Literature DB >> 30039201

Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF) score algorithm for identification of Gordonia species.

Maria Ercibengoa Arana1,2,3, Marta Alonso4,5, Pedro Idigoras4, Diego Vicente4,6,5, Jose María Marimón4,5.   

Abstract

Gordonia species differentiation is a tedious task. Herein, Gordonia identification was performed according to the standard Bruker score system and a recently proposed score for Gram positive rods identification (≥ 1.5 genus level and ≥ 1.7 species level). New scores significantly improved the identification at genus and species level.

Entities:  

Keywords:  Discriminatory peaks; Gordonia species identification; MALDI-TOF MS; Molecular technology

Year:  2018        PMID: 30039201      PMCID: PMC6056354          DOI: 10.1186/s13568-018-0650-z

Source DB:  PubMed          Journal:  AMB Express        ISSN: 2191-0855            Impact factor:   3.298


Introduction

The bacterial genus Gordonia currently includes 39 different species (Sowani et al. 2017). This genus is particularly known for its biotechnological applications and it is also notable for being an opportunistic human pathogen, causing a broad spectrum of diseases in healthy as well as in immunocompromised individuals (Ramanan et al. 2013). The phenotypic identification of Gordonia genus species has been primarily based on biochemical tests (Verma et al. 2006). However, this methodology is time-consuming and frequently leads to misidentifications. Besides, new Gordonia species are continuously being described and biochemical tests commercially available for Gram-positive rods identification are not able to adequately classify all Gordonia at the species level. Therefore, gene sequencing has become the best technique to ensure a proper identification (Hsueh et al. 2014). Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) is an automated method recently implemented as a tool for bacterial identification in clinical microbiology laboratories. Based on poor laboratory results in the identification of Gordonia by MALDI-TOF MS some authors have suggested changing the cut-off points for Gordonia identification at the genus and species level, the proposed scores being ≥ 1.5 and ≥ 1.7 respectively (Rodríguez-Lozano et al. 2016; Barberis et al. 2014; Bizzini et al. 2010). This value system differs from the manufacturer’s recommendations which are score values ≥ 2.0 for identification at species level, between 2.0 and ≥ 1.7 at genus level and being a score of ≤ 1.7 considered as unreliable identification. The aims of this work were to assess the implementation of MALDI-TOF MS for Gordonia species identification compared with 16S rRNA gene sequencing as the gold standard and to try to define discriminatory peaks for Gordonia species differentiation.

Materials and methods

Between 1998 and 2015, 24 clinical isolates belonging to 21 different patients were identified as Gordonia at the Microbiology Department of Hospital Universitario Donostia, San Sebastian (Basque Country, Spain).Only one isolate per patient was considered for the study. Presumptive identification was established by the growth of characteristic salmon to orange colonies, coryneform Gram-positive rods appearance and non- or slightly-acid-fast bacilli. Biochemical identification was done using the API Coryne system (bioMérieux, France) which contained 20 miniaturized biochemical tests. Definitive species identification was established by sequencing a fragment of 1188 bp of the 16S rRNA gene using primers 5F (TGGAGAGTTTGATCCTGGCTAG) and 1193R (ACGTCATCCCCGCTTCCTT). A > 99% sequence identity with the sequences of Gordonia species available at GenBank using BLAST software (http://www.ncbi.nlm.nih.gov) was used as criteria for species identification. Overall, 16 Gordonia sputi, 4 Gordonia otitidis and 1 Gordonia bronchialis isolates were identified in sputum (n = 15), urine (n = 1) and blood (n = 5) samples from 21 patients (15 men, 6 women). In some patients the pathogenic role of Gordonia isolates could not be unequivocally ascertained, especially in those cases where the microorganism was isolated from sputum, given that Gordonia respiratory infections have been rarely described in literature (Brust et al. 2009) and patients suffered from other multiples illnesses. Bacterial extracts for MALDI-TOF MS identification (Bruker, Daltonics, Germany) was carried out according to the manufacturer’s recommendations and results interpretation was done according to the Bruker score system and the proposed new scores. Measurements were carried out in triplicate and the average of the three results was used for analysis (Bizzini et al. 2010). Since Gordonia have been previously classified using biochemical tests as Rhodococcus (Tindall and Euzéby 2001; Lam et al. 2014), six Rhodococcus equi clinical isolates were also tested by MALDI-TOF to assess the possibility of misidentification with Gordonia species. To determine discriminatory peaks for species identification, besides the spectra obtained for the 21 clinical isolates, the reference spectra of the following Gordonia reference strains available at the Bruker library were used: Gordonia aichiensis, Gordonia alkanivorans, Gordonia australis, Gordonia bronchialis (n = 2), Gordonia rubripertincta (n = 11), and Gordonia sputi (n = 4). All peak data were analyzed by the Pearson´s correlation matrix test performed with SPSS V24 software. Differences in the results obtained for Gordonia species identification using the two different score criteria were evaluated by the Fisher exact test using GraphPad Instat version 3.05 software (GraphPad Software Inc., La Jolla, CA, USA).

Results

Using the 16S rRNA gene sequencing as standard and comparing the manufacturer’s and the new described score system for Gordonia identification, 10 isolates showing an unreliable identification (score < 1.700) were correctly identified at the genus level (Table 1) with the new system (p < 0.001) and 9 isolates correctly identified at genus level could be identified at the species level (p = 0.006). Two isolates were correctly identified by both methods at species level.
Table 1

Gordonia species identification by 16S rRNA gene sequencing and correlation with MALDI-TOF MS

Laboratory coding numberMolecular identification (16S rRNA gene)GenBank accession numberScoreMALDI-TOF MS first species in the identification ranking listIdentification according to
Manufacturer’ scoresNew scores
65206307 G. bronchialis MH3710191.899 G. bronchialis Genus levelSpecies level
10999451 G. sputi MH3713381.864 G. sputi Genus levelSpecies level
226573 G. sputi MH3686861.659 G. sputi Unreliable identificationGenus level
228715 G. sputi MH3713371.633 G. rubripertincta Unreliable identificationGenus level
234219 G. sputi MH3708052.05 G. sputi Species levelSpecies level
239340 G. sputi MH3708061.742 G. sputi Genus levelSpecies level
240919 G. sputi MH3708071.679 G. sputi Unreliable identificationGenus level
241080 G. sputi MH3686871.703 G. sputi Genus levelSpecies level
241362 G. sputi MH3708091.867 G. sputi Genus levelSpecies level
241859 G. sputi MH3686882.12 G. sputi Species levelSpecies level
241867 G. sputi MH3686891.549 G. rubripertincta Unreliable identificationGenus level
241963 G. sputi MH3686901.72 G. sputi Genus levelSpecies level
243347 G. sputi MH3708081.765 G. sputi Genus levelSpecies level
243815 G. sputi MH3686911.768 G. sputi Genus levelSpecies level
243837 G. sputi MH3686921.695 G. sputi Unreliable identificationGenus level
245108 G. sputi MH3686931.64 G. sputi Unreliable identificationGenus level
245419 G. sputi MH3686941.715 G. sputi Genus levelSpecies level
240706 G. otitidis MH3711961.507 G. rubripertincta Unreliable identificationGenus level
243669 G. otitidis MH3707991.674 G. aichiensis Unreliable identificationGenus level
243814 G. otitidis MH3708001.638 G. rubripertincta Unreliable identificationGenus level
245663 G. otitidis MH3708011.517 G. rubripertincta Unreliable identificationGenus level
Gordonia species identification by 16S rRNA gene sequencing and correlation with MALDI-TOF MS The four G. otitidis isolates were misidentified probably because of the absence of any G. otitidis reference isolate in the Bruker database. None of the 6 R. equi isolates was misidentified as Gordonia although in only one case the MALDI-TOF MS identified the isolate as R. equi with a score value of 2.087. In the other five isolates the identification score was ≤ 1.2 not given a reliable identification despite the good peak profiles obtained. To define discriminatory peaks for species identification, the spectra of 6 (15.4%) of the 39 different Gordonia species described up to date were employed. The Pearson correlation coefficient showed that most species were closely related with the exception of G. rubripertincta (r = 0.363) and G. alkanivorans (r = − 0.069). The spectra of G. sputi and G. otitidis clinical isolates were closely related (r = 0.946) and two discriminatory peaks at 3332.8 and 4117.5 m/z could be established. The presence of one of those peaks or both was enough to discriminate all G. sputi and G. otitidis isolates from G. aichiensis, G. alkanivorans, G. australis, G. bronchialis, and G. rubripertincta but not between them.

Discussion

Of the 39 Gordonia species described to date only 10 have been identified as opportunistic pathogens in humans capable to cause a wide range of diseases ranging from primary cutaneous infections or lung infections to bacteremia or recurrent breast abscesses in healthy individuals as well as in immunocompromised patients (Sowani et al. 2017; Rodríguez-Lozano et al. 2016). Gordonia is difficult to identify using conventional biochemical tests as reflected in some reports (Tindall and Euzéby 2001; Lam et al. 2014) where all Gordonia isolates were misidentified as Rhodococcus species. To date, sequencing of the 16S rRNA gene has become the most reliable technique for Gordonia species identification (Bizzini et al. 2010). However, sequencing results are not generated instantly and are not available in all laboratories. Recently, MALDI-TOF MS based system has emerged as new tool with the possibility to identify most of the microorganisms causing human infections (Lam et al. 2014). Different studies evaluated the precision of MALDI-TOF MS for Gordonia species identification with not very promising results (Hsueh et al. 2014; Rodríguez-Lozano et al. 2016; Barberis et al. 2014; Bizzini et al. 2010; Lai et al. 2010). In fact, based on previous studies (Rodríguez-Lozano et al. 2016; Barberis et al. 2014; Bartolomé-Álvarez et al. 2016), a lower score cut–off for an accurate identification at species and genus level was suggested. In our study, a lower score significantly increased the correct identification from 10 to 20 isolates at genus level and from 2 to 11 isolates at species level without affecting the specificity. Our work, although with a limited number of different Gordonia species, confirmed that a lower cut-off score value was suitable for Gordonia genus and species identification. Also, the use of discriminatory peaks could aid in the differentiation of G. sputi and G. otitidis from other Gordonia species. Finally, it would be desirable, due to the increase in the description of new pathogenic Gordonia species, to increase the spectra of reference isolates in the MALDI-TOF databases to ensure a correct Gordonia species identification.
  12 in total

1.  Matrix-assisted laser desorption ionization-time of flight mass spectrometry as an alternative to 16S rRNA gene sequencing for identification of difficult-to-identify bacterial strains.

Authors:  A Bizzini; K Jaton; D Romo; J Bille; G Prod'hom; G Greub
Journal:  J Clin Microbiol       Date:  2010-11-24       Impact factor: 5.948

2.  Gordonia species as emerging causes of continuous-ambulatory-peritoneal-dialysis-related peritonitis identified by 16S rRNA and secA1 gene sequencing and matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS).

Authors:  Jimmy Y W Lam; Alan K L Wu; Wai-Shing Leung; Ingrid Cheung; Chi-Ching Tsang; Jonathan H K Chen; Jasper F W Chan; Cindy W S Tse; Rodney A Lee; Susanna K P Lau; Patrick C Y Woo
Journal:  J Clin Microbiol       Date:  2014-11-26       Impact factor: 5.948

3.  Cutaneous abscess due to Gordonia bronchialis: case report and literature review.

Authors:  J Bartolomé-Álvarez; J A Sáez-Nieto; A Escudero-Jiménez; N Barba-Rodríguez; J Galán-Ros; G Carrasco; M P Muñoz-Izquierdo
Journal:  Rev Esp Quimioter       Date:  2016-03-26       Impact factor: 1.553

Review 4.  An insight into the ecology, diversity and adaptations of Gordonia species.

Authors:  Harshada Sowani; Mohan Kulkarni; Smita Zinjarde
Journal:  Crit Rev Microbiol       Date:  2017-12-25       Impact factor: 7.624

5.  Gordonia bacteremia.

Authors:  Poornima Ramanan; Paul J Deziel; Nancy L Wengenack
Journal:  J Clin Microbiol       Date:  2013-07-24       Impact factor: 5.948

6.  A taxonomic note on the authorship and date of valid publication of Rhodococcus sputi.

Authors:  B J Tindall; J P Euzéby
Journal:  Int J Syst Evol Microbiol       Date:  2001-01       Impact factor: 2.747

7.  Infections caused by Gordonia species at a medical centre in Taiwan, 1997 to 2008.

Authors:  C C Lai; C Y Wang; C Y Liu; C K Tan; S H Lin; C H Liao; C H Chou; Y T Huang; H I Lin; P R Hsueh
Journal:  Clin Microbiol Infect       Date:  2010-09       Impact factor: 8.067

8.  Five cases of bacteraemia due to Gordonia species.

Authors:  James C M Brust; Susan Whittier; Brian E Scully; Carlton C McGregor; Michael T Yin
Journal:  J Med Microbiol       Date:  2009-06-15       Impact factor: 2.472

9.  Comparison of the Bruker MALDI-TOF mass spectrometry system and conventional phenotypic methods for identification of Gram-positive rods.

Authors:  Claudia Barberis; Marisa Almuzara; Olivier Join-Lambert; María Soledad Ramírez; Angela Famiglietti; Carlos Vay
Journal:  PLoS One       Date:  2014-09-03       Impact factor: 3.240

10.  Sternal wound infection caused by Gordonia bronchialis: identification by MALDI-TOF MS.

Authors:  Jesús Rodriguez-Lozano; Enrique Pérez-Llantada; Jesús Agüero; Ana Rodríguez-Fernández; Carlos Ruiz de Alegria; Luis Martinez-Martinez; Jorge Calvo
Journal:  JMM Case Rep       Date:  2016-10-31
View more
  1 in total

1.  Evaluation of MALDI Biotyper Interpretation Criteria for Accurate Identification of Nontuberculous Mycobacteria.

Authors:  David Rodriguez-Temporal; Belén Rodríguez-Sánchez; Fernando Alcaide
Journal:  J Clin Microbiol       Date:  2020-09-22       Impact factor: 5.948

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.