Literature DB >> 30023315

Detection of plasmid-mediated colistin-resistant and carbapenem-resistant genes by multiplex PCR.

Rujirat Hatrongjit1, Anusak Kerdsin2, Yukihiro Akeda3, Shigeyuki Hamada4.   

Abstract

A multiplex PCR was described to simultaneously detect mcr-1 and frequently occurring carbapenem-resistant genes including blaKPC, blaNDM, blaIMP, and blaOXA-48-like in a single reaction. The PCR product sizes of these 4 carbapenem-resistant genes were 232 bp, 438 bp, 621 bp, and 798 bp for blaIMP, blaOXA-48-like, blaNDM, and blaKPC, respectively, whereas mcr-1 revealed 1126 bp of PCR product. This protocol accurately detected those resistant genes in agreement with the reference strains, 127 local carbapenem-resistant Enterobacteriaceae, 8 mcr-1 carrying Enterobacteriaceae, and 62 carbapenem-susceptible Enterobacteriaceae. This method will be useful for laboratory application and surveillance of carbapenem and/or colistin-resistant bacteria.

Entities:  

Keywords:  PCR; blaIMP; blaKPC; blaNDM; blaOXA-48-like; mPCR for mcr-1 and carbapenem-resistant genes; mcr-1

Year:  2018        PMID: 30023315      PMCID: PMC6046614          DOI: 10.1016/j.mex.2018.05.016

Source DB:  PubMed          Journal:  MethodsX        ISSN: 2215-0161


Specifications Table

Value of the protocol

Simultaneous detection of four frequent clinically relevant carbapenem-resistant genes and mcr-1 by multiplex PCR in a single reaction. Rapid, simple, and reliable for detection of frequently clinically relevant carbapenem and colistin-resistant genes (mcr-1) from pure culture. Useful for laboratory application and surveillance of carbapenem-resistant and/or colistin-resistant bacteria. Useful for detection of isolates co-carry mcr-1 and carbapenemase genes such as mcr-1 and blaNDM.

Description of protocol

Carbapenem-resistant organisms such as blaKPC, blaNDM, blaIMP, blaOXA48-like, and the emergence of the mcr-1 gene, a plasmid-mediated gene that confers colistin resistance in Enterobacteriaceae, have both been increasingly recognized worldwide. The spread of mcr-1-encoding plasmids into carbapenem-resistant Enterobacteriaceae raises concerns about the emergence of untreatable bacteria and it poses a serious threat to public health worldwide. Many PCR techniques have been described to detect these resistant genes; however, no PCR (especially multiplex PCR) procedure has been described for detecting both mcr-1 and carbapenem-resistant genes in a single reaction. This study describes a protocol to simultaneously detect mcr-1 and frequently occurring carbapenem-resistant genes (blaKPC, blaNDM, blaIMP, blaOXA48-like) as well as to detect co-existence of mcr-1 and carbapenem-resistant genes in a single reaction from Gram-negative bacteria.

Major equipment and supplies for PCR assay

PCR thermal cycler (Takara, Japan or equivalent) PCR tubes (Nest Scientific, USA or equivalent) Sterile Eppendorf style microcentrifuge tubes (Nest Scientific, USA or equivalent) Sterile inoculating loops or needles (Nest Scientific, USA or equivalent) Ice bucket or bench top cooler Adjustable micropipettors (0.1–1000 μl) Aerosol-resistant micropipettor tips (0.1–1000 μl) Vortex Mixer (CAPP, Denmark or equivalent) Microcentrifuge (CAPP, Denmark or equivalent)

Reagents for DNA extraction

Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, USA or equivalent) Sodium hydroxide (Sigma-Aldrich, USA or equivalent)

Reagents for PCR assay

JumpStart™ REDTaq® ReadyMix™ PCR Reaction Mix (Sigma-Aldrich, USA) PCR grade water (Omega, USA or equivalent) 10X Tris-Borate-EDTA buffer (TBE) (Omega, USA or equivalent) Agarose gel (Sigma-Aldrich, USA or equivalent) Primers (Sigma-Aldrich, USA or equivalent)

Procedures

Bacteria and DNA extraction

Bacteria were cultured on blood agar or McConkey agar at 37 °C for 18–24 h. DNA was prepared by heating one or two colonies from an overnight grown plate at 95 °C for 15 min in 30 μl of lysis buffer containing 0.25% (vol/vol) sodium dodecyl sulfate and 0.05 M NaOH. After lysis, 200 μl of sterile distilled water was added to the lysis buffer and the DNA solutions were stored at −20 °C until PCR analysis.

Multiplex PCR analysis

The multiplex PCR assay was performed in 15-μl reaction mixtures, containing 2 μl of template, 1.5 μl of deionized water, 1X JumpStart™ REDTaq® ReadyMix™ PCR Reaction Mix (Sigma–Aldrich, USA) and 0.53 μM of each primer (Table 1). The composition of the reagents in the multiplex PCR is shown in the Table 2.
Table 1

Primers sequences.

NameSequence (5’–3’)PCR product size (bp)Reference
IMP-FGGAATAGAGTGGCTTAAYTCTC232[1]
IMP-RGGTTTAAYAAAACAACCACC
OXA-48-like-FGCGTGGTTAAGGATGAACAC438[1]
OXA-48-like-RCATCAAGTTCAACCCAACCG
NDM-FGGTTTGGCGATCTGGTTTTC621[1]
NDM-RCGGAATGGCTCATCACGATC
KPC-FCGTCTAGTTCTGCTGTCTTG798[1]
KPC-RCTTGTCATCCTTGTTAGGCG
MCR1-FGGGTGTGCTACCAAGTTTGC1126[2]
MCR1-RCATTGGCGTGATGCCAGTTT
Table 2

Contents of mPCR reaction.

ReagentsFinal concentrationμl per reaction
Deionized water1.5
2X JumpStartTM REDTaq® ReadyMixTM PCR reaction mix1X7.5
20 μM IMP-F0.530.4
20 μM IMP-R0.530.4
20 μM OXA-48-F0.530.4
20 μM OXA-48-R0.530.4
20 μM NDM-F0.530.4
20 μM NDM-R0.530.4
20 μM KPC-F0.530.4
20 μM KPC-R0.530.4
20 μM MCR1 -F0.530.4
20 μM MCR1 -R0.530.4
DNA extracted2
Total volume15
Primers sequences. Contents of mPCR reaction. The following PCR thermal profile was used: initial activation of DNA polymerase at 95 °C for 3 min; 30 cycles of denaturation at 95 °C for 30 s, primer annealing at 56 °C for 30 s and extension at 72 °C for 45 s, and a final extension at 72 °C for 5 min. The PCR products were analyzed using gel electrophoresis for 30 min on 2% agarose gels in 0.5X TBE buffer. The gels were stained with ethidium bromide and visualized under ultraviolet light (GeneGenius Bioimaging System, SynGene). The sizes of the PCR products were determined by comparison with a molecular-sized standard (GeneRuler™ 100 bp Plus DNA ladder, Thermo Fisher Scientific).

Interpretation

As shown in Fig. 1, our multiplex PCR differentiated 4 prevalent carbapenemase genes and mcr-1. The PCR product sizes of these 4 carbapenemase genes were about 232 bp, 438 bp, 621 bp, and 798 bp for blaIMP, blaOXA-48-like, blaNDM, and blaKPC, respectively, whereas mcr-1 revealed 1126 bp of PCR product.
Fig. 1

Agarose gel electrophoresis of PCR-amplified products from the representative four carbapenem-resistant genes and mcr-1. Lane M = 100 bp DNA ladder, lane 1 = K. pneumoniae strain no.1385 (blaNDM), lane 2 = K. pneumoniae strain no. 1386 (blaOXA-48-like), lane 3 = E. coli strain no.A434-59 (blaNDM and mcr-1), lane 4 = E. coli strain no.98 (blaNDM and blaOXA-48-like), lane 5 = E. coli strain no.1387 (blaOXA-48-like), lane 6 = K. pneumoniae strain no.1263 (blaNDM), lane 7 = K. pneumoniae strain 22 (blaIMP-14a), lane 8 = K. pneumoniae ATCC® BAA-2524™ (blaOXA48), lane 9 = E. coli ATCC® BAA-2452™ (blaNDM-1), lane 10 = K. pneumoniae ATCC® BAA-1705™ (blaKPC), lane 11 = E. coli AK1 (a strain carrying mcr-1 recombinant plasmid), and lane 12 = negative control (distilled water).

Agarose gel electrophoresis of PCR-amplified products from the representative four carbapenem-resistant genes and mcr-1. Lane M = 100 bp DNA ladder, lane 1 = K. pneumoniae strain no.1385 (blaNDM), lane 2 = K. pneumoniae strain no. 1386 (blaOXA-48-like), lane 3 = E. coli strain no.A434-59 (blaNDM and mcr-1), lane 4 = E. coli strain no.98 (blaNDM and blaOXA-48-like), lane 5 = E. coli strain no.1387 (blaOXA-48-like), lane 6 = K. pneumoniae strain no.1263 (blaNDM), lane 7 = K. pneumoniae strain 22 (blaIMP-14a), lane 8 = K. pneumoniae ATCC® BAA-2524™ (blaOXA48), lane 9 = E. coli ATCC® BAA-2452™ (blaNDM-1), lane 10 = K. pneumoniae ATCC® BAA-1705™ (blaKPC), lane 11 = E. coli AK1 (a strain carrying mcr-1 recombinant plasmid), and lane 12 = negative control (distilled water).

Validation

We have validated our protocol with reference strains including Klebsiella pneumoniae ATCC® BAA-1705™ (blaKPC), Escherichia coli ATCC® BAA-2340™ (blaKPC), E. coli ATCC® BAA-2452™ (blaNDM-1), E. coli ATCC® BAA-2469™ (blaNDM-1), K. pneumoniae ATCC® BAA-2524™ (blaOXA-48), Serratia marcescens KU3838 (blaIMP-6), K. pneumoniae strain 22 and strain 34 (blaIMP-14a) [3], and E. coli A434-59 (mcr-1 and blaNDM-1) [2]. The multiplex PCR revealed PCR product sizes of 232 bp for blaIMP-6 and blaIMP-14a in S. marcescens KU3838 and K. pneumoniae strain 22 and 34, 438 bp for blaOXA-48 in K. pneumoniae ATCC® BAA-2524™, 621 bp for blaNDM in E. coli ATCC® BAA-2452™, E. coli ATCC® BAA-2469™and E. coli A434-59, 798 bp for blaKPC in K. pneumoniae ATCC® BAA-1705™ and E. coli ATCC® BAA-2340™, and 1126 bp for mcr-1 in E. coli A434-59, respectively. In total, testing with our multiplex PCR was undertaken on 127 carbapenem-resistant Enterobacteriaceae with known carbapenemase genes using either Sanger sequencing or next-generation sequencing. These 127 isolates consisted of 50 blaNDM-1 harboring isolates, 19 blaNDM-5 harboring isolates, 1 blaNDM-7 harboring isolates, 32 blaOXA-181 harboring isolates, 10 blaOXA-232 harboring isolates, 5 isolates carrying blaNDM-1 and blaOXA-181, 4 isolates carrying blaNDM-1 and blaOXA-232, and 6 blaIMP14 harboring isolates, respectively. As expected, this multiplex PCR assay could detect these carbapenemase genes in agreement with either Sanger sequencing or next-generation sequencing results e.g., isolates containing blaOXA-181 and blaOXA-232 revealed 438 bp of blaOXA-48-like PCR product, while isolates carrying blaNDM-1, blaNDM-5 and blaNDM-7 showed about 621 bp of blaNDM PCR product. Where isolates contained either blaNDM-1 and blaOXA-181 or blaNDM-1 and blaOXA-232, our PCR revealed 2 bands at 438 bp and 621 bp for blaOXA-48-like and blaNDM, respectively (Fig. 1). We also tested the multiplex PCR with 8 known mcr-1 isolates using Sanger sequencing (6 E. coli and 2 K. pneumoniae). The PCR assay could accurately detect the 1126 bp of mcr-1 in 8 isolates. In addition, E. coli A434-59 a strain co-carry of mcr-1 and blaNDM-1 [2] revealed 2 bands of 1126 bp (mcr-1) and 621 bp (blaNDM-1) by this PCR (Fig. 1). Sixty-two carbapenem-susceptible Enterobacteriaceae were tested using the multiplex PCR and the results revealed no PCR product bands. This method has advance in case of easy to use and save cost and time to simultaneously detect 4 frequently occurring carbapenemase genes and mcr-1 in a single reaction.
Subject areaImmunology and Microbiology
More specific subject areaClinical Bacteriology
Protocol namemPCR for mcr-1 and carbapenem-resistant genes
Reagents/tools1. JumpStartTM REDTaq® ReadyMixTM PCR Reaction Mix (Sigma-Aldrich, USA)2. PrimersIMP-F = 5’-GGAATAGAGTGGCTTAAYTCTC-3’IMP-R = 5’-GGTTTAAYAAAACAACCACC-3’OXA48-like-F = 5’-GCGTGGTTAAGGATGAACAC-3’OXA48-like-R = 5’-CATCAAGTTCAACCCAACCG-3’NDM-F = 5’-GGTTTGGCGATCTGGTTTTC-3’NDM-R = 5’-CGGAATGGCTCATCACGATC-3’KPC-F = 5’-CGTCTAGTTCTGCTGTCTTG-3’KPC-R = 5’-CTTGTCATCCTTGTTAGGCG-3’MCR1-F = 5’- GGGTGTGCTACCAAGTTTGC -3’MCR1-R = 5’- CATTGGCGTGATGCCAGTTT -3’
Experimental designWe modified a multiplex PCR for detection of acquired carbapenemase genes described by Poirel et al. [1] and added the primer to detect mcr-1 in the same PCR reaction. This method can simultaneously detect 4 prevalent carbapenem-resistant genes (blaIMP, blaOXA-48-like, blaNDM, and blaKPC) and a colistin-resistant gene (mcr-1) in a single reaction and revealed different PCR product sizes that are easy to interpret.
Trial registrationNone
EthicsNone
  3 in total

1.  Multiplex PCR for detection of acquired carbapenemase genes.

Authors:  Laurent Poirel; Timothy R Walsh; Vincent Cuvillier; Patrice Nordmann
Journal:  Diagn Microbiol Infect Dis       Date:  2011-03-12       Impact factor: 2.803

2.  Emergence of plasmid-mediated colistin resistance and New Delhi metallo-β-lactamase genes in extensively drug-resistant Escherichia coli isolated from a patient in Thailand.

Authors:  Wantana Paveenkittiporn; Anusak Kerdsin; Sukanya Chokngam; Charatdao Bunthi; Somchai Sangkitporn; Christopher J Gregory
Journal:  Diagn Microbiol Infect Dis       Date:  2016-11-14       Impact factor: 2.803

3.  Emergence of NDM-1- and IMP-14a-producing Enterobacteriaceae in Thailand.

Authors:  Benchamas Rimrang; Aroonwadee Chanawong; Aroonlug Lulitanond; Chotechana Wilailuckana; Nicha Charoensri; Pipat Sribenjalux; Waewta Phumsrikaew; Lumyai Wonglakorn; Anusak Kerdsin; Ploenchan Chetchotisakd
Journal:  J Antimicrob Chemother       Date:  2012-07-13       Impact factor: 5.790

  3 in total
  8 in total

1.  Genomic characterization of an emerging blaKPC-2 carrying Enterobacteriaceae clinical isolates in Thailand.

Authors:  Anusak Kerdsin; Saowarat Deekae; Sunee Chayangsu; Rujirat Hatrongjit; Peechanika Chopjitt; Dan Takeuchi; Yukihiro Akeda; Kazunori Tomono; Shigeyuki Hamada
Journal:  Sci Rep       Date:  2019-12-06       Impact factor: 4.379

2.  Emergent Polymyxin Resistance: End of an Era?

Authors:  Zekun Li; Yuping Cao; Lingxian Yi; Jian-Hua Liu; Qiwen Yang
Journal:  Open Forum Infect Dis       Date:  2019-10-01       Impact factor: 3.835

3.  Whole-Genome Sequencing of Clinically Isolated Carbapenem-Resistant Enterobacterales Harboring mcr Genes in Thailand, 2016-2019.

Authors:  Wantana Paveenkittiporn; Watcharaporn Kamjumphol; Ratchadaporn Ungcharoen; Anusak Kerdsin
Journal:  Front Microbiol       Date:  2021-01-11       Impact factor: 5.640

4.  Genomic Characterization of Clinical Extensively Drug-Resistant Acinetobacter pittii Isolates.

Authors:  Peechanika Chopjitt; Nuntiput Putthanachote; Ratchadaporn Ungcharoen; Rujirat Hatrongjit; Parichart Boueroy; Yukihiro Akeda; Kazunori Tomono; Shigeyuki Hamada; Anusak Kerdsin
Journal:  Microorganisms       Date:  2021-01-25

5.  Genomic Insights into a Colistin-Resistant Uropathogenic Escherichia coli Strain of O23:H4-ST641 Lineage Harboring mcr-1.1 on a Conjugative IncHI2 Plasmid from Egypt.

Authors:  Azza S Zakaria; Eva A Edward; Nelly M Mohamed
Journal:  Microorganisms       Date:  2021-04-10

6.  Quantitative Risk Assessment of Susceptible and Ciprofloxacin-Resistant Salmonella from Retail Pork in Chiang Mai Province in Northern Thailand.

Authors:  Chaiwat Pulsrikarn; Anusak Kedsin; Parichart Boueroy; Peechanika Chopjitt; Rujirat Hatrongjit; Piyarat Chansiripornchai; Nipattra Suanpairintr; Suphachai Nuanualsuwan
Journal:  Foods       Date:  2022-09-20

7.  Klebsiella pneumoniae Complex Harboring mcr-1, mcr-7, and mcr-8 Isolates from Slaughtered Pigs in Thailand.

Authors:  Nattamol Phetburom; Parichart Boueroy; Peechanika Chopjitt; Rujirat Hatrongjit; Yukihiro Akeda; Shigeyuki Hamada; Suphachai Nuanualsuwan; Anusak Kerdsin
Journal:  Microorganisms       Date:  2021-11-25

8.  Resistance Patterns, mcr-4 and OXA-48 Genes, and Virulence Factors of Escherichia coli from Apennine Chamois Living in Sympatry with Domestic Species, Italy.

Authors:  Camilla Smoglica; Alberto Vergara; Simone Angelucci; Anna Rita Festino; Antonio Antonucci; Lorenzo Moschetti; Muhammad Farooq; Fulvio Marsilio; Cristina Esmeralda Di Francesco
Journal:  Animals (Basel)       Date:  2022-01-06       Impact factor: 2.752

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.