Safiye E Sarper1, Hiroshi Kurosaka1, Toshihiro Inubushi1, Hitomi Ono Minagi2, Koh-Ichi Kuremoto3, Takayoshi Sakai2, Ichiro Taniuchi4, Takashi Yamashiro5. 1. Department of Orthodontics and Dentofacial Orthopedics, Osaka University Graduate School of Dentistry, Osaka, Japan. 2. Department of Oral-facial Disorders, Osaka University Graduate School of Dentistry, Osaka, Japan. 3. Department of Advanced Prosthodontics, Graduate School of Biomedical & Health Sciences, Hiroshima University, Hiroshima, Japan. 4. Laboratory for Transcriptional Regulation, RIKEN Research Center for Allergy and Immunology, Yokohama, Japan. 5. Department of Orthodontics and Dentofacial Orthopedics, Osaka University Graduate School of Dentistry, Osaka, Japan. yamashiro@dent.osaka-u.ac.jp.
Abstract
Runx1 deficiency results in an anteriorly specific cleft palate at the boundary between the primary and secondary palates and in the first rugae area of the secondary palate in mice. However, the cellular and molecular pathogenesis underlying such regional specificity remain unknown. In this study, Runx1 epithelial-specific deletion led to the failed disintegration of the contacting palatal epithelium and markedly downregulated Tgfb3 expression in the primary palate and nasal septum. In culture, TGFB3 protein rescued the clefting of the mutant. Furthermore, Stat3 phosphorylation was disturbed in the corresponding cleft regions in Runx1 mutants. The Stat3 function was manifested by palatal fusion defects in culture following Stat3 inhibitor treatment with significant downregulation of Tgfb3. Tgfb3 is therefore a critical target of Runx1 signaling, and this signaling axis could be mediated by Stat3 activation. Interestingly, the expression of Socs3, an inhibitor of Stat3, was specific in the primary palate and upregulated by Runx1 deficiency. Thus, the involvement of Socs3 in Runx1-Tgfb3 signaling might explain, at least in part, the anteriorly specific downregulation of Tgfb3 expression and Stat3 activity in Runx1 mutants. This is the first study to show that the novel Runx1-Stat3-Tgfb3 axis is essential in anterior palatogenesis.
Runx1 deficiency results in an anteriorly specific cleft palate at the boundary between the primary and secondary palates and in the first rugae area of the secondary palate in mice. However, the cellular and molecular pathogenesis underlying such regional specificity remain unknown. In this study, Runx1 epithelial-specific deletion led to the failed disintegration of the contacting palatal epithelium and markedly downregulated Tgfb3 expression in the primary palate and nasal septum. In culture, TGFB3 protein rescued the clefting of the mutant. Furthermore, Stat3 phosphorylation was disturbed in the corresponding cleft regions in Runx1 mutants. The Stat3 function was manifested by palatal fusion defects in culture following Stat3 inhibitor treatment with significant downregulation of Tgfb3. Tgfb3 is therefore a critical target of Runx1 signaling, and this signaling axis could be mediated by Stat3 activation. Interestingly, the expression of Socs3, an inhibitor of Stat3, was specific in the primary palate and upregulated by Runx1 deficiency. Thus, the involvement of Socs3 in Runx1-Tgfb3 signaling might explain, at least in part, the anteriorly specific downregulation of Tgfb3 expression and Stat3 activity in Runx1 mutants. This is the first study to show that the novel Runx1-Stat3-Tgfb3 axis is essential in anterior palatogenesis.
Cleft palate (CP) represents one of the major congenital craniofacial birth defects[1,2]. This condition demonstrates anatomical impairments with various combinations of the defects involving the soft and hard palates, the nasal septum and the alveolar ridge. Palatogenesis requires several developmental steps involving palatal shelf growth and elevation, as well as fusion of the palatal shelves. The palatal fusion begins at the midline of the future secondary palate following bilateral outgrowth of the maxillary process. Thereafter, the anterior secondary palate fuses to the primary palate and the dorsal portions of the secondary palate fuse with the nasal septum. Following contact, the intervening epithelium between the abutted shelves merges to form the epithelium seam that must be removed to provide mesenchymal continuity throughout the fused palate[3,4]. Fusion is crucial for the correct formation of the palate, and its defect can lead to CP. Although recent studies using genetically modified mice and human genetics studies have identified numerous genetic and environmental etiology for cleft palate, the etiology that explains the diversity in morphology in cleft palate has remained largely unknown.We previously demonstrated that Runx1 participates in the pathogenesis of cleft palate using Runx1-null mutants carrying a Gata1 promoter-driven Runx1 transgene (Gata1-Runx1/Runx1−/−)[5]. Runx1 is a member of the Runx family of genes that encode transcription factors that play various important roles in embryogenesis[6] and is a key molecule of hematopoiesis-causative genes in the development of leukemia and other hematopoietic disorders[7,8]. Runx1 is also involved in cancer development[9,10]. Indeed, families with children diagnosed with acute lymphoblastic leukemia reported a family history of clefts more often than control families[11], and adult individuals who survived cancer reported a family history of cleft palate more often than controls[12]. Microdeletion encompassing RUNX1 causes Braddock–Carey syndrome, which is characterized by distinct patterns of anomalies, including thrombocytopenia and cleft palate[13].Although Runx1 is expressed in the fusing epithelium of the developing palatal shelf throughout the AP axis, it is of interest that Runx1 mutants develop a localized anterior palatal clefting due to failed fusion between the primary and secondary palates and at the anterior-most part of the secondary palate corresponding to the 1st rugae[5]. This finding indicates that Runx1 is involved in a different regulatory mechanism for the palatal fusion along the anterior-posterior (AP) axis. Several studies have also revealed such different regulatory mechanism of palatogenesis along the AP axis of the palate[14,15]. Some transcription factors and signaling molecules, such as Msx1, Bmp4, Shh, Fgf10, Fgf7, and Shox2 are recognized as anterior-specific[14,15]. Spatial distribution of such genes within the palate, together with the palatal phenotypes in their null mutant, clearly highlights the importance of regionally specific regulatory mechanism at the molecular level. However, the majority of experiments have focused on the palatal fusion of the secondary palate, and there is less understanding of the mechanisms in the anterior region between the primary and secondary palate and in the first rugae area of the second palate. Indeed, how Runx1 is involved in anterior-specific clefting has not been investigated.In mouseskin cancer formation and maintenance, signal transducer and activator of transcription 3 (Stat3) is activated by Runx1 signaling as a tumor promoter[16,17]. The JAK/STAT pathway is the principal signaling mechanism for a wide array of cytokines and growth factors[18,19]. Upon activation, phosphorylated Stats dimerize and translocate to the nucleus, where they modulate the expression of target genes. It has been established that Stat3 is activated in a number of epithelial cancers[19], in immune response, and also in response to various environmental signals[20]. Heterozygous loss-of-function mutations in STAT3 lead to the primary immune deficiency Hyper-IgE syndrome and interestingly the cleft palate is observed in this syndrome[21]. However, little is known about the possible mechanisms underlying involvement of Stat3 in the pathogenesis of the cleft palate.Runx1 deficiency results in an anteriorly specific cleft palate at the boundary between the primary and secondary palates and in the first rugae area of the secondary palate in mice[5]. However, the cellular and molecular pathogenesis underlying such regional specific cleft palate remain unknown. In this study, using epithelial-specific Runx1 deletion mice, we demonstrate that Tgfb3 is an essential target of Runx1 signaling in anterior-specific disintegration of the fusing palatal epithelium and that the site-specific downregulation of Stat3 phosphorylation plays a central role in downregulating the Tgfb3 expression and manifesting palatal clefting upon Runx1 loss. We also show that the pharmaceutical inhibition of Stat3 signaling disturbs the expression of Tgfb3 as well as of Runx1, leading to failure of palatal fusion. In addition, we show that the involvement of Socs3 in Runx1-Tgfb3 signaling explain, at least in part, the anteriorly specific downregulation of Tgfb3 expression and decreased Stat3 activity in Runx1 mutants. Together, we demonstrate that Stat3-mediating Runx1-Tgfb3 axis is a novel regulatory pathway that regulates the palatal fusion in the anterior regions.
Results
Palatal phenotypes in Runx1 mutants
We previously reported that Gata1-Runx1/Runx1−/− mice exhibit anterior clefting between the primary and secondary palates and in the first rugae region of the secondary palate and that Runx1 is specifically expressed in the fusing epithelium, but the mechanisms underlying this phenotype remained largely unknown[5]. Since Gata1-Runx1/Runx1−/− mice died within a few hours after birth, it was possible that the cleft palate phenotype was simply a consequence of delayed development. To extend the finding and examine how Runx1 regulates the anterior-specific palatal fusion in detail, we used epithelial-specific Runx1 deletion mice (K14-Cre/Runx1fl/fl).We also confirmed the efficiency of K14-Cre recombination using Rosa26R reporter mice at E15.0. β-gal staining was performed in the K14-Cre;R26Rmice, and we confirmed that Cre recombination had been successfully performed in embryonic mouse in anterior palatogenesis. β-gal-positive cells were intense at the epithelium overlying the palatal process of the secondary palate and the primary palate (Fig. S1). The positive cells were evident in the contacting (B–E) and fused epithelium (F–H); however, no positive cells were detected in the mesenchyme underlying the palatal epithelium (Fig. S1).As presumed, the present K14-Cre/Runx1fl/fl mice demonstrated an anterior cleft that was similar to that of previous Gata1-Runx1/Runx1−/− mice and survived after birth. An anterior cleft palate was confirmed in the mutants at P50 (Figs 1A,B and S2), clearly indicating that anterior cleft is not due to delayed development of the palate. This palatal phenotype was evident at P0 in more than 90% of the mutants (Fig. 1C,D,G). The palatal phenotype was not evident at E15.0 by direct observation (Fig. 1E,F).
Figure 1
Palatal phenotypes of K14-Cre/Runx1 mice. (A–F) Occlusal views of control and K14-Cre/Runx1 mouse palate. An anterior cleft palate was evident at the boundary between the primary and secondary palate and at the first rugae area of the secondary palate in the Runx1 mutant palate at both P50 and P0 (B,D, red arrowheads). Palatal phonotype was not evident at E15.0 (E,F). Scale bar: 1000 μm, P50; 500 μm, P0 and E15.0. (G) Frequency of anterior cleft of control and Runx1 mutant mice at P0. (H) Diagram of the palate shows the position of the frontal section for panels (I–N). The upper sections (I,J) are from the area indicated by the red line (H), the middle one (K,L) by blue line, and the lower ones (M,N) by the black line. (I–N) Histological sections at E17.0 revealed the failure in palatal fusion in the Runx1 mutant shelves (J,L, arrowheads). Scale bar: 200 μm. pp, primary palate; sp, secondary palate; ns, nasal septum; vo, vomeronasal organ; if, incisive foramen; 1St, 1st rugae; 2nd, 2nd rugae.
Palatal phenotypes of K14-Cre/Runx1mice. (A–F) Occlusal views of control and K14-Cre/Runx1mouse palate. An anterior cleft palate was evident at the boundary between the primary and secondary palate and at the first rugae area of the secondary palate in the Runx1 mutant palate at both P50 and P0 (B,D, red arrowheads). Palatal phonotype was not evident at E15.0 (E,F). Scale bar: 1000 μm, P50; 500 μm, P0 and E15.0. (G) Frequency of anterior cleft of control and Runx1 mutant mice at P0. (H) Diagram of the palate shows the position of the frontal section for panels (I–N). The upper sections (I,J) are from the area indicated by the red line (H), the middle one (K,L) by blue line, and the lower ones (M,N) by the black line. (I–N) Histological sections at E17.0 revealed the failure in palatal fusion in the Runx1 mutant shelves (J,L, arrowheads). Scale bar: 200 μm. pp, primary palate; sp, secondary palate; ns, nasal septum; vo, vomeronasal organ; if, incisive foramen; 1St, 1st rugae; 2nd, 2nd rugae.Histological analyses revealed that there was a cleft between the primary and secondary palate and in the first rugae area the secondary palate in Runx1 mutants at E17.0 (Fig. 1I–L). In the more posterior regions, the fused palate in Runx1 mutants did not make contact with the nasal septum, even though the septal cartilage was almost normal in size (Fig. 1K,L). Palatal phenotypes were not evident more posteriorly than the point of the 2nd rugae (Fig. 1M,N). Although we used different genetically modified mice to study the function of Runx1 in palatogenesis in this study, the current histological findings are similar to the previous ones[5]. These findings confirmed that Runx1 is essential in anterior-specific palatogenesis.
Characterization of the fusing epithelium of Runx1 mutants
Like the medial edge epithelium (MEE) that is localized at the junction between the secondary palates, the epithelial remnants appeared at the junction between the primary and the secondary palate at the anterior part of the palate (arrowheads in Fig. 2A). In Runx1 mutant samples, immunostaining for K14 revealed that 75% of the mutants (15/20) at E15.0 had partial contact between the primary and secondary palate, and that thick K14-immunoreactive epithelial remnants (arrowhead in Fig. 2B) were detected at the interface. In contrast, 25% of the mutants (5/20) showed no contact between the nasal septum and the secondary palate and epithelial remnants were not formed at E15.0 (Fig. 2C). It has been established that, during epithelial fusion, the MEE ceases proliferation and undergoes apoptosis[22,23], and the periderm overlying the fusing epithelium is removed[24]. Thereafter, the epithelial remnants need to degrade to achieve mesenchymal confluence[25].
Figure 2
Palatal phenotypes of K14-Cre/Runx1 mice. (A–C) Immunostaining for K14 at the boundary between the primary and secondary palate. (A) In controls, the epithelial remnants (arrowheads) are formed in the process of anterior palatal fusion. (B) In Runx mutants, 75% had partial contact at E15.0, and K14-immunoreactive epithelial remnants (B, arrowhead) were retained between the primary and the secondary palate: (C) 25% of the mutants did not have any contact. Scale bar: 100 μm. (D–G) TUNEL staining of frontal sections of the primary and secondary palates at E15.0. Scale bar: 100 μm. TUNEL-positive cells were fewer and sparse on the unfused epithelium in Runx1 mutants. (H) The percentage of TUNEL-positive cells on the contacting epithelium. (I,J) Immunostaining for Ki67(green) and K14(red) revealed less proliferative cells in the epithelial remnants in wild-type mice (I), while some Ki67 signals were retained in the epithelial remnants in Runx1 mutants (arrowheads in J). Scale bar: 50 μm. (K) The percentage of Ki67 positive cells. (L,M) Immunostaining for K17 (green) revealed that K17-immunoreactive periderm cells were retained on the surface of the nasal septum and the nasal side of the secondary palate in Runx1 mutants. Nuclei were counterstained with DAPI (blue). The arrowhead indicates persistent periderm (arrowheads in M). Scale bar: 100 μm. (N,O) BrdU staining revealed that there were no marked changes in the BrdU signals in the palatal mesenchyme due to Runx1 deficiency at E15.0. Scale bar: 200 μm. pp, primary palate; sp, secondary palate; ns, nasal septum; vo, vomeronasal organ.
Palatal phenotypes of K14-Cre/Runx1mice. (A–C) Immunostaining for K14 at the boundary between the primary and secondary palate. (A) In controls, the epithelial remnants (arrowheads) are formed in the process of anterior palatal fusion. (B) In Runx mutants, 75% had partial contact at E15.0, and K14-immunoreactive epithelial remnants (B, arrowhead) were retained between the primary and the secondary palate: (C) 25% of the mutants did not have any contact. Scale bar: 100 μm. (D–G) TUNEL staining of frontal sections of the primary and secondary palates at E15.0. Scale bar: 100 μm. TUNEL-positive cells were fewer and sparse on the unfused epithelium in Runx1 mutants. (H) The percentage of TUNEL-positive cells on the contacting epithelium. (I,J) Immunostaining for Ki67(green) and K14(red) revealed less proliferative cells in the epithelial remnants in wild-type mice (I), while some Ki67 signals were retained in the epithelial remnants in Runx1 mutants (arrowheads in J). Scale bar: 50 μm. (K) The percentage of Ki67 positive cells. (L,M) Immunostaining for K17 (green) revealed that K17-immunoreactive periderm cells were retained on the surface of the nasal septum and the nasal side of the secondary palate in Runx1 mutants. Nuclei were counterstained with DAPI (blue). The arrowhead indicates persistent periderm (arrowheads in M). Scale bar: 100 μm. (N,O) BrdU staining revealed that there were no marked changes in the BrdU signals in the palatal mesenchyme due to Runx1 deficiency at E15.0. Scale bar: 200 μm. pp, primary palate; sp, secondary palate; ns, nasal septum; vo, vomeronasal organ.In this study, we first performed in vivo characterization of these anterior epithelial remnants. TUNEL staining revealed evident apoptosis in controls (Fig. 2D), whereas there were far fewer TUNEL-positive cells on the unfused epithelium of the Runx1 mutants in the corresponding regions (Fig. 2E,H). In more posterior regions, the appearance of TUNEL-positive cells was not affected by Runx1 deficiency (Fig. 2F,G).The proliferative activity in the palatal epithelium of the Runx1 mutant was also evaluated using Ki67 staining. In Runx1 mutants, the thick epithelial remnants formed at the interface without any mesenchymal confluence due to partial contact between the nasal septum and the secondary palate. Double-staining for Ki67 and K14 showed that Ki67-immunoreactive proliferating cells were retained in these epithelial remnants in Runx1 mutant, whereas Ki67-immunoreactive proliferating cells were less present at the fused epithelium in wild-types (Fig. 2I–K). Prior to fusion between the primary and the secondary palate at E14.5, Ki67-immunoreactive proliferating epithelium was sparsely present in the contacting palatal epithelium both in the control and the Runx1 mutant mice (Fig. S3A,B). Significant difference was not detected in the percentage of Ki67 positive cells between the control and the mutants (Fig. S3C).During palatogenesis of the secondary palate, the periderm transiently forms a single flattened layer against premature adhesion of the fusing epithelium overlying the palatal shelf and is sloughed from the palatal surface in order to facilitate adherence and form a palatal seam[24]. In wild-type mice at E15.0, immunoreactivity to Keratin 17(K17), a marker of the periderm[26], was sparsely detected in the epithelial remnants in the 2nd rugae area (Fig. 2L). In contrast, in Runx1 mutants, K17-immunoreactive periderm cells were retained on the surface of the nasal septum, the primary palate and the the secondary palate (Fig. 2M). In the more anterior region corresponding to the 1st rugae, the unfused palatal process of the Runx1 mutants was covered with K17-immunoreactive periderm, whereas K17-immunoreactive periderm was degraded in the control (Fig. S3D,E). Prior to fusion between the primary and the secondary palate at E14.5, K17-immunoreactive periderm covered the whole epithelial surface of the contacting palatal process both in the control and the Runx1 mutants (Fig. S3D,E) These findings indicated that the periderm was not adequately removed in the primary palate and in the anterior-most region of the secondary palate, which is the corresponding to cleft regions in Runx1 mutants.At E17.0, although the nasal septal cartilage was normal in size in Runx1 mutants, a mesenchymal defect was not evident at the tissue overlying the vomeronasal organ (vo) (Fig. 1L). Therefore, insufficient growth of the nasal septum tissue may not have contributed to the cleft phenotypes.BrdU staining revealed that there were no marked changes in the BrdU signals in the palatal mesenchyme due to Runx1 deficiency at E15.0 (Fig. 2N,O). We also evaluated the vertical distance between the vomeronasal organ(vo) and the lower most surface of the primary palate and found that no significant differences were detected between the control and the Runx1 mutants (Fig. S4). It is therefore likely that the tissue defect observed at E17.0 was due to the secondary effect of contact failure between the secondary palate and the nasal septum, and not to growth failure of the nasal septum.Taken together, these findings show that Runx1 deficiency resulted in failure in the disintegration of the epithelial remnants of the anterior palate with retained proliferative activity, suppressed apoptosis, and inadequate periderm removal specifically at the junction between the primary and the secondary palates and at the anterior-most part of the secondary palate. These are novel findings indicating that Runx1 is involved in the disintegration of the fusing epithelium in morphogenesis.
Downstream target of Runx1 signaling
We further investigated the target molecules that may explain the cleft in Runx1 mutants. The previous study demonstrated that Runx1 is expressed in the fusing epithelium[5,27]. A whole-mount in situ hybridization analysis at E12.0, E13.0, E14.0 and E15.0 demonstrated that Runx1 transcripts were detected at the primary palate from E13.0 and that Runx1 was not specific to the anterior regions of the palate but widely expressed in the AP axis (Fig. 3A–D). In the primary palate regions, Runx1 transcripts were abundant in the triangle regions delimited between the bilateral incisive foramen in the primary palate (arrowhead in Fig. 3D). The Runx1 expression in the primary palate and nasal septum was evident from E13.0 (arrows in Fig. 3B,C). Runx1 transcripts were also specifically evident at the fusing surface of the secondary palate (Fig. 3D).
Figure 3
Downstream target molecules in Runx1 signaling in palatogenesis. (A–D) Whole-mount in situ hybridization analyses of Runx1 in the developing palate of wild-type mice. Runx1 is expressed at the fusing and fused epithelium of the secondary palate, the primary palate, and the nasal septum. Scale bar: 1000 μm. (E–L) Whole-mount in situ hybridization analyses showed that Shox2, Msx1, Bmp4, and Shh expression was not affected by Runx1 deficiency. Scale bar: 500 μm. (M,N) The Tgfb3 expression was markedly disturbed at the primary palate regions in K14-Cre/Runx1 mice (yellow arrowhead). Tgfb3 expression at the fused and/or fusing epithelium of the secondary palate was not affected by Runx1 deficiency. Scale bar: 1000 μm. (O–R) Higher magnification of Tgfb3 (inset of panel M) and Mmp13 expression at the boundary between the primary and the secondary palate. The Mmp13 expression was also markedly disturbed at the primary palate regions and at the first rugae area of the secondary palate in Runx1 mutants. The yellow arrow indicates the region where Tgfb3 and Mmp13 expression was disturbed. (S,T) A qPCR analysis confirmed the marked downregulation of Tgfb3 and Mmp13 expression in Runx1 mutants. Scale bar: 500 μm. Error bars, *p < 0.05; pp, primary palate; sp, secondary palate; ns, nasal septum; if, incisive foramen; 1st, 1st rugae. Scale bar: 500 μm.
Downstream target molecules in Runx1 signaling in palatogenesis. (A–D) Whole-mount in situ hybridization analyses of Runx1 in the developing palate of wild-type mice. Runx1 is expressed at the fusing and fused epithelium of the secondary palate, the primary palate, and the nasal septum. Scale bar: 1000 μm. (E–L) Whole-mount in situ hybridization analyses showed that Shox2, Msx1, Bmp4, and Shh expression was not affected by Runx1 deficiency. Scale bar: 500 μm. (M,N) The Tgfb3 expression was markedly disturbed at the primary palate regions in K14-Cre/Runx1mice (yellow arrowhead). Tgfb3 expression at the fused and/or fusing epithelium of the secondary palate was not affected by Runx1 deficiency. Scale bar: 1000 μm. (O–R) Higher magnification of Tgfb3 (inset of panel M) and Mmp13 expression at the boundary between the primary and the secondary palate. The Mmp13 expression was also markedly disturbed at the primary palate regions and at the first rugae area of the secondary palate in Runx1 mutants. The yellow arrow indicates the region where Tgfb3 and Mmp13 expression was disturbed. (S,T) A qPCR analysis confirmed the marked downregulation of Tgfb3 and Mmp13 expression in Runx1 mutants. Scale bar: 500 μm. Error bars, *p < 0.05; pp, primary palate; sp, secondary palate; ns, nasal septum; if, incisive foramen; 1st, 1st rugae. Scale bar: 500 μm.We next evaluated the possible downstream target molecules of Runx1 signaling in anterior palatogenesis. Anterior clefting is a rare phenotype in genetically manipulated mice, and several transcription factors and signaling molecules are recognized as anterior-specific[14,15,28,29]. Shox2 is a homeobox gene expressed specifically in the anterior palate, and Shox2 null mutant mice exhibit an anterior cleft palate[30]. Msx1 is also an anterior-specific homeobox gene. Loss of Msx1 expression leads to a complete cleft palate, and overexpression of BMP4 rescues this palatal phenotype. In this network, Msx1 regulates Bmp4 expression in the anterior mesenchyme, which subsequently induces Shh expression in the palatal epithelium[31]. The present whole-mount in situ hybridization revealed that the expression pattern of Shox2, Msx2, Bmp4 or Shh did not deviate in Runx1 mutants (Fig. 3E–L), indicating that Runx1 signaling is independent of the previously identified Msx1-Bmp4 and Shox2 signaling axes in anterior palatogenesis.Among several signaling molecules, we found that Tgfb3 was significantly decreased in Runx1 mutants (Fig. 3M–P). Coinciding with anteriorly-specific palatal clefting in Runx1 mutants, whole-mount in situ hybridization clearly demonstrated that downregulation of Tgfb3 expression was specifically observed in the primary palate regions of Runx1 mutants (arrowhead in Fig. 3N), while Tgfb3 expression did not deviate in the secondary palate (Fig. 3M,N). A qPCR analysis of microdissected tissue confirmed such significant and spatially-specific downregulation in Tgfb3 expression in the primary palate (Fig. 3S).Whole-mount in situ hybridization also revealed that Mmp13 was remarkably downregulated in the primary palate of Runx1 mutants. Reduction was also evident at the anterior portion of the secondary palate anterior to the 2nd rugae (Fig. 3Q,R). A qPCR analysis also confirmed it (Fig. 3T).Mmp13 is a downstream target of Tgfb3 during mammalian palatogenesis[32], and spatial downregulation of Mmp13 almost coincided with the spatial downregulation of Tgfb3 at the primary palate. Whole-mount in situ hybridization analyses demonstrated that the distribution of Mmp13 expression in the wild-types palate almost coincided with that of Runx1 (Fig. 3D,Q).Furthermore, as stated before, our Runx1 mutants exhibited impaired removal of the periderm, which is similar to the epithelial phenotypes in Tgfb3 null mutants[33,34]. Taken together, these findings indicated that Runx1 deficiency results in the downregulation of Tgfb3 expression specifically in the primary palate, and this Runx1-Tgfb3 signaling axis is a novel regulatory pathway that is independent of the Shh, Shox2 and Msx1-Bmp4 pathways.To further confirm the significance of the downregulation of Tgfb3 signaling in Runx1 mutants, we investigated whether or not treatment with TGFB3 beads can rescue the palatal clefting of Runx1 mutants. TGFB3 protein beads or BSA-containing beads as controls were placed at the primary palate. After 48 h, the TGFB3 beads did indeed rescue the cleft palate formation (Fig. 4A,B). A histological analysis confirmed that the epithelial remnants between the primary and secondary palates and at the anterior-most part of the secondary palate were almost removed in order to allow for mesenchymal continuity (Fig. 4C,D). The success rate of rescuing the cleft palate was 75% (Fig. 4E). A qPCR analysis of microdissected tissue demonstrated that the TGFB3 beads induced Mmp13 expression without upregulation of the Tgfb3 mRNA expression (Fig. 4F,G). These TGFB3 rescue studies therefore confirmed that Tgfb3 is an essential and critical target molecule in Runx1 signaling in the anterior palatal fusion.
Figure 4
Rescue of cleft palate in Runx1 mutants by application of TGFB3. (A,B) Occlusal view of Runx1 mutant palate cultured with BSA or TGFB3 protein beads. TGFB3 rescued the clefting of Runx1 mutants (arrowhead). (C,D) A histological analysis confirmed the fusion by TGFB3 application. Scale bar: 100 μm. (E) The table shows the success rate of rescue. (F,G) A qPCR analysis of the rescued palatal tissues of Runx1 mutants. The expression of Tgfb3 and Mmp13 was evaluated in the tissues of control and Runx1 mutants with BSA or TGFB3 protein beads. (H–K) In situ hybridization analyses of protein-planted tissue. TGFB3-soaked beads induced the ectopic expression of Runx1. Control BSA beads failed to induce Runx1. Scale bar: 100 μm (upper), 200 μm (lower).
Rescue of cleft palate in Runx1 mutants by application of TGFB3. (A,B) Occlusal view of Runx1 mutant palate cultured with BSA or TGFB3 protein beads. TGFB3 rescued the clefting of Runx1 mutants (arrowhead). (C,D) A histological analysis confirmed the fusion by TGFB3 application. Scale bar: 100 μm. (E) The table shows the success rate of rescue. (F,G) A qPCR analysis of the rescued palatal tissues of Runx1 mutants. The expression of Tgfb3 and Mmp13 was evaluated in the tissues of control and Runx1 mutants with BSA or TGFB3 protein beads. (H–K) In situ hybridization analyses of protein-planted tissue. TGFB3-soaked beads induced the ectopic expression of Runx1. Control BSA beads failed to induce Runx1. Scale bar: 100 μm (upper), 200 μm (lower).
Bidirectional Runx1-Tgfb3 signaling in the palate
We also evaluated whether or not Tgfb3 induces Runx1 expression in the reverse direction in the palatal tissues. We found that TGFB3 protein beads induced ectopic Runx1 expression in the palates in culture (Fig. 4H–K), indicating that Runx1-Tgfb3 signaling is reciprocally regulated.
Stat3 activity in the Runx1-Tgfb3 axis
Runx1 acts is a tumor promoter in mouseskin cancer formation and maintenance by promoting Stat3 activation[16,17] and Tgfb3 expression is often upregulated in cancer formation[35]. We therefore evaluated the Stat3 activity in anterior palatal fusion in Runx1 mutants. Whole-mount in situ hybridization analyses for Stat3 mRNA demonstrated that the Stat3 expression is particularly intense in the fusing palate; however, the Stat3 mRNA expression was not anterior-specific (Fig. 5A,B). Stat3 activity was evaluated based on the state of phosphorylation using immunohistochemistry, and we performed immunohistochemical analyses for phosphorylated-Stat3 (pStat3) and Stat3.
Figure 5
Stat3 activity in the palate of Runx1 mutants. (A,B) Whole-mount in situ hybridization analyses of the expression of Stat3 at E14.5 and E15.0 palate. Scale bar: 500 μm. (C–F) Immunofluorescence analyses of STAT3 (C,D, green) and phosphorylated STAT3 (E,F,green) of control and K14-Cre/Runx1 mice. Nuclei were counterstained with DAPI (blue). The arrowhead indicates(I) decreased pStat3 immunoreactivity at the primary palate and at the first rugae area of the secondary palate of Run1 mutants. Scale bar: 100 μm. (G,H) Confocal microscopy confirmed that Stat3 immunoreactivity was detectable only in the cytoplasm, whereas phosphorylated Stat3 (pStat3) was detected in the perinuclear region and Stat proteins were translocated into the nucleus. (I) A Western blot analysis confirmed that pStat3 immunoreactivity was markedly downregulated by Runx1 deficiency. (J,K) Whole-mount in situ hybridization analyses showed that Socs3 mRNA was specifically localized in the primary palate at E14.0 (arrowhead) and that the Socs3 expression was further upregulated by Runx1 deficiency (arrowhead). Scale bar: 200 μm. (L) qPCR analysis confirmed the significant upregulation of Socs3 expression in Runx1 mutants. *p < 0.05. (M,N) Whole-mount in situ hybridization analyses of Tgfb3 in the unfused palate at E14.5. Scale bar: 200 μm. pp, primary palate; sp, secondary palate; ns, nasal septum; if, incisive foramen; in, incisor germ.
Stat3 activity in the palate of Runx1 mutants. (A,B) Whole-mount in situ hybridization analyses of the expression of Stat3 at E14.5 and E15.0 palate. Scale bar: 500 μm. (C–F) Immunofluorescence analyses of STAT3 (C,D, green) and phosphorylated STAT3 (E,F,green) of control and K14-Cre/Runx1mice. Nuclei were counterstained with DAPI (blue). The arrowhead indicates(I) decreased pStat3 immunoreactivity at the primary palate and at the first rugae area of the secondary palate of Run1 mutants. Scale bar: 100 μm. (G,H) Confocal microscopy confirmed that Stat3 immunoreactivity was detectable only in the cytoplasm, whereas phosphorylated Stat3 (pStat3) was detected in the perinuclear region and Stat proteins were translocated into the nucleus. (I) A Western blot analysis confirmed that pStat3 immunoreactivity was markedly downregulated by Runx1 deficiency. (J,K) Whole-mount in situ hybridization analyses showed that Socs3 mRNA was specifically localized in the primary palate at E14.0 (arrowhead) and that the Socs3 expression was further upregulated by Runx1 deficiency (arrowhead). Scale bar: 200 μm. (L) qPCR analysis confirmed the significant upregulation of Socs3 expression in Runx1 mutants. *p < 0.05. (M,N) Whole-mount in situ hybridization analyses of Tgfb3 in the unfused palate at E14.5. Scale bar: 200 μm. pp, primary palate; sp, secondary palate; ns, nasal septum; if, incisive foramen; in, incisor germ.Stat3 immunoreactivity was evident in the palatal epithelium, and some signals were detected in the mesenchyme (Fig. 5C); the distribution of Stat3 immunoreactivity did not deviate in Runx1 mutant palate (Fig. 5D). In contrast, pStat3 immunoreactivity was evident in the fusing or fused epithelium of the wild-type palates (Fig. 5E). Notably, in Runx1 mutant palate, immunoreactivity to pStat3 was significantly downregulated at the boundary between the primary and secondary palate and at the first rugae area of the palatal process, which are the corresponding cleft regions in Runx1 mutants (Fig. 5F), whereas the immunoreactivity was unchanged in the secondary palate (Fig. S5).In this observation of the fusing epithelium, confocal microscopy confirmed that Stat3 immunoreactivity was detectable only in the cytoplasm, whereas pStat3 was detected in the perinuclear region, indicating that phosphorylated Stat proteins translocate into the nucleus (Fig. 5G,H). A western blot analysis also demonstrated that pStat3 was significantly reduced in the Runx1 mutant primary palate, while Stat3 was not affected (Fig. 5I). The scanned full blots are presented in Supplementary Fig. S6.
Socs3 mRNA in Runx1 mutants
Then, in order to understand why pStat3 immunoreactivity was disturbed specifically in the nasal septum and the primary palate regions, we investigate the possible deviation of Socs3 mRNA on Runx1 deficiency. In cytokine signaling pathways, SOCS3 suppress Stat3 phosphorylation via interference with Jak2[36]. In keratinocytes, Runx1 binds to the SOCS3 promoters to represses their transcription and ultimately upregulates Stat3 activity by enhancing phosphorylation due to Runx1 depletion[9]. Hence, we hypothesized that Runx1 could regulate Stat3 activity specifically in the primary palate and the secondary palate at the at the first rugae regions through modulation of phosphorylation of Stat3 by downregulation of Socs3.The present whole mount in situ hybridization demonstrated that Socs3 mRNA expression was specifically localized on the surface of the nasal septum and the primary palate at E14.0 (Fig. 5J). The Intensity and the area of Socs3 expression became further increased by Runx1 deficiency (Fig. 5K). qPCR analysis of these regions confirmed that Socs3 mRNA expression was significantly increased in the Runx1 mutant (Fig. 5L). Strikingly, the spatial distribution of Socs3 mRNA expression in Runx1 mutants almost overlapped with the regions where the Tgfb3 expression was remarkably decreased in Runx1 mutants (Fig. 5M,N). Collectively, Runx1 deficiency leads to upregulated expression of Socs3 specifically in the nasal septum and the primary palate, which might inhibit Stat3 activation in a spatially specific manner.
Impairment of palatal fusion by Stat3 inhibitors
Given that spatiotemporal downregulation of Tgfb3 expression overlaps with that of pStat3 immunoreactivity at the anterior palate, we hypothesized that Stat3 activity might directly or indirectly regulate Tgfb3 expression, and concomitant impairment of Tgfb3 induction might lead to the failure of palatal fusion. To evaluate the functional roles of Stat3 signaling, AG490, a selective Jak2/Stat3 inhibitor that prevents Stat3 phosphorylation, and S3I-201, a direct Stat3 inhibitor that blocks Stat3 dimerization and DNA-binding[37], was applied in explanted palate at E15.0 for 48 h[38,39].A Western blot analysis confirmed that application of Stat3 inhibitors of Ag490 or S3I-201 almost suppressed immunoreactivity to pStat3, while Stat3 immunoreactivity was not affected (Fig. 6A). The scanned full blots are presented in Supplementary Fig. S7. In our in vitro culture system, the explanted palate fused by 100% in control mice (Fig. 6B,C). AG490 treated palate exhibited failure in fusion at both 200 and 400 µM by 100% (Fig. 6B,E,F). S3I-201 also impaired palatal fusion at 200 and 400 µM by almost 100% (Fig. 6B,G,H).
Figure 6
Application of Stat3 inhibitors leading to cleft palate in culture. (A) A Western blot analysis showed that the application of Stat3 inhibitors of Ag490 or S3I-201 suppressed immunoreactivity to pStat3 but not to Stat3. (B) The incidence of cleft palate by Stat3 inhibitors. (C–H) Occlusal views of the palates treated with Stat3 inhibitors. Both Ag490 and S3I-201 impaired the palatal fusion, while the BSA-treated control group showed complete fusion of the palate. The boxed region in the diagram was magnified to evaluate the cleft formation (D) if, incisal foramen. (I–Q) A qPCR analysis of the palatal tissues treated by AG490 or S3I-201. A qPCR analysis showed that application of Stat3 inhibitors disturbed the expression of Tgfb3 and Mmp13 and enhanced the Socs3 expression in a dose-dependent manner.
Application of Stat3 inhibitors leading to cleft palate in culture. (A) A Western blot analysis showed that the application of Stat3 inhibitors of Ag490 or S3I-201 suppressed immunoreactivity to pStat3 but not to Stat3. (B) The incidence of cleft palate by Stat3 inhibitors. (C–H) Occlusal views of the palates treated with Stat3 inhibitors. Both Ag490 and S3I-201 impaired the palatal fusion, while the BSA-treated control group showed complete fusion of the palate. The boxed region in the diagram was magnified to evaluate the cleft formation (D) if, incisal foramen. (I–Q) A qPCR analysis of the palatal tissues treated by AG490 or S3I-201. A qPCR analysis showed that application of Stat3 inhibitors disturbed the expression of Tgfb3 and Mmp13 and enhanced the Socs3 expression in a dose-dependent manner.To further clarify the present hypothesis, a qPCR analysis of the microdissected primary palate revealed that the expression of Tgfb3, Mmp13 and Runx1 was reduced significantly in a dose-dependent manner when pStat3 inhibitors were applied (Fig. 6I,J,K), whereas Socs3 expression was upregulated in a dose-dependent manner (Fig. 6L). S3I-201 also downregulated Tgfb3, Mmp13 and Runx and upregulated Socs3 significantly (Fig. 6M–Q).These findings confirmed that the modification of Stat3 activity was able to influence the expression of Tgfb3 directly or indirectly and subsequently regulate the anterior palatal fusion in culture.
Discussion
Runx1 deficiency results in anterior cleft palate between the primary and secondary palate and at the anterior-most region of the secondary palate. Using conditional Runx1 null mutant mice, we showed that Tgfb3 is a critical downstream target in this pathogenesis and that the Runx1-Tgfb3 signaling axis is reciprocal and specific in the anterior regions of palatogenesis. In this process, we demonstrated that Stat3 mediates this Runx1-Tgfb3 signaling axis and that Runx1 deficiency upregulates the expression of Socs3, an inhibitor of Stat3 signaling and specifically expressed in the primary palate regions. We further demonstrated that the pharmaceutical modification of Stat3 affects Runx1-Tgfb3 signaling and the palatal fusion in vitro.In the present study, we found that Tgfb3 is a critical downstream target in Runx1 mutants with anterior clefting and that the expression of Shh, Shox2, Msx1, or Bmp4, which are anterior-specific genes in palatogenesis[14], was not affected in these mutants. Runx1 deficiency resulted in marked downregulation of Tgfb3 in the epithelium in the primary palate and the nasal septum; however, the expression of Tgfb3 in the secondary palate was not affected. Tgfb3 has been established as a critical molecule that regulates epithelial fusion, and null mutant mice display a complete cleft palate[40]. In agreement with the animal phenotypes in Tgfb3 null mutant mice, the case-parent triad study demonstrated that TGFB3 variant was a potential genetic risk factor for increasing risk of non-syndromic CP[41]. However, when Tgfb3[33] or its receptor[34,42] is deleted under K14 epithelial promoter, clefting appears only in the anterior regions. In accordance with these previous findings in Tgfb3 mutants, the cellular phenotypes in the present Runx1 mutants resembled those of Tgfb3 null mutants with sustained proliferation, disturbed apoptosis, and a retained periderm. Furthermore, TGFB3 rescued the cleft phenotypes among Runx1 mutants in culture. Taken together, our findings indicated that Tgfb3 is a critical downstream target of Runx1 signaling specifically in the anterior palatogenesis and that this Runx1-Tgfb3 signaling axis is a novel regulatory pathway that is independent of previously known molecular networks involved in palatogenesis.Tgfb3 promoter does not contain Runx1 consensus sites within 1 kb of the transcription start site[43]. Therefore, some molecules mediate the downregulation of Tgfb3 due to Runx1 deficiency. In mammary gland involution, gland epithelium disappears due to lysosomal-mediated cell death[44], as observed in the fusing palatal epithelium. Such cellular behaviors towards disintegration resemble those of the fusing epithelium of the palate[5], and Tgfb3 expression is upregulated in the involuting epithelium[45]. During involution, the induction of cell death is correlated with the phosphorylation of Stat3[44], and the removal of Stat3 resulted in the inhibition of cell death in a similar fashion to that seen in the Tgfb3 null mutant mammary glands[46], collectively indicating that the upregulation of Tgfb3 expression with activated Stat3 phosphorylation regulates the cell death in mammary gland involution. Furthermore, Runx1 maintained Stat3 activity in the epidermis and in skin cancer cells[16,17]. Given these previous findings, we hypothesized that Stat3 might mediate the Runx1-Tgfb3 signaling pathway in palatal fusion.The involvement of Stat3 in palatogenesis has not been previously investigated. We found that Runx1 deficiency induces the inhibition of phosphorylation of Stat3 specifically in the corresponding cleft regions in the Runx1 mutants, and such inhibition of Stat3 activity almost demonstrated spatiotemporal overlapping with that of Tgfb3 expression. As two different Stat3 inhibitors with different modes of actions impaired the palatal fusion in vitro with remarkable inhibition of Tgfb3 expression in the primary palate, the present findings suggested that Stat3 may be important in palatogenesis as a critical mediator of Runx1-Tgfb3 signaling. Interestingly, TGFB3 protein beads also reciprocally induced pStat3 and ectopic Runx1 mRNA expression. Although whether such regulatory control is direct or indirect remains unclear, the present findings indicated that the Runx1-Stat3-Tgfb3 regulatory pathway orchestrates reciprocal control of genes required for palatal fusion in the anterior regions.Anterior clefting is a rare palatal phenotype in the genetically modified mice, however, spatial distribution of Runx1 mRNA do not account why the Stat3 activation and Tgfb3 mRNA expression is disturbed only in the primary palate and the nasal septum. In humancancer cells, Runx1 loss impairs tumor initiation and maintenance and the growth of oral, skin, and ovarian epithelial human cancer cells. In a previous study using mouse keratinocytes, chromatin immunoprecipitation followed by quantitative PCR (ChIP-qPCR) analysis demonstrated Runx1 binds to the promoters of Socs3, Stat3 inhibitors, to represses their transcription, and ultimately upregulates Stat3 activity by enhancing phosphorylation[9]. Conversely, Runx1 deficiency results in upregulation of Socs3 expression and Stat3 inactivation. Our whole mount in situ hybridization analyses demonstrated that Socs3 expression was evident specifically in the fusing epithelium of the nasal septum and the primary palate of wild-type and this Socs3 mRNA was further upregulated by Runx1 deficiency. Remarkably, spatial distribution of upregulated Socs3 mRNA overlapped with the regions of downregulated pStat3 immunoreactivity and Tgfb3 mRNA. Hence, involvement of Socs3 on Runx1-Tgfb3 signaling axis could, at least in part, account how Runx1 deficiency leads to spatially-specific downregulation of Stat3 phosphorylation and Tgfb3 mRNA in the primary palate and the nasal septum and at the anterior portion of the secondary palate, and subsequent anterior specific cleft palate.A striking finding of our study is that the pharmaceutical application of two different types of Stat3 inhibitor disturbed the expression of Runx1 and inhibited Tgfb3 expression, leading to failure in palatal fusion in wild-type mice. Such downregulation of Runx1 by Stat3 inhibitors was also supported by upregulated expression of Socs3, as observed in Runx1 mutants. These findings showed that the Runx1-Tgfb3 signaling axis was affected by extrinsic modification of Stat3. It has been established that Stat3 senses an array of extracellular signals and rapidly responds to them by controlling the target gene expression[47]. Acute alcohol intake suppresses the Stat3 activity through excessive Socs3 activation in human monocytes[48], and nicotine also induces anti-inflammatory action associated with Stat3 phosphorylation in peritoneal macrophages[49]. Although a previous study did not examine whether or not alcohol intake and/or smoking influence the Stat3 activity in palatal fusion, Stat3 might act as a point of convergence integrating extrinsic environmental input into the genetically defined intrinsic conditions, which might provide a novel understanding of the etiology and pathology of the cleft palate. In the pathogenesis of non-syndromic cleft palate, several genetic susceptibility factors and environmental risk factors have been identified, and a clinically relevant phenotype is identified only when a threshold effect is reached after combining each genetic and environmental susceptibility factor affecting each individual[1,2]. Prevention is the ultimate objective with regard to CP. The present findings have identified genetic targets that modify the environmental risk factors, and pharmaceutical modulation of Stat3 signaling may modify the Runx1-Tgfb3 signaling axis, suggesting its utility as a therapeutic procedure for preventing CP in patients with pathologic TGFB3 variant.One limitation associated with this study is that Stat3 signaling was inhibited by pharmacological Stat3 inhibitors. Given the possibility that Stat3 inhibitors also affect other signaling besides Stat3, we used two different Stat3 inhibitors with different mechanisms of action. In future experiments, we will generate epithelial-specific Stat3 null mutants to directly confirm the function of Stat3. Previous studies using tissue-specific Stat3-deficient mice showed that Stat3 plays a crucial role in a variety of biological functions, including cell growth, anti-apoptosis, apoptosis and cell motility depending on the cell type and stimulus[9,19,47,50]. However, the cleft palate phenotype has not been reported using such Stat3 mutant mice. In previous studies using epithelial-specific stat3 deletion mice, Keratin 5 (K5) promoter was used for the epithelial-specific Cre-mediated deletion of the Stat3 gene. K14-Cre is another Cre driver for generating epithelial-specific conditional null mutant mice, and interestingly, Dicer-null mutants driven by K14 and K5 do not exhibit similar appendage phenotypes. Indeed, K14-Dicer mutants exhibit more severe phenotypes at birth than K5-Dicer mutants, possibly due to the earlier onset of the K14-Cre driver[51]. Since palatal fusion occurs in the embryonic stages, it is likely that the K14-Cre driver is appropriate for evaluating the possible function of Stat3 in the fusing epithelium. We intend to investigate the palatal phenotypes using K14-Cre driven Stat3 conditional null mice in future experiments.In conclusion, we found that Runx1 epithelial-specific deletion led to the failed disintegration of the contacting palatal epithelium and that Tgfb3 is a critical downstream target in the pathogenesis of anterior cleft palate in the mutants. This Runx1-Tgfb3 signaling axis is independent of previously known signaling systems and is reciprocally mediated by Stat3. In this process, expression of Socs3, an inhibitor of Stat3 signaling, was upregulated specifically in the primary palate by Runx1 deficiency, which could explain, at least in part, how Runx1 deficiency results in anteriorly specific clefting (Fig. 7A,B). Furthermore, the pharmaceutical application of Stat3 inhibitor disturbs the expression of Runx1 as well as Tgfb3 and leads to failure of palatal fusion in wild-type mice, suggesting that the Runx1-Tgfb3 signaling axis may be affected by extrinsic modification of Stat3 signaling (Fig. 7C). The involvement of Stat3 modification in Runx1-Tgfb3 signaling may offer novel insights into the physiologic and pathophysiologic regulation of the palatal fusion (Fig. 7A) and our study also clarifies potential therapeutic targets in the prevention and pharmaceutical intervention for cleft palate.
Figure 7
Runx1-Stat3-Tgfb3 signaling network regulate the fusion of the anterior palate. Schematic illustration of the key findings in this article. (A) Tgfb3 is a critical downstream target of Runx1 signaling, which regulate the palatal fusion between the primary and the secondary palate and at the anterior-most part of the secondary palate. The novel Runx1-Tgfb3 signaling axis is mediated by Stat3 phosphorylation. (B) Tgfb3 is remarkably disturbed in Runx1 mutants specifically in the primary palate and nasal septum with suppression of Stat3 phosphorylation. Socs3 expression is localized in the primary palate and Socs3 mRNA is upregulated by Runx1 deficiency. (C) Stat3 inhibitor results in the failure of palatal fusion in vitro with significant downregulation of Tgfb3 expression and Stat phosphorylation. Stat3 inhibitor further disturbs the Runx1 expression.
Runx1-Stat3-Tgfb3 signaling network regulate the fusion of the anterior palate. Schematic illustration of the key findings in this article. (A) Tgfb3 is a critical downstream target of Runx1 signaling, which regulate the palatal fusion between the primary and the secondary palate and at the anterior-most part of the secondary palate. The novel Runx1-Tgfb3 signaling axis is mediated by Stat3 phosphorylation. (B) Tgfb3 is remarkably disturbed in Runx1 mutants specifically in the primary palate and nasal septum with suppression of Stat3 phosphorylation. Socs3 expression is localized in the primary palate and Socs3 mRNA is upregulated by Runx1 deficiency. (C) Stat3 inhibitor results in the failure of palatal fusion in vitro with significant downregulation of Tgfb3 expression and Stat phosphorylation. Stat3 inhibitor further disturbs the Runx1 expression.
Materials and Methods
Animals
Runx1−/− mice are lethal due to hemorrhaging at about E10.5 to E12.5, when the palatal development is not yet completed[5]. To determine the role of Runx1 in oral epithelium, we use epithelial-specific knockout mice created through the Cre/loxP system (K14-Cre/Runx1). To generate K14-Cre/Runx1mice, we first mated heterozygous K14-Cre mice[52] and Runx1mice[53] to obtain K14-Cre/Runx1mice. These progenies were subsequently bred with Runx1mice. Genotyping was performed by the conventional polymerase chain reaction (PCR) method using each primer set to detect Cre (5′ CTCTGGTGTAGCTGATGATC 3′ and 5′ TAATCGCCATCTTCCAGCAG 3′) and the loxP site of Runx1 (5′ GCGTTCCAAGTCAGTTGTAAGCC 3′ and 5′ CTGCATTTGTCCCTTGGTTGACG 3′). We used littermates that did not carry the K14-Cre/Runx1 genotype as control animals. We also confirmed the efficiency of the K14-Cre recombination in anterior palatogenesis using Rosa26R reporter mice and X-gal staining, as shown in a previous study[54].
Assessment of palatal fusion and a histological analysis
The mouse embryonic heads were dissected in BGJb medium (Gibco). The palate was evaluated by direct observation and with a dissecting microscope. These tissue were fixed in 4% paraformaldehyde, equilibrated in graded sucrose, and embedded in Tissue-Tek (OCT compound, Sakura).
Immunohistochemistry
Immunofluorescence staining was performed on 20-µm sections using polyclonal rabbit-anti-Ki67 (1:400, ab15580, Abcam), monoclonal rabbit anti-K17 (1:200, #4543, Cell Signaling Technology), monoclonal anti-K14 (1:200, ab7880, Abcam), monoclonal rabbit anti-phospho-Stat3 (pStat3, 1:200, #9145, Cell Signaling Technology), monoclonal rabbit anti-Stat3 (1:200, #9139, Cell Signaling Technology) overnight at 4 °C. Then, Alexa488-conjugated goat-anti-rabbit IgG (1:400, A21206, Molecular Probes) or Alexa546-conjugated goat-anti-mouse IgG (1:400, A11003, Molecular Probes) was used as secondary antibody. The sections were then counterstained with DAPI (1:500, Dojindo) and mounted with fluorescent mounting medium (Dako). At least three embryos of each genotype were used for each analysis.
Laser microdissection
The miceembryonic maxilla were freshly embedded in OCT compound and frozen immediately. Tissues are serially sectioned at −20 °C on a cryostat (CM 1950, Leica) at a thickness of 25 μm. The maxilla was sectioned from anterior to posterior throughout anterior palate until the secondary palate appeared. The tissue sections were mounted and thawed on a film-coated slide. In total, there were 12–14 serial sections obtained from the anterior palate at E15.0 (section numbers varied due to the orientation of the frozen block). We stained these slides with cresyl violet dye staining. Anterior palate epithelial and mesenchymal tissue were dissected from the sections using a Leica Micro Laser System (LMD6500, Leica) and collected by tube.
RNA extraction and real-time RT-PCR analyses
We used the laser-microdissected tissues of the control and K14-Cre/Runx1mice to extract total RNA. IsogenII (Nippon Gene) was used to extract total RNA according to the manufacturer’s protocol. Total RNA was reverse transcribed to cDNA using an oligo (dT) with avian myeloblastosis virus reverse transcriptase (Takara). For the real-time RT-PCR analysis, the cDNA was amplified with TaqDNA Polymerase (Toyobo) using a light cycler (Roche). The qPCR was carried out with Gapdh used as a housekeeping gene and analyzed as previously described[54]. Primer sequences are available in the Supplementary Fig. S8. At least three embryos of each genotype were used for each analysis.
Whole-mount in situ hybridization
Whole-mount in situ hybridization was performed using fixed E12.0, E13.0, E14.0, E14.5 and E15.0 palates. The digoxigenin-labeled RNA probes used in this study were prepared using a DIG RNA labeling kit (Roche) according to the manufacturer’s protocol using each cDNA clone as the template. The probes were synthesized from fragments of Runx1, Shox2, Msx1, Shh, Bmp4, Tgfb3, Socs3 and Stat3 (Allen Institute for Brain Science) and were amplified with T7 and SP6 adaptor primers through PCR. After hybridization, the expression patterns for each mRNA were detected and visualized according to their immunoreactivity with anti-digoxigenin alkaline phosphatase-conjugated Fab fragments (Roche), as previously reported[2]. At least three embryos of each genotype were used for each analysis.
TUNEL staining
TUNEL assay for apoptosis was conducted according to the manufacturer’s protocol (ApopTag; Chemicon). Frozen sections (10 μm) from samples were prepared. The sections were counterstained with methyl green. At least three embryos of each genotype were used for each analysis.
In vitro culture of palatal shelves and rescue of the mutant cleft palate using TGFB3 protein
The palate was dissected and explanted from the E15.0 embryo and cultured on track-etched polycarbonate membrane filter (Nuclepore) in Trowell type organ culture with serumless, chemically defined BGJb medium (Gibco). In our dissection, the primary palate and the nasal septum were not excluded from our culture system. Affi-Gel beads (Bio-Rad) were incubated in TGFB3 (100 ng/μl, R&D Systems). Bovine serum albumin (BSA; Sigma-Aldrich) was used instead of recombinant protein for the control beads. The beads were immersed in recombinant protein or BSA at 37 °C for 60 min and placed on the primary palate of the explants using a pipette tube. After culture, the in vitro explants were fixed at each stage in 4% paraformaldehyde overnight and then processed for histological examination and qPCR analyses.
Whole-head roller culture and treatment of Stat3 inhibitor
Embryo heads from E14.0 ICR mouse embryos were collected in BGJB, and the mandibles, tongues, and brains were removed. The remaining palatal tissue, including both the primary and secondary palate and the nasal septum, were cultured for 24–48 h in a whole-embryo culture incubator (RKI Ikemoto) at 37 °C. Palatal tissues were incubated in BGJb medium with or without AG490 (200–400 µM; Sigma-Aldrich) or STAT3 Inhibitor VI, S3I-201 (200–400 µM; Sigma-Aldrich). Tissues were harvested after 24 h of culture and processed for qPCR analysis.
Western blot analysis
The dissected palatal tissues were lysed with RIPA buffer (nacalai tesque) supplemented with protease and phosphatase inhibitors (nacalai tesque). The lysates were centrifuged and the supernates were heated in denaturing Laemmli buffer (Bio-rad Laboratories). Proteins were separated by SDS-PAGE and transferred to Polyvinylidene difluoride membranes (Bio-rad Laboratories). The membranes were incubated with either anti-Stat3 (1:1000, #9139, Cell Signaling Technology), anti-pStat3 (1:1000, #9145, Cell Signaling Technology) and beta-actin (1:2000, Sigma). The bound antibodies were detected with HRP-linked antibody (1:1,000, Cell Signaling Technology) and the ECL detection kit (Bio-rad Laboratories).
Statistical analyses
Quantitative variables in two groups were compared using the Mann-Whitney U test. Differences among the three groups were determined using the analysis of variance (ANOVA) test, and significant effects indicated by the ANOVA were further analyzed with post hoc Bonferroni correction. P values < 0.05 were considered significant. Significance was determined using the statistical analysis software program JMP, version 5 (SAS Institute Inc.).
Study approval
All animal experiments were carried out in strict accordance with the recommendations in the Guide for the Care and Use Committee of the Osaka University Graduate School of Dentistry, Osaka, Japan. The protocol was approved by the Committee on the Ethics of Animal Experiments of Osaka University Graduate School of Dentistry. Mice were housed in the animal facility at the Department of Dentistry, Osaka University. Welfare guidelines and procedures were performed with the approval of the Osaka University Graduate School of Dentistry Animal Committee.Supplementary Figures
Authors: Marek Dudas; Jieun Kim; Wai-Yee Li; Andre Nagy; Jonas Larsson; Stefan Karlsson; Yang Chai; Vesa Kaartinen Journal: Dev Biol Date: 2006-05-27 Impact factor: 3.582