Literature DB >> 30026863

HUWE1 controls the development of non-small cell lung cancer through down-regulation of p53.

Dong Yang1,2, Daomei Cheng3, Qiu Tu1, Huihui Yang1, Bin Sun1, Lanzhen Yan1,4, Hongjuan Dai1, Jierong Luo5, Bingyu Mao6, Yi Cao1, Xiaoping Yu3, Hua Jiang2, Xudong Zhao1,4,7,8.   

Abstract

Lung cancer is the most frequent cancer type and the leading cause of tumor-associated deaths worldwide. TP53 is an important tumor suppressor gene and is frequently inactivated in lung cancer. E3 ligases targeting p53, such as MDM2, are involved in the development of lung cancer. The E3 ligase HUWE1, which targets many tumor-associated proteins including p53, has been reported to be highly expressed in lung cancer; however, its role in lung tumorigenesis is unclear.
Methods: The expression of HUWE1 and p53 in lung cancer cells was modulated and the phenotypes were assessed by performing soft agar colony forming assays, cell cycle analysis, BrdU incorporation assays, and xenograft tumor growth assays. The effect on tumorigenesis in genetically-engineered mice was also analyzed. The mechanism through which HUWE1 sustained lung cancer cell malignancy was confirmed by western blotting. HUWE1 expression in clinical lung cancer was identified by immunohistochemistry and validated by analyzing lung adenocarcinoma and lung squamous carcinoma samples from the Cancer Genome Atlas (TCGA) database. Finally, we assessed the association between HUWE1 expression and patient outcome using online survival analysis software including survival information from the caBIG, GEO, and TCGA database.
Results: Inactivation of HUWE1 in a human lung cancer cell line inhibited proliferation, colony-forming capacity, and tumorigenicity. Mechanistically, this phenotype was driven by increased p53, which was due to attenuated proteasomal degradation by HUWE1. Up-regulation of p53 inhibited cancer cell malignancy, mainly through the induction of p21 expression and the down-regulation of HIF1α. Huwe1 deletion completely abolished the development of EGFRVIII-induced lung cancer in Huwe1 conditional knockout mice. Furthermore, survival analysis of lung cancer patients showed that increased HUWE1 expression is significantly associated with worse prognosis.
Conclusion: Our data suggest that HUWE1 plays a critical role in lung cancer and that the HUWE1-p53 axis might be a potential target for lung cancer therapy.

Entities:  

Keywords:  HUWE1; lung cancer; mouse model; p53

Mesh:

Substances:

Year:  2018        PMID: 30026863      PMCID: PMC6037029          DOI: 10.7150/thno.24401

Source DB:  PubMed          Journal:  Theranostics        ISSN: 1838-7640            Impact factor:   11.556


Introduction

Globally, lung cancer is the leading cause of cancer-related death, contributing to 27% of such incidences 1, 2. Furthermore, 80% of lung cancers consist of non-small cell lung cancer (NSCLC), for which only 17.4% patients survive longer than 5 years, despite tremendous efforts to uncover the associated mechanisms and studies to develop new therapies 3, 4. Tumor development involves many cancer-associated genes that act as oncogenes or tumor suppressors. E3 ligases take part in this process by directing specific degradation of these proteins though ubiquitination 5. The dysregulation of E3 ligases frequently results in chemotherapy resistance and poor prognosis 6. E3 ligases have emerged as important targets for tumor therapy. For example, thalidomide and its derivatives, lenalidomide and pomalidomide, inhibit the E3 ligase activity of CRL4CRBN and have been approved by the FDA to treat multiple myeloma 7. Numerous studies have demonstrated that E3 ligases also play important roles in lung cancer. Genetic alterations in c-Cbl, which targets EGFR for proteasomal degradation, were found in lung cancers, and the overexpression of its mutant was determined to promote cellular proliferation and migration 8. In addition, lower expression of the E3 ligase CCNB1IP1 often implies poor survival for lung cancer 9. TP53 is a classic tumor suppressor gene, encoding a protein that inhibits oncogenesis by inducing growth arrest, apoptosis, senescence, and angiogenesis inhibition. Its inactivation is a frequent event in lung cancer and this is classified as a driver mutation 10. Up-regulation or activation of p53 is beneficial for lung tumor treatment 11. Thus, p53 and its upstream effectors such as E3 ligases have become attractive targets for new targeted therapies for lung cancers 11. MDM2 is believed to be a predominant E3 ligase that regulates p53, and its increased expression has been observed in lung cancer. Inactivation of MDM2 results in p53 accumulation and the induction of cell cycle arrest and apoptosis in lung cancer cell lines 12. Several MDM2 inhibitors have been designed for lung cancer therapy, such as Nutlin-3a, RG7112, and MI-773 13. HUWE1 (HECT, UBA, and WWE domain containing 1) is another well-known E3 ligase that targets p53 and many other substrates involved in tumorigenesis. However, the role of HUWE1 in cancer is still controversial based on in vitro and in vivo data. In a colon cancer model induced by APC deletion, Huwe1 knockout promotes cancer development 14; however, Huwe1 inactivation was shown to inhibit the proliferation of the colon cancer cell line Ls174T and its tumorigenicity in immunocompromised mice 15. In a mouse skin cancer model, Huwe1 inhibits tumor development by inducing the degradation of the Myc/Miz complex 16. Our previous studies demonstrated that Huwe1 is essential for the transformation of ovarian epithelial cells and for the development of ovarian cancer by ubiquitinating histone H1.3 for subsequent proteasomal degradation 17. These data imply that the role of Huwe1 in cancer might depend on the type of disease. Although HUWE1 was reported to be overexpressed in lung cancer 9, 18 and to mediate HGF-induced cell migration and invasion by targeting TIAM1 for proteasomal degradation in the H1299 lung cancer cell line 19, the role of HUWE1 and the HUWE1-p53 axis in lung cancer initiation and development have not been investigated. In this study, we found that inactivation of HUWE1 inhibited the proliferation, colony-forming activity, and tumorigenicity of the A549 human lung cancer cell line and abolished the development of lung cancer induced by overexpression of EGFRVIII in mice. p53 accumulation upon HUWE1 deletion was found to be one of the main mechanisms association with the inhibition of tumor growth and angiogenesis.

Methods

Animals

The Huwe1 conditional knockout mouse was described in a previous study 20. The HUWE1 gene is located on chromosome X, and thus male mice have only one allele; therefore, here, the genotype of wild-type mice was referred to as and that of conditional knockout mice was , where y denotes the Y chromosome. Six-week-old BALB/c nude mice were purchased from Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). The animal protocol was approved by the Institutional Review Board at Kunming Institute of Zoology, Chinese Academy of Sciences.

Cell culture

The A549 human lung adenocarcinoma cell line was purchased from China Infrastructure of Cell Line Resources and tested via short tandem repeat (STR) profiling by the provider. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM, Life Technologies, USA) medium supplemented with 10% heat-inactivated fetal bovine serum (Life Technologies, USA) and maintained in a humidified incubator with 5% CO2 at 37 °C.

Plasmid construction and lentiviral preparation

The lentiviral vector pTomo-EGFRVIII-IRES-Cre was constructed based on the backbone of the pTomo vector. pTomo was a gift from Inder Verma (Addgene plasmid #26291) 21. The genetic element EGFRVIII-IRES-Cre was cloned into pTomo between the XbaI and SalI restriction sites. For the HUWE1 and TP53 shRNA plasmids, the target sequences were cloned into a Tet-pLKO-puro vector obtained from ADDGENE according to the manufacturer's protocol (http://www.addgene.org/21915/). The following target sequences were used: HUWE1, 5´CGACGAGAACTAGCACAG-AAT3´ 22 and TP53: 5´CGGCGCACAGAGGAAGAGAAT3´ 23. The DNA vectors were co-transfected into HEK293T cells with the helper plasmids pCMVΔ8.9 and pMD2.G at a ratio of 10:5:2 for lentiviral packaging as described previously 17.

RNA isolation and real-time PCR

Total RNA was isolated using Trizol (Sigma-Aldrich, USA) and DNA contaminants were removed using the TURBO DNA-free TM Kit (Life Technologies, USA). Next, 2 μg of total RNA was reverse transcribed using random primers and the RevertAid First Strand cDNA Synthesis kit (Thermo Scientific, USA). Quantitative PCR was performed in triplicate using the SYBR Green method (Life Technologies, USA) according to the manufacturer's instructions. The cycle threshold (CT) values of the target genes were normalized to those of 18S rRNA. All primers used in this study are shown in Table .

Colony formation assay

Colony formation assay in soft agar was performed as described before 17. Briefly, 1.5 × 104 single cells were mixed with 1 mL DMEM supplemented with 10% FBS and 0.3% soft agar (Sigma-Aldrich, USA), and then the mixture was added to the top of the base agar containing 0.6% agarose in a 6-well plate. After 5 weeks, 1 mL of PBS containing 4% formaldehyde and 0.005% crystal violet was added to fix and stain the colonies.

Cell cycle analysis

Cells were digested with 0.25% trypsin-EDTA (Life Technologies, USA) and fixed with 70% ethanol for 12 h at 4 °C. Then, the cells were treated with RNase A (QIAGEN, German) and propidium iodide (PI; Sigma-Aldrich, USA) for 0.5 h. Cell cycle analyses were performed by flow cytometry using the BD FACSVantage™ SE System.

HUWE1 gene editing

The guide RNA (gRNA) sequences for HUWE1 were designed using the Target Finder program and cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene plasmid #42230) 24. Constructed plasmids were transfected into 293T cells and genomic DNA was extracted 3 days later. PCR was performed to amplify the gRNA targeting region and a T7 endonuclease I assay was used to assess targeting efficiency. The most efficient gRNA-3840 was then transfected into A549 cells and single-cell culture was established using the limiting dilution method. The HUWE1-null clones were screened by DNA sequencing and western blotting. All gRNA sequences are listed in Table .

Xenograft mouse models of lung cancer

A549/teton-shHUWE1 cells, established by transduction of A549 with lentiviral particles expressing HUWE1 shRNA, were resuspended at 1 × 107 cells/mL in PBS containing 30% Matrigel (BD Biosciences, USA) and subcutaneously injected into 6-week-old BALB/c nude mice (1 × 106 cells per mouse). When the subcutaneous tumors reached approximately 5 mm in diameter, doxycycline (DOX) was delivered via the drinking water, which contained 5% sucrose. Tumor volume was calculated based on the formula 0.5 × length × width2 25. The data are shown as the means ± standard deviation (SD), and statistical analyses were performed using GraphPad Prism statistical software.

Intranasal inoculation

Mice were subjected to general anesthesia with 2.5% avertin by intraperitoneal injection (15 mL/kg). The mice were placed with their head forward in a supine position and 2 × 105 lentivirus particles in 70 µL PBS was gradually released into the nostrils with sterile pipette tips. Finally, the mice were allowed to slowly wake up, and tumorigenesis was subsequently observed.

Survival analyses

Survival analyses were performed as described 26. In brief, 1926 lung cancer patients were split into two groups, with the lower tertile expression of the target gene as the cut-off level. The two patient cohorts were compared by a Kaplan-Meier survival plot analysis using the default parameters, and the hazard ratio with 95% confidence intervals and log-rank P value were calculated. The probe set used was 207783_x_at for HUWE1 and 205385_at for MDM2.

Western blotting and co-immunoprecipitation

Tissues or cells were lysed using RIPA buffer 17 supplemented with a 1× protease inhibitor cocktail (Roche, Switzerland) and 0.1 mg/mL phenylmethylsulfonyl fluoride (Sigma-Aldrich, USA) for 30 min on ice. Protein concentration was determined using the BCA protein assay kit (Beyotime, China). Then, 100 μg of protein was subjected to standard SDS-PAGE electrophoresis. For co-immunoprecipitations, 1 × 107 cells were treated with 5 μM MG-132 for 6 h, lysed in lysis buffer [50 mM tris HCl, 150 mM NaCl, 1 mM EDTA, 1% triton X-100, and a 1× protease inhibitor cocktail], and 500 μg of total protein was incubated with 10 μL of p53 antibody and 20 μL protein G agarose (Santa Cruz, USA); co-immunoprecipitation was performed in accordance with the manufacturer's instructions. The antibodies used in the study are shown in Table . The use of human cancer tissues was approved by the Institutional Review Board at Kunming Institute of Zoology, Chinese Academy of Sciences.

BrdU incorporation assay

The BrdU incorporation assay was performed as described elsewhere 17. BrdU (Thermo Scientific, USA) was added to the cell medium at a final concentration 10 μM and incubated for 1 h. The labeled cells were fixed with 4% paraformaldehyde, permeabilized with 0.3% triton-X-100, denatured with 2 M HCl, and blocked with 10% goat serum. The cells were stained for 1 h at room temperature with anti-BrdU primary antibody (Abcam, ab6326, 1:250), and then incubated with the CY3-labeled secondary antibody. The data were quantitated by counting the number of BrdU-positive cells in seven random microscopic views for each sample. The data are presented as the means ± SD.

Immunohistochemical staining

Immunohistochemical staining was performed as described previously 17. Information regarding all primary antibodies is provided in Table .

Results

HUWE1 expression in lung cancer

Although an increase in HUWE1 mRNA was reported in lung cancer, HUWE1 expression in lung cancer at the protein level had not been explored. Thus, we performed immunohistochemistry to determine and compare the expression of HUWE1 using a tissue microarray (Shanghai Outdo Biotech Co., ltd) containing 14 pairs of lung cancer and adjacent normal tissues. HUWE1 expression was elevated in cancer tissue in seven of 14 pairs (Figure ). To further confirm HUWE1 expression in larger tissue sections, immunohistochemistry was performed on frozen sections and similar staining patterns were observed (Figure ). Proteins were also extracted from another 10 pairs of frozen samples for western blot analysis, which confirmed the increase in HUWE1 expression in cancer (Figure ). Thus, our experimental results showing protein levels and previous studies exhibiting transcriptional levels all indicate the dysregulation of HUWE1 in lung cancers.

HUWE1 inactivation inhibits lung cancer cell proliferation and tumor growth

To study the role of HUWE1 in lung cancer, we performed genome editing on the HUWE1 gene in a widely-used lung cancer cell line, A549, using CRISPR/cas9 (Figure ). Single-cell clones were picked and expanded, and HUWE1 inactivation was confirmed by DNA sequencing and western blotting. HUWE1 intact clones A549AA1 and A549CF5 and HUWE1-null clones A549AD11 and A549CC10 were used for the following experiment (Figure and Figure ). As shown in the cell growth curve, the proliferation was significantly inhibited by HUWE1 deletion (Figure ). Both an increased proportion of cells in the G1 phase and decreased BrdU-incorporation indicated G1 arrest upon HUWE1 inactivation (Figure and Figure ). Moreover, HUWE1-null clones also showed significantly decreased colony formation capacity (Figure ). No obvious cell death was observed in HUWE1-null cells, and this conclusion was also verified by the apoptosis marker cleaved caspase-3 staining (Figure ). Although it was reported that some substrates of HUWE1 are involved in DNA damage, results from the comet assay did not appear to detect remarkable changes upon HUWE1 deletion (Figure ). To determine if HUWE1 deletion inhibits tumor growth, HUWE1-intact clones A549AA1 and HUWE1-null clones A549AD11 were injected subcutaneously into immunocompromised mice. A549AD11 xenograft tumors grew significantly slower than formed by A549AA1 cells (Figure ). Mice were sacrificed after 30 days, and immunohistochemical staining was performed. As expected, HUWE1 was completely absent in tumors derived from A549AD11 cells and expression of the proliferation marker Ki-67 was significantly reduced (Figure ). Interestingly, an increase in cellular apoptosis was observed in tumors, which was not observed in vitro (Figure ). To further confirm the role of HUWE1 in lung cancer cells, A549 cells were infected with lentivirus expressing tetracycline-inducible HUWE1 shRNA (A549/teton-shHUWE1). HUWE1 knockdown was confirmed by western blotting (Figure ). As shown in HUWE1-null cells, knockdown of this gene impaired proliferation and colony-forming activity in lung cancer cells but had no effect on apoptosis. (Figure ). A549/teton-shHUWE1 cells were subcutaneously injected into immunocompromised mice and HUWE1 knockdown was induced by doxycycline 7 days after injection when tumor sizes reached approximately 5 mm in diameter. Treatment with doxycycline inhibited tumor growth and decreased tumor size (Figure ). When mice were sacrificed on day 32 after Dox treatment, the mice that received Dox treatment had significantly diminished tumor burden compared to that in the control group (Figure ). Immunohistochemical staining indicated a decrease in HUWE1 protein expression in Dox-treated tumors (Figure ). HUWE1 knockdown also decreased the number of proliferating cells and increased the expression of the apoptosis marker cleaved-caspase 3 (Figure ).

p53 is a key mediator of the phenotype induced by HUWE1 inhibition

To elucidate the molecular mechanisms through which HUWE1 inactivation inhibits tumor growth, the substrates of HUWE1 were detected by western blotting. p53 was significantly accumulated, whereas some other substrates such as Miz-1 and c-MYC increased slightly (Figure ). No significant change was found regarding the expression of histone H1.3, which was reported to be a substrate of HUWE1 and to mediate the role of HUWE1 in ovarian cancer (Figure ). We then determined the expression of p53-regulated genes by real-time PCR. Consistent with our expectations, many genes encoding proteins such as the cell-cycle inhibitor CDKN1A, the apoptosis promoters PUMA, TP53I3, BAX, and FAX, the DNA damage response-associated SESN2, and the angiogenesis inhibitors SERPINE1 and CD82 were up-regulated upon HUWE1 inactivation (fold change > 2; Figure ). The MDM2 gene encoding an E3 ligase that ubiquitinates p53 for proteasome-mediated degradation also increased (Figure ), which might be due to feedback regulation 27. These data demonstrated the increase in p53 expression and activation of the p53 pathway. p53 is a well-known tumor suppressor and thus we speculated that its increase might explain the inhibition of tumor growth by HUWE1 inactivation in lung cancer. Considering that decreased cell proliferation was one of the main phenotypes associated with HUWE1 inactivation, the expression of cell-cycle associated proteins was assessed. Similar to real-time PCR data, p21 remarkably increased upon HUWE1 deletion, which could be attributed to p53 upregulation. Cyclin D1, the target protein of p21, also decreased in HUWE1-null cells (Figure ). It has been reported that the cyclinD1-CDK4 complex promotes passage through the G1 phase by inhibiting the retinoblastoma protein 28. We assessed expression of core c-Myc downstream targets including cyclin A, cyclin E, and CDK4, and found no significant changes when HUWE1 was inactivated (Figure ). As the significant difference in apoptosis between in vivo and in vitro conditions was speculated to be potentially caused by hypoxemia, HIF1α, which is also regulated by p53 on the protein level and plays an important role in enhancing tumor growth by promoting angiogenesis and regulating cellular metabolism to overcome hypoxia, was also assessed by western blotting; this protein was found to be down-regulated with HUWE1 ablation (Figure ). To determine if HUWE1 affects tumorigenesis by maintaining HIF1α expression, markers of angiogenesis including VEGF, Tie2, and CD31 were detected in the lysates of subcutaneous tumors formed by A549 cells. Results showed that all of these proteins were strikingly down-regulated with HUWE1 inactivation (Figure and Figure ). To confirm the role of p53 in mediating the phenotype associated with HUWE1 down-regulation, TP53 was silenced in HUWE1-null cells. The up-regulation of p21 and down-regulation of HIF1α mediated by HUWE1 deletion were partially rescued by p53 silencing (Figure ). Phenotypically, the effects of HUWE1 ablation on cell proliferation and colony formation were also partially rescued (Figure ). However, reduced p53 expression did not restore SERPINE1 and CD82 expression on the mRNA level, although they were up-regulated upon HUWE1 inactivation (Figure ). We speculated that they could be regulated by HUWE1 in a p53-independent manner. Taken together, the aforementioned data demonstrate that p53 is one of the key mediators of HUWE1 in lung cancer. Ubiquitin-dependent p53 degradation mediated by HUWE1 was reported in previous studies 29. Here we determined the associated mechanism in lung cancer cells. Co-immunoprecipitation was performed in A549 cells harboring intact HUWE1. Western blot analysis demonstrated binding between HUWE1 and p53 (Figure ). Next, ubiquitination assays were performed in HUWE1-intact and HUWE1-null cells and we found that HUWE1 deletion decreased the level of ubiquitinated p53 (Figure ).

Huwe1 deletion inhibits lung cancer development in mice

To further elucidate the role of Huwe1 in lung cancer, we studied its effect on lung cancer formation in Huwe1 conditional knockout mice. Alterations in EGFR have been confirmed to be driver mutations in human lung cancer and are widely used in mouse models for lung cancer research 10, 30. Here we constructed a lentiviral vector expressing EGFRVIII and Cre driven by the carbonic anhydrase II (CAII) promoter, which is expressed mainly in alveolar epithelial cells and was previously demonstrated to efficiently drive adenocarcinoma formation in mouse lungs 31. Lentiviral particles were tested for EGFRVIII expression and Huwe1 deletion in vitro (Figure ), and these were then delivered via intranasal infection. We determined that 54% of Huwe1+/Y mice developed lung cancer by 8 months after lentivirus infection, whereas all Huwe1L/Y mice were healthy with no obvious signs of lung cancer (Figure ). Similar to previous reports of EGFRVIII-induced lung cancer, histological examination of lung cancer in Huwe1+/Y mice showed characteristics of lung adenocarcinoma 32, 33 (Figure ). This was also confirmed by pulmonary-associated surfactant protein C (SPC)-positive and clara cell-specific protein (CC10)-negative staining (Figure ). Cellular proliferation was also detected in cancers, and the rate of Ki67 positivity was approximately 10%, which is similar to that in human adenocarcinomas 34 (Figure ). In conclusion, these data demonstrated the critical role of Huwe1 in lung cancer development.

High expression of HUWE1 is associated with poor survival in lung cancer patients

To clarify the clinical relevance of HUWE1, we analyzed the RNA-Seq data of paired lung cancer and para-cancerous tissues from The Cancer Genome Atlas (TCGA) and found that approximately 82% of lung adenocarcinomas and 73% of lung squamous cell carcinomas had elevated HUWE1 expression compared to that in paired normal tissue (fold change > 1, Figure ). Unexpectedly, the change in MDM2 was not significant (Figure ). Importantly, survival analysis showed that increased HUWE1 expression is significantly associated with poorer prognosis using online survival analysis software including survival information of the caBIG, GEO, and TCGA databases 26 (Figure ). However, there was no significant association between MDM2 expression and prognosis (Figure ). By analyzing the RNA-Seq data of lung adenocarcinoma and squamous cancer tissues from TCGA, we found that the expression of CDKN1A (the gene encoding p21) in the HUWE1-low expression group was significantly higher than that in the in HUWE1-high expression group (Figure ), which was consistent with our experimental data. Meanwhile, MDM2 had no obvious relationship with CDKN1A (Figure ). The non-significant correlation between HIF1α and HUWE1 at the transcription level, which was shown in our experiment, was also confirmed by the RNA-Seq data from the TCGA (data not shown). These results suggested that HUWE1 regulates HIF1α expression primarily at the protein level in non-small-cell lung carcinoma.

Discussion

Many HUWE1 substrates have been identified, such as the tumor suppressors BRCA1 35 and p53 29, the oncogenes c-Myc 18 and n-Myc 36, the anti-apoptotic factor Mcl-1 37, the cell cycle protein CDC6 38, the DNA damage repair-related proteins H2AX 39 and TopBP1 40, the DNA polymerase Pol β 41 and Pol λ 42, and key proteins of the Wnt signaling pathway, including β-catenin 43 and Dishevelled 44. By controlling the stability of its substrates, HUWE1 is involved in biological processes such as DNA damage repair, cell proliferation, apoptosis, differentiation, migration, neurodevelopment, and spermatogenesis. HUWE1 overexpression was reported in cancers of the ovary, lung, breast, colon, liver, and pancreas 9, 18. However, as shown in the TCGA database, deletions or mutations in the HUWE1 gene were also found in a significant number of human samples such as lung, esophageal, cervical, melanoma, head and neck. These results suggest that HUWE1 plays a diverse role in different cancer types, or even in different patients with the same type. This was also confirmed by in vivo and in vitro studies 14-16, 29, 37. Previous data showed that HUWE1 performed oncogenic functions mainly through the activation of the proto-oncogene c-Myc 18, 45, or by targeting histone H1.3 for ubiquitination and degradation 17. However, in this study, we found that the oncogenic function of HUWE1 occurs through a different mechanism. p53, rather than H1.3 or c-Myc, was the most significantly increased substrate. In HUWE1-null cells, p21, a well-known transcriptional target of TP53, increased at the mRNA and protein level, and resulted in the G1 arrest of cancer cells. Meanwhile, another p53 target protein HIF1α was down-regulated, which blocked angiogenesis in a xenograft model. p53 accumulation mediated by HUWE1 inactivation has been frequently reported to induce apoptosis, for example, in U2OS cells in vitro 29 and in mouse pancreatic β-cells in vivo 46. Nonetheless, HUWE1 inactivation in a human lung cancer cell line did not induce cellular apoptosis in vitro. Interestingly, HUWE1 inactivation obviously resulted in apoptosis in xenograft tumors. This might have resulted from the hypoxic environment and the decrease in HIF1α in solid tumors. HIF1α is a recognized oncogene that has been reported to help cancer cells overcome hypoxia through its role in initiating angiogenesis and regulating cellular metabolism. Although an association between HUWE1 and HIF1α has not been reported, another E3 ligase, MDM2, which targets p53, was shown to inhibit HIF1α directly or through degradation of the p53/HIF1α complex 47. In our experiments, the fact that p53 silencing could rescue the expression of HIF1α implied that the decrease in this protein was mediated by p53 instead of through direct degradation by HUWE1. Although MDM2 has been reported as the primary E3 ligase that is directly involved in p53 regulation, an increasing number of studies suggest that p53 proteasomal degradation is also part of the MDM2-independent pathway 29, 48. p53 was the first identified substrate of HUWE1 29, 49. However, no direct evidence has demonstrated a role for the HUWE1-p53 axis in lung cancer. Based on the analysis of paired lung cancer and adjacent normal tissues from the TCGA database, we found that increased HUWE1 expression was much higher than that of MDM2. Accordingly, samples with increased HUWE1 expression were associated with worse prognosis. Meanwhile, MDM2 expression did not correlate with survival. These data suggested that HUWE1 might play more important roles in lung cancer and could be more clinically relevant than MDM2. Small molecules inhibiting the MDM2-p53 association have been tested for lung cancer therapy in preclinical studies 13. Our results suggest that the HUWE1-p53 axis might represent a better target for lung cancer treatment. Some efforts have been made to screen or design molecules that target HUWE1 for cancer therapy. BI8622 and BI8626 inhibit the proliferation and colony formation of the colon cancer cell line Ls174T by preventing MYC-dependent transactivation 15. Taken together, HUWE1 plays a critical role in the initiation and development of lung cancer by controlling p53 proteasomal degradation. Hence, the HUWE1-p53 axis is important for mediating the effects of HUWE1 in lung cancer, and thus could represent a potential target for lung cancer treatment.
  49 in total

1.  Mule/ARF-BP1, a BH3-only E3 ubiquitin ligase, catalyzes the polyubiquitination of Mcl-1 and regulates apoptosis.

Authors:  Qing Zhong; Wenhua Gao; Fenghe Du; Xiaodong Wang
Journal:  Cell       Date:  2005-07-01       Impact factor: 41.582

2.  E3 ubiquitin ligase Mule targets β-catenin under conditions of hyperactive Wnt signaling.

Authors:  Carmen Dominguez-Brauer; Rahima Khatun; Andrew J Elia; Kelsie L Thu; Parameswaran Ramachandran; Shakiba P Baniasadi; Zhenyue Hao; Lisa D Jones; Jillian Haight; Yi Sheng; Tak W Mak
Journal:  Proc Natl Acad Sci U S A       Date:  2017-01-30       Impact factor: 11.205

3.  UREB1, a tyrosine phosphorylated nuclear protein, inhibits p53 transactivation.

Authors:  J Gu; R Dubner; A J Fornace; M J Iadarola
Journal:  Oncogene       Date:  1995-11-16       Impact factor: 9.867

Review 4.  Mouse models for human lung cancer.

Authors:  Ralph Meuwissen; Anton Berns
Journal:  Genes Dev       Date:  2005-03-15       Impact factor: 11.361

5.  NCCN Guidelines Insights: Non-Small Cell Lung Cancer, Version 4.2016.

Authors:  David S Ettinger; Douglas E Wood; Wallace Akerley; Lyudmila A Bazhenova; Hossein Borghaei; David Ross Camidge; Richard T Cheney; Lucian R Chirieac; Thomas A D'Amico; Thomas J Dilling; M Chris Dobelbower; Ramaswamy Govindan; Mark Hennon; Leora Horn; Thierry M Jahan; Ritsuko Komaki; Rudy P Lackner; Michael Lanuti; Rogerio Lilenbaum; Jules Lin; Billy W Loo; Renato Martins; Gregory A Otterson; Jyoti D Patel; Katherine M Pisters; Karen Reckamp; Gregory J Riely; Steven E Schild; Theresa A Shapiro; Neelesh Sharma; James Stevenson; Scott J Swanson; Kurt Tauer; Stephen C Yang; Kristina Gregory; Miranda Hughes
Journal:  J Natl Compr Canc Netw       Date:  2016-03       Impact factor: 11.908

Review 6.  Non-small-cell lung cancers: a heterogeneous set of diseases.

Authors:  Zhao Chen; Christine M Fillmore; Peter S Hammerman; Carla F Kim; Kwok-Kin Wong
Journal:  Nat Rev Cancer       Date:  2014-08       Impact factor: 60.716

7.  Cdc6 stability is regulated by the Huwe1 ubiquitin ligase after DNA damage.

Authors:  Jonathan R Hall; Evelyn Kow; Kathleen R Nevis; Chiajung Karen Lu; K Scott Luce; Qing Zhong; Jeanette Gowen Cook
Journal:  Mol Biol Cell       Date:  2007-06-13       Impact factor: 4.138

8.  Tracking the Evolution of Non-Small-Cell Lung Cancer.

Authors:  Mariam Jamal-Hanjani; Gareth A Wilson; Nicholas McGranahan; Nicolai J Birkbak; Thomas B K Watkins; Selvaraju Veeriah; Seema Shafi; Diana H Johnson; Richard Mitter; Rachel Rosenthal; Max Salm; Stuart Horswell; Mickael Escudero; Nik Matthews; Andrew Rowan; Tim Chambers; David A Moore; Samra Turajlic; Hang Xu; Siow-Ming Lee; Martin D Forster; Tanya Ahmad; Crispin T Hiley; Christopher Abbosh; Mary Falzon; Elaine Borg; Teresa Marafioti; David Lawrence; Martin Hayward; Shyam Kolvekar; Nikolaos Panagiotopoulos; Sam M Janes; Ricky Thakrar; Asia Ahmed; Fiona Blackhall; Yvonne Summers; Rajesh Shah; Leena Joseph; Anne M Quinn; Phil A Crosbie; Babu Naidu; Gary Middleton; Gerald Langman; Simon Trotter; Marianne Nicolson; Hardy Remmen; Keith Kerr; Mahendran Chetty; Lesley Gomersall; Dean A Fennell; Apostolos Nakas; Sridhar Rathinam; Girija Anand; Sajid Khan; Peter Russell; Veni Ezhil; Babikir Ismail; Melanie Irvin-Sellers; Vineet Prakash; Jason F Lester; Malgorzata Kornaszewska; Richard Attanoos; Haydn Adams; Helen Davies; Stefan Dentro; Philippe Taniere; Brendan O'Sullivan; Helen L Lowe; John A Hartley; Natasha Iles; Harriet Bell; Yenting Ngai; Jacqui A Shaw; Javier Herrero; Zoltan Szallasi; Roland F Schwarz; Aengus Stewart; Sergio A Quezada; John Le Quesne; Peter Van Loo; Caroline Dive; Allan Hackshaw; Charles Swanton
Journal:  N Engl J Med       Date:  2017-04-26       Impact factor: 91.245

9.  Online survival analysis software to assess the prognostic value of biomarkers using transcriptomic data in non-small-cell lung cancer.

Authors:  Balázs Győrffy; Pawel Surowiak; Jan Budczies; András Lánczky
Journal:  PLoS One       Date:  2013-12-18       Impact factor: 3.240

10.  MDM2 but not MDM4 promotes retinoblastoma cell proliferation through p53-independent regulation of MYCN translation.

Authors:  D-L Qi; D Cobrinik
Journal:  Oncogene       Date:  2016-10-17       Impact factor: 9.867

View more
  18 in total

1.  Intermittent fasting from dawn to sunset for 30 consecutive days is associated with anticancer proteomic signature and upregulates key regulatory proteins of glucose and lipid metabolism, circadian clock, DNA repair, cytoskeleton remodeling, immune system and cognitive function in healthy subjects.

Authors:  Ayse L Mindikoglu; Mustafa M Abdulsada; Antrix Jain; Jong Min Choi; Prasun K Jalal; Sridevi Devaraj; Melissa P Mezzari; Joseph F Petrosino; Antone R Opekun; Sung Yun Jung
Journal:  J Proteomics       Date:  2020-01-09       Impact factor: 4.044

2.  HUWE1 mediates inflammasome activation and promotes host defense against bacterial infection.

Authors:  Yu Guo; Longjun Li; Tao Xu; Xiaomin Guo; Chaoming Wang; Yihui Li; Yanan Yang; Dong Yang; Bin Sun; Xudong Zhao; Genze Shao; Xiaopeng Qi
Journal:  J Clin Invest       Date:  2020-12-01       Impact factor: 14.808

3.  The E3 ligase HUWE1 mediates TGFBR2 ubiquitination and promotes gastric cancer cell proliferation, migration, and invasion.

Authors:  Yuting He; Jianming Zhou; Qinsi Wan
Journal:  Invest New Drugs       Date:  2021-01-06       Impact factor: 3.850

4.  The E3 ligase HUWE1 inhibition as a therapeutic strategy to target MYC in multiple myeloma.

Authors:  Lisa J Crawford; David C Campbell; Jonathan J Morgan; Michelle A Lawson; Jennifer M Down; Dharminder Chauhan; Roisin M McAvera; Treen C Morris; Claudia Hamilton; Aswini Krishnan; Krishnaraj Rajalingam; Andrew D Chantry; Alexandra E Irvine
Journal:  Oncogene       Date:  2020-06-10       Impact factor: 9.867

Review 5.  Mitophagy in Cancer: A Tale of Adaptation.

Authors:  Monica Vara-Perez; Blanca Felipe-Abrio; Patrizia Agostinis
Journal:  Cells       Date:  2019-05-22       Impact factor: 6.600

6.  Silencing Huwe1 reduces apoptosis of cortical neurons exposed to oxygen-glucose deprivation and reperfusion.

Authors:  Guo-Qian He; Wen-Ming Xu; Hui-Juan Liao; Chuan Jiang; Chang-Qing Li; Wei Zhang
Journal:  Neural Regen Res       Date:  2019-11       Impact factor: 5.135

7.  Identification of seven-gene signature for prediction of lung squamous cell carcinoma.

Authors:  Zhe Wang; Zhongmiao Wang; Xing Niu; Jie Liu; Zhuning Wang; Lijie Chen; Baoli Qin
Journal:  Onco Targets Ther       Date:  2019-07-24       Impact factor: 4.147

8.  T cells expressing NKG2D chimeric antigen receptors efficiently eliminate glioblastoma and cancer stem cells.

Authors:  Dong Yang; Bin Sun; Hongjiu Dai; Wenxuan Li; Lan Shi; Peixian Zhang; Shirong Li; Xudong Zhao
Journal:  J Immunother Cancer       Date:  2019-07-09       Impact factor: 13.751

Review 9.  Developing Small-Molecule Inhibitors of HECT-Type Ubiquitin Ligases for Therapeutic Applications: Challenges and Opportunities.

Authors:  Dan Chen; Matthias Gehringer; Sonja Lorenz
Journal:  Chembiochem       Date:  2018-10-17       Impact factor: 3.164

Review 10.  The role of miRNA biogenesis and DDX17 in tumorigenesis and cancer stemness.

Authors:  Kou-Juey Wu
Journal:  Biomed J       Date:  2020-04-13       Impact factor: 4.910

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.