Literature DB >> 30015830

Identification of a novel idiopathic congenital nystagmus‑causing missense mutation, p.G296C, in the FRMD7 gene.

Yanghui Xiu1, Yihua Yao1, Tanchu Yang2, Meihua Pan3, Hui Yang4, Weifang Fang1, Feng Gu5, Junzhao Zhao6, Yihua Zhu1.   

Abstract

Exploring the genetic basis for idiopathic congenital nystagmus is critical for improving our understanding of its molecular pathogenesis. In the present study, direct sequencing using gene specific primers was performed in order to identify the causative mutations in two brothers from a Chinese family who had been diagnosed with idiopathic congenital nystagmus. A comprehensive ophthalmological examination, including eye movement recordings, fundus examination, and retinal optical coherence tomography imaging was also conducted, to characterize the disease phenotype. The results revealed that the two brothers exhibited clear signs of nystagmus without any other ocular anomalies. Direct sequencing revealed a G to T transition (c.886G>T) in exon 9 of the four‑point‑one, ezrin, radixin, moesin domain‑containing 7 (FRMD7) gene, which resulted in a conservative substitution of glycine to cysteine at codon 296 (p.G296C), leading to idiopathic congenital nystagmus in the two affected brothers. c.886G>T is a novel idiopathic congenital nystagmus‑inducing mutation in the FRMD7 gene. This finding expands the spectrum of known gene mutations in idiopathic congenital nystagmus, and may be useful for faster gene diagnosis, prenatal testing, the development of potential gene therapies, and for improving the understanding of the molecular pathogenesis of idiopathic congenital nystagmus.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30015830      PMCID: PMC6102629          DOI: 10.3892/mmr.2018.9260

Source DB:  PubMed          Journal:  Mol Med Rep        ISSN: 1791-2997            Impact factor:   2.952


Introduction

Idiopathic congenital nystagmus is one of the most common oculomotor disorders, characterized by involuntary, periodic, and predominantly horizontal oscillations of both eyes (1). The symptoms usually appear at birth or during the first few months of life. To date, the pathogenesis of idiopathic congenital nystagmus remains unclear. Abnormal brain control of the ocular motor system possibly contributes to this disease. At present, there is no effective treatment for idiopathic congenital nystagmus, and only very limited surgical, optical and pharmaceutical therapies are available improve the symptoms (2,3). Idiopathic congenital nystagmus exhibits extreme genetic and clinical heterogeneity. There are three different inheritance patterns that have been reported, including X-linked idiopathic congenital nystagmus [Online Mendelian Inheritance in Man (OMIM) nos: 300628, 300589], autosomal recessive (OMIM no: 257400) and autosomal dominant (OMIM nos: 164100, 608345 and 193003) (4,5). Although the inheritance mode is heterogeneous, X-linked idiopathic congenital nystagmus is the most commonly reported. Three disease loci for X-linked idiopathic congenital nystagmus have been mapped to Xp11.4-p11.3 [Nystagmus (NYS)5, OMIM no. 300589] (6), Xp22.3 (NYS6, OMIM no. 300814) (7) and Xq26-q27 (NYS1, OMIM no. 310700) (8). The four-point-one, ezrin, radixin, moesin (FERM) domain-containing 7 gene (FRMD7; OMIM no. 300628), containing 12 exons and encoding a member of the protein 4.1 superfamily, is credited for the disease loci at Xq26-q27, which is the main cause of X-linked idiopathic congenital nystagmus in Asian populations (1,9). As demonstrated in Table I, >73 mutations responsible for idiopathic congenital nystagmus have been identified to date. In the present study, two brothers from a Chinese family who had been diagnosed with idiopathic congenital nystagmus were evaluated. To identify the causative gene mutations, the affected patients were first genotyped with microsatellite markers flanking the FRMD7 locus. Direct sequencing using gene specific primers then identified the mutations. The aim of this study was to identify a causative mutation responsible for idiopathic congenital nystagmus in a Chinese family, which may be important for the future genetic diagnosis and treatment of idiopathic congenital nystagmus.
Table I.

Genetic mutations in the FRMD7 gene responsible for X-idiopathic congenital nystagmus, identified since 2008.

Author, yearOriginMutation typeNucleotide changeProtein change(Refs.)
Bai et al, 2017ChinaMissensec.284G>Tp.R95M(10)
Jia et al, 2017ChinaMissensec.473T>Ap.I158N(11)
Bai et al, 2017ChinaMissensec.521A>Tp.D174V(10)
Gupta et al, 2015IndiaMissensec.556A>Gp.M186V(12)
Jia et al, 2017ChinaMissensec.580G>Tp.A194S(11)
Bai et al, 2017ChinaMissensec.586G>Ap.D196N(10)
Jia et al, 2017ChinaMissensec.605T>Ap.I202N(11)
Li et al, 2011ChinaMissensec. 623A>Gp. H208R(13)
Liu et al, 2013ChinaMissensec.635T>C(14)
Bai et al, 2017ChinaMissensec.T766Ap.F2561(10)
Al-Moallem et al, 2015BelgiumMissensec.801C>A(15)
Thomas et al, 2008ChinaMissensec.811T>Cp.C271R(16)
Jia et al, 2017ChinaMissensec.811T>Ap.C271S(11)
Al-Moallem et al and Kohmoto et al, 2015Belgium, JapanMissensec.875T>Cp.L292P(15,17)
Radhakrishna et al, 2012IndiaMissensec.A917GQ305R(18)
Bai et al, 2017ChinaMissensec.A973Gp.R325G(10)
Choi et al, 2015KoreanMissensec.A>Gp.M1>V(19)
Zhao et al, 2016ChinaNonsensec.1090C>Tp.Q364X(20)
AlMoallem et al, 2015BelgiumFrameshiftc.2036del(15)
He et al, 2008ChinaFrameshiftc.1274-1275delTG(21)
Bai et al, 2017ChinaFrameshiftc.999delTp.H333fs(10)
Jia et al, 2017ChinaSlice mutationc.57+1G>A(11)
Hu et al, 2012ChinaSplicing mutationc.163-1G>T(22)
AlMoallem et al, 2015BelgiumSplice site mutationc.497þ5G>A(15)
Hu et al, 2011ChinaSplicing mutationc.658+1g>t(23)
Al-Moallem et al, 2015BelgiumCopy number variation1.4 Mb deletion(15)
Jia et al, 2017ChinaDeletionc.41_43delAG(11)
Al-Moallem et al, 2015BelgiumDeletionc.660del(15)
Jia et al, 2017ChinaDeletionc.689-690delAGp.Ser232del(11)
Du et al, 2011ChinaDeletionc.1486-1489delTTTTp.F497fs26X(24)
Bai et al, 2017ChinaShear mutationc.162+2T>C(10)
Bai et al, 2017ChinaShear mutationc.206-1G>A(10)
Jia et al, 2017ChinaInsertc.1492-1493insAp.Y498X(11)
Schorderet et al, 2007SwitzerlandVariantc.383-11G>A(25)
Schorderet et al, 2007SwitzerlandVariantc.206-20T>C(25)

A total of 38 mutations identified before 2007 summarized in a previous review (21), were not included in this table. FRMD, four-point-one, ezrin, radixin, moesin domain-containing.

Materials and methods

Clinical evaluation and DNA sampling

The present study was approved by the ethics committee of Xiamen Eye Center Affiliated Xiamen University (Xiamen, China) and adhered to the guidelines of the Declaration of Helsinki. The study participants included the two affected brothers and their parents, as well as 100 unaffected control subjects (45 male, 55 female; age range 18–56, recruited from 1st January-29th February 2016); written informed consent was received from all participants prior to enrolment. All subjects underwent comprehensive ophthalmologic evaluation, including eye movement recording using the Metrovision MonPack 3 vision monitoring system (Metrovision, Lille, France), fundus examination, and retinal optical coherence tomography (OCT) imaging. Peripheral venous blood samples (2 ml) were obtained from the affected brothers, their unaffected parents, and the 100 controls.

Mutational analysis and multiple-sequence alignment

The coding exons and splice junctions of the FRMD7 gene were amplified via polymerase chain reaction (PCR) using PCR primers (Table III) that have been previously published (14). PCR products were purified and directly sequenced using an ABI A3730 Automated Sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The suspected mutation identified in the two affected brothers was further confirmed as a mutation by sequencing of other family members and control males from the same ethnic background. Mutation descriptions followed the nomenclature recommended by the Human Genomic Variation Society (www.hgvs.org/). The amino acid sequences of the FRMD7 protein from various species were obtained from the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov/). The amino acid sequences of the FRMD7 gene from different species were aligned by the CLC Sequence Viewer 6 (CLC bio A/S; www.clcbio.com). The potential impact of amino acid substitution on the function of the FRMD7 protein was predicted using online tools, including the PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/) and SIFT (http://sift.jcvi.org/) programs.
Table III.

Primers and PCR conditions for FRMD7.

ExonSequence (5′>3′)Annealing tempLength
FRMD7 E1CCCTTGGGTGTGCATTACTT58°C308 bp
TTGCTCTCTAATGGGCTGTTC
FRMD7 E2CAGAGAGTCTTGTGGCTTCTAC58°C380 bp
TGGCCAAGGTGACTGTTAAT
FRMD7 E3CCACCTATTTGACATTGCTGTTT58°C399 bp
CCAGCAGCATGATTTCTTTCATC
FRMD7 E4AGTCTGTAGGAGGGAGTGATG58°C418 bp
TCCTGTAGTCTCCACCCTTT
FRMD7 E5GCCTGCCAAAGTGTTCAATC58°C455 bp
GCCATGCTGTTTCTCTCTATCT
FRMD7 E6+7TTTGATGGAGGACAAGGGTATG58°C660 bp
CCCTTTCTGGCTGGTGATAAT
FRMD7 E8CATCCTTGTATCCCACCTGAAATG58°C590 bp
CTGGTCACTCCCATTTGACTTA
FRMD7 E9GTTTCTGGCAGAGAAGAGTGAGT58°C638 bp
CATCTTCCTCCCTCCTAGTTAG
FRMD7 E10+11CTCTGCCTGGTCCTTGAATAAG58°C562 bp
CCAGGAAGCTAACCTACTCAAA
FRMD7 E12aCTGGAAGTAGGATGGCATTGAG58°C845 bp
TTGGAGTACTTGCAGGTCTTG
FRMD7 E12bCAGGTCAGCAGGTTGGTATTAT58°C916 bp
GAGGAGAGGGCATGTTCTAAAG

Protein structural modeling

The secondary structure of the human wild type was predicted by the Phyre2 program (www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index, 2.0) and 3D structures of the human wild type and mutant FRMD7 proteins were predicted using Iterative Threading ASSEmbly Refinement (I-TASSER; zhanglab.ccmb.med.umich.edu/I-TASSER), and the results saved in a Protein Data Bank (PDB) file format. The PDB files obtained for the two proteins were then analyzed using PyMOL1.7.0.0 (pymol.org/2/) to visualize the structural variations.

Results

Phenotypic characterization of the affected brothers

There were two affected individuals in this two-generation family. The probands (II:1 and II:2) presented with nystagmus as the first symptom. The clinical findings are summarized in Table II. Mental retardation, night blindness and photophobia were not observed in either of the two affected individuals. No head nodding was observed in the two affected patients, although one exhibited a clear head tilt. As demonstrated in Fig. 1, a representative ophthalmological examination results of both probands suggested that there was no indication of other ocular anomalies. OCT imaging demonstrated that the retinal nerve fiber layer thickness was within the normal range. Eye movement recordings revealed that nystagmus of the proband 1 was predominantly a horizontal waveform (Fig. 2). The ocular oscillation could be slightly slowed at a right gaze of 5°. Patients in this family were confirmed to have X-linked congenital nystagmus based on the comprehensive ophthalmologic examination and family history.
Table II.

Clinical features of individuals with idiopathic congenital nystagmus in the present study.

PhenotypeI:1II:2
SexMaleMale
Age (years)76
Age at diagnosis (years)43
Visual activityOD20/100OD20/50
at presentationOS20/80OS20/50
NystagmusHorizontalHorizontal
Abnormal head movementNegativeClear head tilt
Neurological findingsNormalNormal

OD, oculus dextrus (right); OS, oculus sinister (left).

Figure 1.

Ophthalmological examination suggested no other ocular anomalies in the two patients from the Chinese family. Representative (A) fundus and (B) optical coherence tomography images from proband 1.

Figure 2.

Eye movement recordings from proband 1. Typical nystagmus waveforms recorded by Metrovision MonPack 3 vision monitor system, which revealed that nystagmus of the probands were predominantly a horizontal waveform. OS (Green), oculus sinister/left eye; OD (red), oculus dextrus/right eye; HOR, horizontal; VER, vertical.

Mutation analysis and protein structure modeling

A pedigree analysis of the patients is presented in Fig. 3A. Sequencing the FRMD7 gene revealed a G to T transition (c.886G>T) in exon 9 (Fig. 3B), which caused a conservative substitution of a glycine to a cysteine at codon 296 (p.G296C). This mutation was identified in both affected individuals and was present in the mother, but was absent in the father and in all control subjects. The FRMD7 p.G296C mutation is not present in any single nucleotide polymorphism database. In addition, this mutation was predicted with high confidence to be ‘probably damaging’ and ‘damaging’ by Polyphen-2 (score, 0) and SIFT (score, 2.54), respectively. Furthermore, multiple sequence alignment of the FRMD7 gene from different species was performed. The results demonstrated that codon 296, where the mutation (p.G296C) occurred, was located within a phylogenetically conserved region (Fig. 3C). Considering the above, it is reasonable to conclude that the p.G296C substitution is a causative mutation with the disease.
Figure 3.

Determination of the p.G296C mutation in the FRMD7 gene causing idiopathic congenital nystagmus. (A) Pedigree analysis. (B) DNA sequence chromatograms of the two affected probands, one unaffected family member and one carrier family member. A single base G to T transition in exon 9 of the FRMD7 gene that causes a conservative substitution of glycine to a cysteine at codon 296 (p.G296C) was detected. (C) Multiple-sequence alignment of the FRMD7 gene from different species revealed that codon 296, where the mutation (p.G296C) occurred, was located within a highly conserved region. The red box indicates the location of the mutation. FRMD, four-point-one, ezrin, radixin, moesin domain-containing.

Using the Phyre2 program (www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index, 2.0), the secondary structure of the wild type FRMD7 protein was predicted, the three-dimensional structure of the wild type FRMD7 protein (1–336) was modeled, and p.G296C was mapped within the structure (Fig. 4). The results demonstrated that, with the p.G296C mutation, the amino acid residues at 296 were largely surrounded by hydrophilic polar amino acid residues. Substitution of glycine to cysteine at codon 296 increased the regional polarity of the amino acids. Furthermore, the thiol group of cysteine is a reducing group, able to change the local electron density. Changes in hydrophobicity and electron density may cause structural instability of the FRMD7 protein leading to protein dysfunction, thus causing idiopathic congenital nystagmus, but this requires further investigation.
Figure 4.

Structural model of the FRMD7 protein. (A) Structural modeling and structure alignment indicated that the wild type (green) and p.G296C (cyan) proteins share a similar structure overall, with the exception of the loop region. (B) Structural analysis of the amino acid sequences where the mutation p.G296C is localized. FRMD, four-point-one, ezrin, radixin, moesin domain-containing.

Discussion

Idiopathic congenital nystagmus is an inherited ocular disorder that develops at birth or shortly after and persists throughout the patient's life (26). Nystagmus has an estimated prevalence of 6.72 per 100,000 for individuals younger than 19 years (27). Idiopathic congenital nystagmus is associated with significant negative psychosocial and functional consequences, including negative social stigma and poor visual function scores (28,29). There is a great interest in the treatment and early diagnosis of idiopathic congenital nystagmus. However, there is currently no effective treatment for idiopathic congenital nystagmus, and only limited surgical, optical and pharmaceutical therapies have been tested for the improvement of nystagmus waveforms and visual acuity (2,3). The early diagnosis of congenital nystagmus is critical for facilitating habilitation, providing genetic counseling, and potential gene therapies in the future (30). The diagnosis of idiopathic congenital nystagmus remains being a challenge and potential patients are usually required to undergo numerous examinations (31). Nystagmus is currently clinically described in terms of its peak-to peak amplitude, frequency, mean velocity and waveform (32). In the present study, idiopathic congenital nystagmus in two brothers from a Chinese family was first diagnosed using eye movement recordings and a comprehensive ophthalmologic examination. Recently, a next-generation sequencing panel has been used for the early diagnosis of idiopathic congenital nystagmus (31). Comprehensive understanding of the mutation spectrum is the foundation for efficient early genetic diagnosis. To identify the causative mutations in the two affected brothers, direct sequencing of genomic DNA samples from the affected brothers was conducted. The results revealed a G to T transition (c.886G>T) in exon 9 of the FRMD7 gene, which resulted in a conservative substitution of a glycine to a cysteine at codon 296 (p.G296C), leading to idiopathic congenital nystagmus. So far, >40 mutations causing idiopathic congenital nystagmus have been identified in the FRMD7 gene, predominantly concentrated in two key regions: The FERM and FERM adjacent domains (9). Identification of the mutations is not only critical for early diagnosis, but also for understanding the pathogenesis of idiopathic congenital nystagmus. The genetic etiology of idiopathic congenital nystagmus is not yet fully understood, especially regarding sporadic cases. Identifying previously unknown genetic mutations involved in idiopathic congenital nystagmus will allow the development of cell and animal-based models to help classify idiopathic congenital nystagmus and guide future therapies. The present findings provide further insight into the genetic spectrum for idiopathic congenital nystagmus, which is useful for the earlier genetic diagnosis, genetic counseling, and potential future gene therapy of patients with idiopathic congenital nystagmus. In summary, a novel mutation in the FRMD7 gene causing idiopathic congenital nystagmus was identified using direct sequencing. G to T transition (c.886G>T) in exon 9 that resulted in the conservative substitution of a glycine to a cysteine at codon 296 (p.G296C) was identified in two affected brothers from a Chinese family. The present study expanded the already known gene mutation spectrum for idiopathic congenital nystagmus, providing more evidence for the genetic heterogeneity associated with idiopathic congenital nystagmus. This novel finding is important for faster diagnosis, prenatal testing, and improving the understanding of the molecular pathogenesis of idiopathic congenital nystagmus.
  32 in total

1.  A gene for X-linked idiopathic congenital nystagmus (NYS1) maps to chromosome Xp11.4-p11.3.

Authors:  A Cabot; J M Rozet; S Gerber; I Perrault; D Ducroq; A Smahi; E Souied; A Munnich; J Kaplan
Journal:  Am J Hum Genet       Date:  1999-04       Impact factor: 11.025

2.  Incidence and Types of Pediatric Nystagmus.

Authors:  David L Nash; Nancy N Diehl; Brian G Mohney
Journal:  Am J Ophthalmol       Date:  2017-07-20       Impact factor: 5.258

3.  Novel FRMD7 Mutations and Genomic Rearrangement Expand the Molecular Pathogenesis of X-Linked Idiopathic Infantile Nystagmus.

Authors:  Basamat AlMoallem; Miriam Bauwens; Sophie Walraedt; Patricia Delbeke; Julie De Zaeytijd; Philippe Kestelyn; Françoise Meire; Sandra Janssens; Caroline van Cauwenbergh; Hannah Verdin; Sally Hooghe; Prasoon Kumar Thakur; Frauke Coppieters; Kim De Leeneer; Koenraad Devriendt; Bart P Leroy; Elfride De Baere
Journal:  Invest Ophthalmol Vis Sci       Date:  2015-02-12       Impact factor: 4.799

4.  A novel frameshift mutation in FRMD7 causing X-linked idiopathic congenital nystagmus.

Authors:  Xiang He; Feng Gu; Ze Wang; Chong Wang; Yi Tong; Yujing Wang; Juhua Yang; Wei Liu; Meng Zhang; Xu Ma
Journal:  Genet Test       Date:  2008-12

5.  The prevalence of nystagmus: the Leicestershire nystagmus survey.

Authors:  Nagini Sarvananthan; Mylvaganam Surendran; Eryl O Roberts; Sunila Jain; Shery Thomas; Nitant Shah; Frank A Proudlock; John R Thompson; Rebecca J McLean; Christopher Degg; Geoffrey Woodruff; Irene Gottlob
Journal:  Invest Ophthalmol Vis Sci       Date:  2009-05-20       Impact factor: 4.799

6.  Mutations in FRMD7, a newly identified member of the FERM family, cause X-linked idiopathic congenital nystagmus.

Authors:  Patrick Tarpey; Shery Thomas; Nagini Sarvananthan; Uma Mallya; Steven Lisgo; Chris J Talbot; Eryl O Roberts; Musarat Awan; Mylvaganam Surendran; Rebecca J McLean; Robert D Reinecke; Andrea Langmann; Susanne Lindner; Martina Koch; Sunila Jain; Geoffrey Woodruff; Richard P Gale; Andrew Bastawrous; Chris Degg; Konstantinos Droutsas; Ioannis Asproudis; Alina A Zubcov; Christina Pieh; Colin D Veal; Rajiv D Machado; Oliver C Backhouse; Laura Baumber; Cris S Constantinescu; Michael C Brodsky; David G Hunter; Richard W Hertle; Randy J Read; Sarah Edkins; Sarah O'Meara; Adrian Parker; Claire Stevens; Jon Teague; Richard Wooster; P Andrew Futreal; Richard C Trembath; Michael R Stratton; F Lucy Raymond; Irene Gottlob
Journal:  Nat Genet       Date:  2006-10-01       Impact factor: 38.330

7.  The Role of FRMD7 in Idiopathic Infantile Nystagmus.

Authors:  Rachel J Watkins; Mervyn G Thomas; Chris J Talbot; Irene Gottlob; Sue Shackleton
Journal:  J Ophthalmol       Date:  2011-08-29       Impact factor: 1.909

8.  A novel splicing mutation of the FRMD7 gene in a Chinese family with X-linked congenital nystagmus.

Authors:  Ying Hu; Jing Shen; Shuihua Zhang; Tao Yang; Shangzhi Huang; Huiping Yuan
Journal:  Mol Vis       Date:  2012-01-13       Impact factor: 2.367

9.  Identifcation of a novel mutation p.I240T in the FRMD7 gene in a family with congenital nystagmus.

Authors:  Yihua Zhu; Jianfu Zhuang; Xianglian Ge; Xiao Zhang; Zheng Wang; Ji Sun; Juhua Yang; Feng Gu
Journal:  Sci Rep       Date:  2013-10-30       Impact factor: 4.379

10.  Molecular genetic analysis of patients with sporadic and X-linked infantile nystagmus.

Authors:  Hui Zhao; Xiu-Feng Huang; Zhi-Li Zheng; Wen-Li Deng; Xin-Lan Lei; Dong-Jun Xing; Liang Ye; Su-Zhong Xu; Jie Chen; Fang Zhang; Xin-Ping Yu; Zi-Bing Jin
Journal:  BMJ Open       Date:  2016-04-01       Impact factor: 2.692

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.