Yang Bai1, Yong Chen1, Xinyu Hong1, Xinrui Liu1, Xing Su2, Shanji Li1, Xuechao Dong1, Gang Zhao3, Yunqian Li4. 1. Department of Neurosurgery, First Hospital of Jilin University, Changchun, China. 2. Laboratory of Cancer Precision Medicine, First Hospital of Jilin University, Changchun, China. 3. Department of Neurosurgery, First Hospital of Jilin University, Changchun, China. zhao_gangjlu@aliyun.com. 4. Department of Neurosurgery, First Hospital of Jilin University, Changchun, China. 13943188080@163.com.
Abstract
Glioblastoma (GBM) is the most serious and most common brain tumor in humans. Despite recent advances in the diagnosis of GBM and the development of new treatments, the prognosis of patients has not improved. Multidrug resistance, particularly resistance to temozolomide (TMZ), is a challenge in combating glioma, and more effective therapies are needed. Complementary treatment with the LaSota strain of the naturally oncolytic Newcastle disease virus (NDV-LaSota) is an innovation. In our experiments, the combination therapy of NDV-LaSota and temozolomide (TMZ) was more effective than either treatment alone in inducing apoptosis in glioma cells. NDV can function as a tumor cell selective approach to inhibit AKT and activate AMPK. Consequently, mTOR, 4EBP1 and S6K were also suppressed. The combination therapy of NDV and TMZ also significantly extended survival in a rat xenograft tumor model. In conclusion, NDV suppress AKT signaling and enhances antitumor effects of TMZ. Our study provides one of the theoretical basis for the use of a combined therapy of TMZ and NDV, which could benefit GBM patients.
Glioblastoma (GBM) is the most serious and most common brain tumor in humans. Despite recent advances in the diagnosis of GBM and the development of new treatments, the prognosis of patients has not improved. Multidrug resistance, particularly resistance to temozolomide (TMZ), is a challenge in combating glioma, and more effective therapies are needed. Complementary treatment with the LaSota strain of the naturally oncolytic Newcastle disease virus (NDV-LaSota) is an innovation. In our experiments, the combination therapy of NDV-LaSota and temozolomide (TMZ) was more effective than either treatment alone in inducing apoptosis in glioma cells. NDV can function as a tumor cell selective approach to inhibit AKT and activate AMPK. Consequently, mTOR, 4EBP1 and S6K were also suppressed. The combination therapy of NDV and TMZ also significantly extended survival in a rat xenograft tumor model. In conclusion, NDV suppress AKT signaling and enhances antitumor effects of TMZ. Our study provides one of the theoretical basis for the use of a combined therapy of TMZ and NDV, which could benefit GBM patients.
Among the primary malignant intracranial tumors, glioblastoma (GBM) is the most common and is associated with a very unfavorable prognosis[1]. The current standard treatment for newly diagnosed GBM is surgical resection followed by radiotherapy plus auxiliary temozolomide (TMZ)[2]. Unfortunately, even with this treatment the prognosis of GBM is relatively poor with a median progression-free survival (PFS) of slightly less than 7 months, a median overall survival (OS) of only 15 months, and a 5-year survival rate after diagnosis of less than 10%[1,2]. Rapid recurrence and multidrug resistance of GBM are some of the major challenges that complicate its treatment[3].TMZ is the first-line clinical chemotherapeutic used in the treatment of GBM. Recent studies[3,4] suggested that AMPK activation is among the multiple cytotoxic mechanisms of TMZ. In addition, accumulating evidence shows that GBM features hyperactive AKT signaling and that clinical use of TMZ can stimulate endogenous AKT kinase activity[5], which is involved in various cellular processes, including cell survival, growth, metabolism, and proliferation[6]. Although some studies have considered combination therapy with TMZ and other drugs, the effectiveness of such therapy has not been demonstrated[3,7].More than half a century ago, the use of oncolytic viruses (OVs) for the treatment of certain types of malignancies was introduced. Newcastle disease virus (NDV) is a naturally occurring virus that has been evaluated for the treatment of glioma in early-phase studies[1,8]. The selective, targeted elimination of tumor cells by NDV based on the presence of defective interferon signaling in tumor tissue shows that this treatment induce an effective antiviral response to hamper viral replication in normal tissue[9]. Some studies have indicated that NDV can increase apoptosis by suppressing AKT signaling[10,11]. Because TMZ and NDV have differing effects on AKT signaling, we tested the anti-tumor effect of this combination therapy.In the present study, we first demonstrated that combined therapy with TMZ and NDV is more effective than either treatment alone for inhibiting growth and inducing cell apoptosis in the T98G, LN18, U251, U87 and C6 cell lines. NDV inhibits AKT and activates AMPK when combined with TMZ, which provides one aspect of the theoretical basis for the use of a combined therapy consisting of TMZ and NDV. The effectiveness of this combination was confirmed in vivo, with the combined therapy yielding significantly smaller tumor volumes and significantly longer median survival times for tumor-bearing rats than either treatment alone. At the same time, pathological examination and blood test analyses of different tissues of normal mice also confirmed the safety of NDV in vivo.
Results
NDV-LaSota reduces GBM cell growth in vitro
First, we examined the effects of NDV-LaSota on the growth of GBM cells in vitro, using four human GBM cell lines, T98G, LN18, U87, and U251, and the rat cell line C6. T98G and LN18 cells were resistant to TMZ, and C6 cells were used to establish ratbrain tumor models. We found that NDV-LaSota reduced the viability of all glioma cell lines in a dose-dependent manner, and the rates of inhibition by NDV-LaSoto on T98G, LN18, U87, U251, and C6 cell proliferation appeared to be similar (Fig. 1A). However, NDV-LaSota had a weaker influence on human umbilical vein endothelial cells (HUVECs) and HEBs (normal cells) than on the other cancer cell lines (Fig. 1B; multiplicity of infection [MOI] 0.1, 1, and 10). Here, we recorded the influence of TMZ on the cell lines as a control (Fig. 1B, TMZ 200 μM). TMZ exhibited similar influences on normal cells and glioma cells in vitro. However, the rate of inhibition in normal cells mediated by NDV was only a fraction of that observed in the tumor cell lines. Similar to that observed at a MOI 10, normal cell viability was reduced by approximately 30%, while tumor cell viability was decreased by more than 70%. Altogether, these data suggest that NDV-LaSota can strongly and safely reduce GBM cell growth in vitro.
Figure 1
NDV-LaSota and the combination of TMZ and NDV reduce GBM cell growth in vitro. (A) We infected the T98G, LN18, U251, U87 and C6 cell lines with different MOIs (0, 0.1, 1, or 10) of NDV-LaSota and analyzed cell viability at 36 hours using an MTT assay. The data are presented as the mean ± SD, (*P < 0.01, n = 3, MOI 0.1 vs control, MOI 1 vs MOI 0.1, MOI 10 vs MOI 0.1). (B) Growth inhibition rates after infection of the same strains with the same MOIs as in (A). Every MOI of NDV-LaSota had lower inhibitory effects on HUVECs and HEB cells than on any cancer cell line. TMZ (200 μM) had the same effects on cancer cell lines and normal cell lines (*P < 0.01, n = 3, HUVECs and HEBs vs cancer cell lines). (C) GBM cells were treated with medium, TMZ (200 μM), NDV-LaSota (MOI 1), or a combination of TMZ (200 μM) and NDV-LaSota (MOI 1) (*P < 0.01, n = 3, TMZ and NDV vs control; Δ* P < 0.01, n = 3, TMZ and NDV vs TMZ alone or NDV alone). All results were obtained 36 hours after infection with NDV.
NDV-LaSota and the combination of TMZ and NDV reduce GBM cell growth in vitro. (A) We infected the T98G, LN18, U251, U87 and C6 cell lines with different MOIs (0, 0.1, 1, or 10) of NDV-LaSota and analyzed cell viability at 36 hours using an MTT assay. The data are presented as the mean ± SD, (*P < 0.01, n = 3, MOI 0.1 vs control, MOI 1 vs MOI 0.1, MOI 10 vs MOI 0.1). (B) Growth inhibition rates after infection of the same strains with the same MOIs as in (A). Every MOI of NDV-LaSota had lower inhibitory effects on HUVECs and HEB cells than on any cancer cell line. TMZ (200 μM) had the same effects on cancer cell lines and normal cell lines (*P < 0.01, n = 3, HUVECs and HEBs vs cancer cell lines). (C) GBM cells were treated with medium, TMZ (200 μM), NDV-LaSota (MOI 1), or a combination of TMZ (200 μM) and NDV-LaSota (MOI 1) (*P < 0.01, n = 3, TMZ and NDV vs control; Δ* P < 0.01, n = 3, TMZ and NDV vs TMZ alone or NDV alone). All results were obtained 36 hours after infection with NDV.
NDV-LaSota combined with TMZ has an enhanced inhibitory effect on GBM cell proliferation
To determine whether addition of NDV to TMZ can augment the antiproliferative effects of TMZ in GBM cells, we cultured tumor cells with TMZ alone, NDV alone, TMZ and NDV, or standard medium alone. According to the results of MTT assays, the combination of TMZ and NDV was more effective than either the drug or virus alone at inhibiting the proliferation of T98G, LN18, U87, U251, and C6 cells (Fig. 1C).
NDV-LaSota combined with TMZ has an enhanced proapoptotic effect on glioma cells in vitro
Next, we analyzed the effects of the combination of TMZ and NDV on glioma cell apoptosis. We found that the combination clearly induced more apoptosis than the drug or the virus alone in every GBM cell line tested, including T98G, LN18, U251, U87, and C6 cells (Fig. 2). For all cell lines, the groups treated with the combination of TMZ and NDV displayed the highest apoptosis rates, and the differences between those groups and the single-treatment groups were obvious. For example, compared with that in control T98G cells (5.9% ± 0.1%), the rates of apoptosis in T98G cells treated with 200 µM TMZ alone or NDV alone at a MOI 1 alone were greater (9.7 ± 0.7% and 25.1 ± 1.4%, respectively, both P < 0.01, n = 3), and treatment with both 200 µM TMZ and NDV at a MOI 1 induced a higher rate of apoptosis in the glioma cells (37.1 ± 2.5%, ΔP < 0.01, n = 3).
Figure 2
Apoptosis among cell lines treated with PBS, TMZ, NDV or a combination of TMZ and NDV for 36 h. Representative flow charts for the apoptotic populations of T98G, LN18, U251, U87 and C6 are shown. The column graph on the right shows the quantification of T98G, LN18, U251, U87 and C6 apoptosis (*P < 0.01, n = 3, TMZ and NDV vs control; Δ* P < 0.01, n = 3, TMZ and NDV vs TMZ alone or NDV alone).
Apoptosis among cell lines treated with PBS, TMZ, NDV or a combination of TMZ and NDV for 36 h. Representative flow charts for the apoptotic populations of T98G, LN18, U251, U87 and C6 are shown. The column graph on the right shows the quantification of T98G, LN18, U251, U87 and C6 apoptosis (*P < 0.01, n = 3, TMZ and NDV vs control; Δ* P < 0.01, n = 3, TMZ and NDV vs TMZ alone or NDV alone).
NDV-LaSota activates AMPK, inhibits AKT signaling, and promotes apoptosis in a dose-dependent manner in T98G cells
We next analyzed the expression of factors involved in apoptosis-associated signaling pathways in glioma cells after the different treatments. The levels of the apoptosis-related proteins cleaved caspase-3, cleaved poly (ADP-ribose) polymerase (PARP)-1, Bax, and cleaved Bid increased in a dose-dependent manner after NDV infection of T98G cells (Fig. 3A). Although we did not observe a decrease in Bcl-2 (Fig. 3A), we did find that the level of Bcl-xL declined (Fig. 3A), and the Bax/Bcl-2 ratio increased (Fig. 3A). These results are consistent with those of the proliferation assay (Fig. 1) and apoptosis assay (Fig. 2). Western blotting confirmed that NDV-LaSota inhibited AKT signaling in T98G cells. We determined that the virus affected AKT signaling rather than PI3K p85 (Tyr458) signaling. The expression of phosphorylated (p)-mammalian target of rapamycin (mTOR, Ser2448), p-4EBP1 (Thr37/46) and p-S6K (Thr389) was down-regulated in turn with down-regulation of p-AKT (Ser473, Fig. 3B). In addition, we found activation of AMPK (Thr172) in response to NDV (Fig. 3B).
Figure 3
(A) Expression of apoptotic proteins in T98G cells at 36 hours after infection with NDV-LaSota at 0, 0.1, 1 and 10 MOI increased in a dose-dependent manner. β-Tubulin was used as a control. (B) In T98G cells, the AKT/mTOR pathway was inhibited as the MOI of NDV was increased, and AMPK was significantly activated. (C,D) Time course showing the induction of cell death in relation to AKT and AMPK signaling after NDV infection. (E) Viral RNA levels in the medium relative to those from HEB cells (****P < 0.0001, n = 3).
(A) Expression of apoptotic proteins in T98G cells at 36 hours after infection with NDV-LaSota at 0, 0.1, 1 and 10 MOI increased in a dose-dependent manner. β-Tubulin was used as a control. (B) In T98G cells, the AKT/mTOR pathway was inhibited as the MOI of NDV was increased, and AMPK was significantly activated. (C,D) Time course showing the induction of cell death in relation to AKT and AMPK signaling after NDV infection. (E) Viral RNA levels in the medium relative to those from HEB cells (****P < 0.0001, n = 3).The levels of the apoptosis-related proteins cleaved PARP-1 and cleaved Bid also increased in a time-dependent manner after NDV infection in T98G and LN18 cells, particularly after 24 hours. AKT signaling was gradually suppressed after NDV infection of these cell lines, and AMPK was activated (Fig. 3C). The MTT assay (Fig. 3D) further confirmed the time dependency of the effects of NDV on T98G and LN18 cell apoptosis.We used real-time quantitative polymerase chain reaction (PCR) analysis to determine the level of NDV replication in T98G cells and normal cells. We found that the virus replication in T98G cells was more than 700 times that in HEB cells, and the virus replication in the HUVECs was only 20% higher than that in HEB cells (Fig. 3E).
NDV-LaSota inhibits activation of AKT signaling, promotes apoptosis in five GBM cell lines, and acts as an AMPK-activating agent in T98G cells
Previous research has demonstrated that treatment of cells with TMZ can activate AKT[12] and p-AKT increases GBM cell resistance to TMZ[5]. NDV-LaSota inhibits the proliferation of GBM by down-regulating p-AKT. To explore whether NDV-LaSota also enhances the cytotoxicity of TMZ by down-regulating AKT signaling, we analyzed these changes after various drug or virus treatments (TMZ, NDV, or TMZ plus NDV) in T98G, LN18, U87, U251, and C6 cells. As shown in Fig. 4A, treatment with the combination of TMZ and NDV increased the levels of the apoptosis-related proteins cleaved caspase-3, cleaved PARP-1, and cleaved Bid as well as Bax/Bcl-2 and Bax/Bcl-xL in the T98G and LN18 cells (Fig. 4A). Moreover, activation of p-AKT (Ser473), p-mTOR (Ser2448), p-4EBP1 (Thr37/46), and p-S6K (Thr389) by TMZ (Fig. 4B) was inhibited by the combination treatment (Fig. 4B) in the T98G and LN18 cells. We also verified the presence of p-AKT in the other three cell lines (Fig. 4C). Previous studies performed by our team have shown that alteration in the AMPK pathway may be the mechanism underlying the synergism between AMPK-activating agents and TMZ, but AMPK activation is not the only mechanism responsible for the effects of the combination of TMZ and AMPK-activating agents[3]. In the present study, we found that NDV-LaSota was an AMPK-activating agent in the examined GBM cell lines (Fig. 4B). Notably, compared with that in LN18 cells, AMPK activation in T98G cells was more obvious.
Figure 4
(A) Among T98G and LN18 cells treated for 36 hours with PBS, TMZ (200 μM), NDV (MOI 1) or a combination of TMZ (200 μM) and NDV (MOI 1), the combination-treated cells showed the most obvious signs of apoptosis at the protein level. (B) The AKT/mTOR pathway was markedly inhibited, and AMPK was activated. (C) Similar AKT suppression was also found in the U87, U251 and C6 cell lines. (D) T98G and LN18 cells were treated with TMZ (200 μM), NDV (moi 1), MK2206 (2 μM) or their combination for 42 hours; p-AKT, AKT and β-tubulin were detected by Western blotting. (E,G) Cell viability was detected by MTT assay (*P < 0.05). (F) T98G and LN18 cells were treated with TMZ (200 μM), NDV (MOI 1), compound C (2 μM) or their combination for 42 hours; p-AMPK, AMPK and β-tubulin were detected by Western blotting. (H) T98G and LN18 cells were treated with TMZ (200 μM), AT13148 (5 μM) or their combination for 36 hours; p-AKT, AKT, Parp1, cleaved BID and β-tubulin were detected by Western blotting. (I) Cell viability was detected by MTT assay (*P < 0.05, AT13148 and TMZ vs TMZ alone or AT13148 alone).
(A) Among T98G and LN18 cells treated for 36 hours with PBS, TMZ (200 μM), NDV (MOI 1) or a combination of TMZ (200 μM) and NDV (MOI 1), the combination-treated cells showed the most obvious signs of apoptosis at the protein level. (B) The AKT/mTOR pathway was markedly inhibited, and AMPK was activated. (C) Similar AKT suppression was also found in the U87, U251 and C6 cell lines. (D) T98G and LN18 cells were treated with TMZ (200 μM), NDV (moi 1), MK2206 (2 μM) or their combination for 42 hours; p-AKT, AKT and β-tubulin were detected by Western blotting. (E,G) Cell viability was detected by MTT assay (*P < 0.05). (F) T98G and LN18 cells were treated with TMZ (200 μM), NDV (MOI 1), compound C (2 μM) or their combination for 42 hours; p-AMPK, AMPK and β-tubulin were detected by Western blotting. (H) T98G and LN18 cells were treated with TMZ (200 μM), AT13148 (5 μM) or their combination for 36 hours; p-AKT, AKT, Parp1, cleaved BID and β-tubulin were detected by Western blotting. (I) Cell viability was detected by MTT assay (*P < 0.05, AT13148 and TMZ vs TMZ alone or AT13148 alone).
Combination treatment of glioma cells with NDV and TMZ more effectively restricts cancer cell growth than combination treatment with AKT inhibitor and TMZ
We used MK-2206 (2 μM) as an AKT inhibitor to block AKT signaling. We found that the combined effect was partially but significantly reversed (Fig. 4D,E, P < 0.05, n = 3) in T98G cells. However, AKT inhibition did not prevent all the effects of combination treatment with NDV and TMZ in glioma cells, but the NDV plus TMZ combination treatment did prevent the effects of the AKT inhibitor on glioma cells.To determine the involvement of AMPK signaling in the effects of combined treatment with NDV and TMZ, we used the AMPK inhibitor compound C (2 μM) to block AMPK signaling. As shown in Fig. 4F,G, we observed a small but statistically significant effect on cell viability (P > 0.05, n = 3). This shows that the AMPK signaling pathway plays only a partial role here, not the main one.To further confirm the mechanism of combined treatment with NDV and TMZ, we used AT13148 as a kinase inhibitor of the AKT pathway to recapitulate the effect of combined treatment with NDV and TMZ in vitro (Fig. 4H,I). The effect of AT13148 was statistically significant (P < 0.05, n = 3), although not as strong as the effect of NDV.
Combination of TMZ and NDV shows good therapeutic effects in vivo in an intracranial tumor model
We also examined whether the combination therapy has an appreciable anti-glioma effect in vivo. Eight days after intracranial injection of C6 cells, we examined the rats by magnetic resonance imaging (MRI) (3.0 T, Philips) to assess tumor growth (Fig. 5A) after the application of different treatments to the different groups of rats. Encouragingly, the combination of NDV and TMZ significantly prolonged the median survival of the intracranial tumor-bearing rats as shown in the Kaplan-Meier curves (Fig. 5B). The median survival times were 18.5, 23.5, and 23.5 days for the control, NDV-LaSota, and TMZ groups, respectively (n = 6), and the median survival time of the combined treatment group was 32.5 days (n = 6). At 18 days after intracranial injection of C6 cells, we randomly euthanized two rats (No. 1 and No. 6) from each group and collected the brains. We found that the group treated with the combination of TMZ and NDV-LaSota had significantly smaller tumors than the other groups (Fig. 5C). Due to the small number of animals (two rats), we did not perform statistical analysis of the tumor volume. Immunohistochemical staining for p-AKT (Ser473) and p-4EBP1 (Thr37/46) in the implanted tumors showed that NDV-LaSota also inhibited p-AKT (Ser473) and p-4EBP1 (Thr37/46) in vivo (Fig. 5D).
Figure 5
(A) Eight days after Wistar rats were intracranially injected with C6 cells, creation of the animal models was confirmed by MRI. (B) Survival curves for the animals in the four experimental groups. (C) Eighteen days after intracranial injection of C6 cells, intracranial tumor growth was significantly inhibited in the combination-treated group. (D) Immunohistochemistry analysis of p-AKT(Ser473) and p-4EBP1(Thr37/46) in the implanted tumors. (E) Twenty-four normal rats were intravenously injected with saline, 2 × 107 pfu NDV, or 5 × 107 pfu NDV once every 3 days for a total of three injections, and blood was then collected for routine and biochemical examination. White blood cell and platelet counts differed significantly among the groups, but all values were within the normal ranges. The remaining indices did not differ significantly among the groups (*P < 0.05, n = 6).
(A) Eight days after Wistar rats were intracranially injected with C6 cells, creation of the animal models was confirmed by MRI. (B) Survival curves for the animals in the four experimental groups. (C) Eighteen days after intracranial injection of C6 cells, intracranial tumor growth was significantly inhibited in the combination-treated group. (D) Immunohistochemistry analysis of p-AKT(Ser473) and p-4EBP1(Thr37/46) in the implanted tumors. (E) Twenty-four normal rats were intravenously injected with saline, 2 × 107 pfu NDV, or 5 × 107 pfu NDV once every 3 days for a total of three injections, and blood was then collected for routine and biochemical examination. White blood cell and platelet counts differed significantly among the groups, but all values were within the normal ranges. The remaining indices did not differ significantly among the groups (*P < 0.05, n = 6).
NDV-LaSota has little or no adverse effects on rats
To demonstrate that the live virus did not harm the rats, we randomly divided 18 healthy rats into three groups that received an intravenous injection of 0.5 ml normal saline, 0.2 ml of NDV-LaSota (2 × 107 pfu), or 0.5 ml of NDV-LaSota (5 × 107 pfu) every 3 days for 9 days. The results of blood tests and pathological examinations of the heart, liver, kidneys, lungs, and brain by hematoxylin and eosin (HE) staining were then compared among the groups (Fig. 6). The blood test results showed no differences in the indicators among the groups (Fig. 5E). Pathological examinations revealed that all the rats were in good health, independent of virus injection.
Figure 6
Representative histological images showing no lesions in the organs of rats after the injection.
Representative histological images showing no lesions in the organs of rats after the injection.
Discussion
To date, no effective targeted therapies for GBM are available[13]. A wide range of novel treatments are being studied, but so far, few of these treatments have been found to be effective. Currently, postoperative radiotherapy combined with TMZ chemotherapy remains the standard treatment for GBM, but its effects are limited[2,11,13-15]. Drug resistance can occur through several mechanisms, such as the high expression of MGMT (O6-methylguanine DNA methyltransferase), base excision repair (BER), acquired drug resistance, and constitutively active AKT/PI3K/mTOR/nuclear factor (NF)-κB signaling[5,12,15]. Inspired by early studies performed by our team[3,16], we aimed to inhibit AKT activation to achieve a breakthrough in our understanding of drug resistance in GMB cells. We focused on OVs because many researchers have used bacteriophages to attack super-resistant bacteria. Previous studies[11] showed that NDV strongly inhibits AKT. NDV offers the advantage that T cells and other immune cell function are not impaired by non-specific AKT inhibition via small-molecule inhibitors such as AT13148 and MK-2206 2HCL[17]. In the present study, we innovatively attempted to inhibit GBM using a combination of NDV and TMZ, and this creative approach yielded exciting results.First, our in vitro results showed that NDV significantly inhibits the proliferation of GBM cells (the T98G, LN18, U87, U251, and C6 lines) and induces apoptosis in GBM cells. However, in HUVECs and HEBs, the impact of NDV was minimal, and virus replication appeared to be blocked in these normal cell lines (Fig. 3E). The tumor inhibitory effect was dose- and time-dependent (Figs 1 and 3). Inhibition of anti-apoptotic proteins, such as Bcl-xL, can promote cancer[5], and our Western blot analysis demonstrated that NDV-LaSota could reduce the expression of Bcl-xL in T98G cells and significantly activate Bax, Bad, Bid, caspase-3, and PARP-1. Furthermore, we observed constitutive activation of AMPK and powerful inhibition of AKT, mTOR, 4EBP1, and S6K in treated GBM cells.Next, we tested TMZ and NDV in combination, and our results showed that the combination had a greater inhibitory effect than either component alone, demonstrating that the two treatments can work together. Western blot analysis showed that the combined treatment significantly reduced the expression of Bcl-xL in T98G cells and Bcl-2 in LN18 cells. It also activated caspase-3, Bax, Bad, Bid, and PARP-1. Moreover, NDV-LaSota and TMZ activated AMPK simultaneously in T98G cells. AKT inhibition did not block all the effects of the NDV plus TMZ combination in glioma cells but the NDV plus TMZ combination did block the effects of AKT inhibitor in glioma cells, indicating that NDV not only acts through AKT inhibition but also additional possible mechanisms to halt cancer cell growth. Furthermore, activation of the AKT pathway by TMZ was effectively inhibited by NDV. These results were confirmed in T98G, LN18, U87, U251, and C6 cells, according to the findings from MTT, flow cytometry and AKT inhibition analyses. This research aimed to show that NDV has a wide range of tumor suppressive effects. In the present study, we chose T98G and LN18 cells as TMZ-resistant cell lines[7,18] in order to illustrate TMZ resistance can be overcome by combined treatment with NDV, which has great clinical significance.Identification of the molecular mechanism underlying the inhibitory effects of TMZ and NDV is critical for the development of combined therapies as effective novel treatments for GBM. As an energy metabolism protein kinase, AMPK plays a central role as an energy sensor, principally in regulating cell growth and metabolism[2]. P-AMPK down-regulates several anabolic enzymes, leading to the inhibition of cell growth[4]. Both TMZ and NDV induce GBM apoptosis in vitro through AMPK activation, but this AMPK activation is not the only mechanism responsible for the effect of TMZ and NDV[3,12]. NDV, as a type of OV, operates via a complex mechanism[1,8,19-23]. Our experiments confirmed that NDV inhibits AKT and activates AMPK when combined with TMZ. This is the first demonstration that NDV can be used as a supplement to TMZ to kill GBM cells in vitro. Figure 7 presents a hypothetical model of the mechanisms influenced by NDV and TMZ.
Figure 7
Proposed mechanism underlying the observed anti-glioma effect of combined treatment with TMZ and NDV-LaSota.
Proposed mechanism underlying the observed anti-glioma effect of combined treatment with TMZ and NDV-LaSota.Our in vivo experiments also showed that NDV-LaSota in combination with TMZ significantly reduced cancer growth and prolonged the median survival of tumor-bearing rats. Additionally, our toxicology experiments showed that the pathogenic effect of NDV on mammals is minimal. These results are similar to those of Csatary and Wagner et al.[1,14]. Moreover, NDV has good anti-tumor potential according to studies investigating other tumor types[4,11,14,15,20,22,23].In conclusion, NDV-LaSota enhanced the cytotoxicity of TMZ not only by down-regulating the AKT–mTOR signaling pathway but also by activating AMPK. This effect was confirmed in vitro and in vivo. This novel combination treatment could offer meaningful new choices for patients with advanced GBM.
Materials and Methods
Reagents
TMZ used in the in vitro study was purchased from Sigma Chemical Co., and TMZ used in the in vivo studies was purchased from Merck Sharp & Dohme Ltd. AT13148, MK-2206 2HCL and Compound C were purchased from Selleck. All reagents were dissolved in dimethyl sulfoxide (DMSO. Sigma Chemical Co.).
Cell culture
The glioma cell lines T98G, U251, LN18, U87, and C6 and the normal cell lines HUVEC and HEB were purchased from ATCC. The first four cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, USA) supplemented with penicillin-streptomycin (100 U/ml, HyClone, USA) and 10% fetal bovine serum (FBS, HyClone) in a humidified atmosphere of 5% CO2 at 37 °C. The C6 cell line was cultured in F-12K medium (Gibco) supplemented with 12.5% horse serum (HyClone), 2.5% FBS (HyClone), and penicillin-streptomycin (100 U/ml, HyClone) in a humidified atmosphere of 5% CO2 at 37 °C. HUVECs were cultured in special medium (Procell, China). The HEB cell line was cultured similarly to the first four cell lines. All cell lines were subcultured once every 2–3 days and dissociated using a 0.25% trypsin and 0.02% EDTA solution.
Propagation of NDV and determination of the infectious titer
The NDV-LaSota strain was obtained from Professor Zhuang Ding, Laboratory of Infectious Diseases, College of Veterinary Medicine, Jilin University. The virus was propagated in 9-day-old specific pathogen-free embryonated chicken eggs by seeding the eggs with the virus, harvesting the allantoic fluid, and purifying it by centrifugation at 5000 rpm at 4 °C for 5 min. The viruses in the supernatant were cryopreserved at −80 °C. The infectious virus titer was determined based on the 50% tissue culture infective dose (TCID50). Briefly, 1 × 104 cells were plated in 96-well plates in complete medium and allowed to attach for 4 hours. Ten serial dilutions of the virus in medium (10−1, 10−2, … 10−10) were prepared. Then, the medium was discarded, and 100 μl of virus diluent was added to each well, with 8 wells per concentration. After 1 hour of incubation in a humidified atmosphere of 5% CO2 at 37 °C, the virus diluent was replaced with complete medium. Changes were monitored every day for 5 days. The cells were examined for the cytopathic effect (CPE), and the TCID50, the concentration necessary to induce a CPE in half the wells, was calculated using the Reed-Muench method.
MTT assay
An MTT assay was used to quantify cell viability. Approximately 2 × 104 cells per well were plated in 96-well plates in complete medium and allowed to attach for 4 hours. Subsequently, NDV, TMZ, NDV + TMZ, or phosphate-buffered saline (PBS) as a control was applied to three replicate wells. After 36 hours of incubation, 20 μl of MTT solution (5 mg/ml) was added to each well. Four hours later, the solution in the wells was discarded, and 150 μl DMSO was added. The absorption at 450 nm (OD450) was measured on a microplate reader. Cell viability was expressed as a percentage of the control.
Apoptosis assays
Apoptosis was quantified as a percentage using an apoptosis detection kit (BD Biosciences). The procedure was conducted according to the manufacturer’s instructions, and the numbers of viable, apoptotic and necrotic cells were calculated with FACSDiva version 6.2.
Western blotting
Protein was extracted from the cultured cells with radioimmunoprecipitation (RIPA) lysis buffer on ice and centrifuged at 12 000 × g for 15 min at 4 °C. The total protein concentration was determined using a BCA protein assay kit (Beyotime Biotechnology, China), and whole lysates mixed with 5 × sodium dodecyl sulfate (SDS) loading buffer were denatured with a 10-minute incubation at 100 °C. Then, equal amounts of protein (30 μg) were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to a polyvinylidene difluoride (PVDF) membrane. After blocking with 5% skim milk for 2 hours at room temperature, the membrane blots were first probed with a primary antibody. After incubation with the horseradish peroxidase (HRP)-conjugated secondary antibody, the protein was visualized using an Odyssey Infrared Imaging System (LI-COR). The images shown in the figure are representative images from at least three separate experiments. The original results are described in the supplementary information.
Real-time quantitative PCR
In six-well plates, we exchanged the fluid at 6 hours after 1 MOI infection and again 30 hours later 200 µl of medium was taken for extraction of the viral RNA (GENSTAR P141-01). Quantitative (q)PCR (TRANSGEN AQ131-01) was performed after reverse transcription (TRANSGEN AT311-02). The following qPCR primers were used: qPCR-La -F: CCATGACTGCGTATGAGACTG, and qPCR-La-R: GACTGTCTGATCGTGAGTTGG.
Intracranial injection of C6 cells
Male Wistar rats were anesthetized with 10% chloral hydrate (0.4 ml/100 g, i.p.) and fixed in a head stereotaxic frame. Each rat was stereotactically injected with 2.5 × 105 C6 cells as follows. A midline incision of approximately 1 cm was made, and a hole was drilled in the skull at the point 0.5 mm anterior and 3 mm to the right of the bregma. Cell suspensions in F-12K (10 μl) were injected with a microsyringe at a rate of 2 μl/min at 2 mm depth, and the syringe was left in place for 5 min. After 8 days, we screened the rats by magnetic resonance imaging (MRI; Fig. 4A). We randomly divided them into four groups (n = 8 per group): control, TMZ, NDV-LaSota, and combination treatment.
Routine and biochemical laboratory blood testing
Blood samples were taken from the abdominal aorta. A blood analysis system (Sysmex, Japan) was used for routine blood tests, and a 7600 automatic biochemical analyzer (HITACHI, Japan) was used for the biochemical examination.
Protocol approval
All the experimental methods in the current study were approved by the research committee at the First Hospital of Jilin University. All the experiments were conducted in accordance with the guidelines issued by that committee. All animal experiments were approved by the Institutional Animal Care and Use Committee at the First Hospital of Jilin University and in compliance with relevant international codes.
Immunohistochemistry
Immunohistochemistry was performed using the HRP/DAB (ABC) Detection IHC kit (Abcam, USA), according to the manufacturer’s instructions. Rabbit anti-pAKT was purchased from Cell Signaling Technology (USA).
Statistical analysis
All experiments were performed in triplicate unless otherwise noted. The results are expressed as the mean ± standard deviation (SD). In addition, P-values less than 0.05 were considered statistically significant. All analyses were performed using GraphPad Prism 7.03.Supplementary information
Authors: K W Reichard; R M Lorence; C J Cascino; M E Peeples; R J Walter; M B Fernando; H M Reyes; J A Greager Journal: J Surg Res Date: 1992-05 Impact factor: 2.192
Authors: Lulu Hu; Sulan Sun; Tianpeng Wang; Yingchun Li; Ke Jiang; Guibin Lin; Yan Ma; Martin P Barr; Fei Song; Guirong Zhang; Songshu Meng Journal: Am J Cancer Res Date: 2015-11-15 Impact factor: 6.166
Authors: Roel G W Verhaak; Sun Ha Paek; Yona Kim; Frederick S Varn; Sung-Hye Park; Byung Woo Yoon; Hye Ran Park; Charles Lee Journal: Acta Neuropathol Commun Date: 2021-03-24 Impact factor: 7.801
Authors: Kaushik Banerjee; Felipe J Núñez; Santiago Haase; Brandon L McClellan; Syed M Faisal; Stephen V Carney; Jin Yu; Mahmoud S Alghamri; Antonela S Asad; Alejandro J Nicola Candia; Maria Luisa Varela; Marianela Candolfi; Pedro R Lowenstein; Maria G Castro Journal: Front Mol Neurosci Date: 2021-03-11 Impact factor: 5.639
Authors: Pavlina Chuntova; Frances Chow; Payal B Watchmaker; Mildred Galvez; Amy B Heimberger; Evan W Newell; Aaron Diaz; Ronald A DePinho; Ming O Li; E John Wherry; Duane Mitchell; Masaki Terabe; Derek A Wainwright; Jay A Berzofsky; Christel Herold-Mende; James R Heath; Michael Lim; Kim A Margolin; E Antonio Chiocca; Noriyuki Kasahara; Benjamin M Ellingson; Christine E Brown; Yvonne Chen; Peter E Fecci; David A Reardon; Gavin P Dunn; Linda M Liau; Joseph F Costello; Wolfgang Wick; Timothy Cloughesy; William C Timmer; Patrick Y Wen; Robert M Prins; Michael Platten; Hideho Okada Journal: Neuro Oncol Date: 2021-03-25 Impact factor: 12.300