Curcumin Inhibits Lipopolysaccharide-Induced Mucin 5AC Hypersecretion and Airway Inflammation via Nuclear Factor Erythroid 2-Related Factor 2.

BACKGROUND: Excess mucus production is an important pathophysiological feature of chronic inflammatory airway diseases. Effective therapies are currently lacking. The aim of the study was to evaluate the effects of curcumin (CUR) on lipopolysaccharide (LPS)-induced mucus secretion and inflammation, and explored the underlying mechanism in vivo and in vitro.
METHODS: For the in vitro study, human bronchial epithelial (NCI-H292) cells were pretreated with CUR or vehicle for 30 min, and then exposed to LPS for 24 h. Next, nuclear factor erythroid 2-related factor 2 (Nrf2) was knocked down with Nrf2 small interfering RNA (siRNA) to confirm the specific role of Nrf2 in mucin regulation of CUR in NCI-H292 cells. In vivo, C57BL/6 mice were randomly assigned to three groups (n = 7 for each group): control group, LPS group, and LPS + CUR group. Mice in LPS and LPS + CUR group were injected with saline or CUR (50 mg/kg) intraperitoneally 2 h before intratracheal instillation with LPS (100 μg/ml) for 7 days. Cell lysate and lung tissue were obtained to measured Mucin 5AC (MUC5AC) and Nrf2 mRNA and protein expression by a real-time polymerase chain reaction and Western blotting. Bronchoalveolar lavage fluid (BALF) was collected to enumerate total cells and neutrophils. Histopathological changes of the lung were observed. Data were analyzed by one-way analysis of variance. Student's t-test was used when two groups were compared.
RESULTS: CUR significantly decreased the expression of MUC5AC mRNA and protein in NCI-H292 cells exposed to LPS. This effect was dose dependent (2.424 ± 0.318 vs. 7.169 ± 1.785, t = 4.534, and 1.060 ± 0.197 vs. 2.340 ± 0.209, t = 7.716; both P < 0.05, respectively) and accompanied by increased mRNA and protein expression of Nrf2 (1.952 ± 0.340 vs. 1.142 ± 0.176, t = -3.661, and 2.010 ± 0.209 vs. 1.089 ± 0.132, t = -6.453; both P < 0.05, respectively). Furthermore, knockdown of Nrf2 with siRNA increased MUC5AC mRNA expression by 47.7%, compared with levels observed in the siRNA-negative group (6.845 ± 1.478 vs. 3.391 ± 0.517, t = -3.821, P < 0.05). Knockdown of Nrf2 with siRNA also markedly increased MUC5AC protein expression in NCI-H292 cells. CUR also significantly decreased LPS-induced mRNA and protein expression of MUC5AC in mouse lung (1.672 ± 0.721 vs. 5.961 ± 2.452, t = 2.906, and 0.480 ± 0.191 vs. 2.290 ± 0.834, t = 3.665, respectively; both P < 0.05). Alcian blue/periodic acid-Schiff staining also showed that CUR suppressed mucin production. Compared with the LPS group, the numbers of inflammatory cells (247 ± 30 vs. 334 ± 24, t = 3.901, P < 0.05) and neutrophils (185 ± 22 vs. 246 ± 20, t = 3.566, P < 0.05) in BALF decreased in the LPS + CUR group, as well as reduced inflammatory cell infiltration in lung tissue.
CONCLUSION: CUR inhibits LPS-induced airway mucus hypersecretion and inflammation through activation of Nrf2 possibly.

INTRODUCTION

Airway mucus plays an important role in defense against invading airborne particles, foreign irritants, chemicals, and pathogenic microorganisms. Excessive mucus production is a major pathological event contributing to airway obstruction, atelectasis, impairment of gas exchange, and antibiotic permeability.[12] Mucins are a family of high-molecular-weight, heavily glycosylated proteins that are the most important constituent of mucus. At least 21 human mucin genes have been distinguished by cDNA cloning. Mucin 5AC (MUC5AC) is a gel-forming mucin predominantly expressed in airway epithelial cells; its expression is up-regulated in chronic inflammatory airway diseases such as chronic obstructive pulmonary disease, asthma, and cystic fibrosis.[345] Several natural products are reported to affect airway mucin production.[67] We, therefore, sought to identify natural medicinal compounds to inhibit MUC5AC overexpression. Curcumin (CUR), a polyphenolic compound of turmeric (Curcuma longa) and a pharmacologically safe agent, has been shown to exert various biological effects through its antioxidant, anticancer, and anti-inflammatory properties.[89] CUR is also known to inhibit paraquat-induced lung inflammation and fibrosis in mice.[10] A recent study demonstrated that CUR may inhibit MUC5AC production induced by epidermal growth factor (EGF) or interleukin (IL)-1beta in human airway epithelial cells.[1112] However, whether CUR plays the same role in mucus overproduction in vivo and the underlying mechanism remain to be elucidated.

Pseudomonas aeruginosa is an important and opportunistic human respiratory pathogen associated with serious chronic inflammatory airway disease, especially hospital-acquired infections such as ventilator-associated pneumonia and sepsis. Lipopolysaccharide (LPS), a major component of P. aeruginosa, is one of the most potent inducers of mucus overproduction.[1314] We sought to identify the role of CUR in LPS-induced MUC5AC mucin production, as well as the underlying mechanism.

Recent studies have shown that excessive oxidative stress plays an important role in MUC5AC mucin expression. Reactive oxygen species (ROS) are involved in the MUC5AC production induced by LPS, cigarette smoke, phorbol 12-myristate 13-acetate, and neutrophil elastase.[141516] Nuclear factor erythroid 2-related factor-2 (Nrf2), a member of the cap ‘n’ collar basic leucine zipper transcription factor family, is a critical regulator of defense against oxidative damage. Nrf2 is thought to protect lung and other tissues against oxidative insults such as those caused by bacterial endotoxin, inflammatory factors, cigarette smoking, and hyperoxia.[171819]

Qi et al.[16] reported that Nrf2 is involved in neutrophil elastase-induced MUC5AC expression in human airway epithelial cells. Our laboratory has previously shown that Nrf2 ameliorates cigarette smoking-induced mucus overproduction in airway epithelium and mouse lung.[20] CUR is recognized to induce Nrf2 activation and to protect cells and tissues against oxidative insult, airway inflammation, and lung carcinogenesis.[212223]

Despite extensive study of CUR's role in the treatment of lung disorders, little is known about the effect of CUR on LPS-induced MUC5AC mucin expression or about the role of Nrf2 in this process. In the present study, we attempted to explore whether CUR regulates the production of MUC5AC induced by LPS in airway epithelial cells and mouse lung. To confirm the specific role of Nrf2 in mucin regulation of CUR, we investigated whether knockdown of Nrf2 with Nrf2 small interfering RNA (siRNA) could influence MUC5AC expression in NCI-H292 cells. We demonstrated that CUR protected against LPS-induced MUC5AC mucin production and that the process was mediated, in part, by Nrf2. Based on its antioxidant effects, we identified CUR as a potential agent for prevention of mucus hypersecretion in chronic inflammatory airway disease.

METHODS

Materials and reagents

RPMI-1640 and fetal bovine serum (FBS) were from Gibco (Grand Island, NY, USA). LPS, CUR (purity: 98%) and methylthiazolyltetrazolium (MTT) were purchased from SigmaAldrich (St. Louis, MO, USA). TRIzol reagent was Invitrogen (Carlsbad, CA, USA). Total RNA isolation and reverse transcription systems were obtained from Promega (Madison, WI, USA). Antibodies against human MUC5AC (45M1) was from Thermo Fisher Scientific (Rockford, IL, USA. Lot. PJ1926761). Antibodies against mouse MUC5AC, Nrf2, and β-actin were from Abcam (Cambridge, MA, USA. Lot. GR257950-1, GR37038-9, and GR212262-9). Antibodies against human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were from Abway (China. Lot. F011207).

Cell culture and measurement of cellular toxicity

A human pulmonary mucoepidermoid carcinoma cell line, NCI-H292, was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in RPMI 1640 medium supplemented with 10% (vol/vol) FBS at 37°C in a humidified, 5% CO2/95% air, water-jacketed incubator. Before experimentation, confluent NCI-H292 cells were washed twice with phosphate-buffered saline (PBS) and recultured in serum-free RPMI 1640 overnight to maintain low basal levels of MUC5AC expression. After serum deprivation, the cells were pretreated with varying concentrations of CUR for 30 min and treated with LPS (10 μg/ml) for 24 h in serum-free RPMI 1640. The LPS and CUR were dissolved in RPMI 1640 and dimethylsulfoxide, respectively. The final concentrations of dimethylsulfoxide were 0.5%, which did not affect mucin gene expression and production. The cytotoxicity was determined by the conventional 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay, following exactly as the supplier's protocol.

Transfection

The human Nrf2 siRNA or the scrambled RNA as a negative control (Invitrogen, USA) were transfected into NCI-H292 cells using Lipofectamine 2000 (Invitrogen, USA), according to the manufacturer's protocol. Briefly, cells were seeded in 6-well tissue culture plates at a density of 5 × 105 cells/ml, until they reached 50–70% confluency. Next, 100 nmol/L siRNA in 1 ml growth medium was incubated with NCI-H292 cells for 24 h. Then, infection medium was removed and replaced with fresh growth medium.

Measurement of intracellular reactive oxygen species

A ROS detection Kit (Enzo Life Sciences, Farmingdale, NY, USA) was used to measure the total ROS generated by LPS following the manufacturer's protocol. Briefly, 5 × 105 cells were seeded in each well of 6-well plates and grown to 70–80% confluency. After overnight serum starvation, the cells were co-treated with CUR and LPS for 24 h. The medium was then replaced with a ROS wash buffer containing ROS detection solution. The fluorescence intensity was measured using a flow cytometry.

Animals

The 8–10-week-old C57BL/6 mice were purchased from the Experimental Animal Center of Fujian Medical University (No. 2015000515917 and No. 2015000518707). All animal protocols and procedures were approved by the Animal Ethics Committee of the Second Affiliated Hospital of Fujian Medical University. Mice were pretreated with intraperitoneal injection of CUR (50 mg/kg) or vehicle. After 2 h of CUR administration, mice were treated with 100 μg LPS (in 50 μl saline) by intratracheal instillation and sacrificed after 6 days. Control mice received the same volume of saline.

Bronchoalveolar lavage fluid and airway inflammation analysis

Mouse tracheas were cannulated, and bronchoalveolar lavage fluid (BALF) was obtained by injecting 0.4 ml PBS into the right lungs (twice). After the total number of BALF cells was counted, remaining BALF was centrifuged at 400 ×g for 10 min at 4°C. Cell pellets were spun onto glass microscope slides and stained with Wright-Giemsa (Baso). Total cells and neutrophils counts were assessed through light microscopy.

Lung histology

After BALF collection, the left lungs were fixed in 10% formalin for 24 h and then embedded in paraffin. The lung tissues were stained with hematoxylin and eosin (H&E) or periodic acid-Schiff's (PAS) following standard protocols. The extent of inflammation was assessed according to published guidelines. To measure airway mucus production, PAS-stained goblet cells in airway epithelium were scored, as described previously.[22]

RNA isolation and quantitative real-time polymerase chain reaction

Total RNA from cells and lung homogenate was isolated with Trizol Reagent (Invitrogen) and reverse-transcribed with the Reverse Transcription Reagent Kit (TaKaRa Biotechnology, Japan), according to the manufacturer's instructions. The mRNA expression of MUC5AC and Nrf2 was measured by quantitative real-time polymerase chain reaction (PCR), using SYBR Green Master Mix (TaKaRa Biotechnology, Japan) on a StepOne real-time PCR system (Applied Biosystems, Foster City). PCR primers used in the study are listed in Table 1.

Table 1

Primers for quantitative real-time PCR analysis

Species	Genes	Primer sequence (5’- 3’)
Human	GAPDH	Forward: TGCCACTCCTCCACCTTTG
		Reverse: CGAACCACCCTGTTGCTGT
Human	MUC5AC	Forward: CAGCACAACCCCTGTTTCAAA
		Reverse: GCGCACAGAGGATGACAGT
Human	Nrf2	Forward: AAACCAGTGGATCTGCCAAC
		Reverse: ACGTAGCCGAAGAAACCTCA
Mouse	Beta-actin	Forward: GGCTGTATTCCCCTCCATCG
		Reverse: CCAGTTGGTAACAATGCCATGT
Mouse	MUC5AC	Forward: CTGTGACATTATCCCATAAGCCC
		Reverse: AAGGGGTATAGCTGGCCTGA
Mouse	Nrf2	Forward: GGACATGGAGCAAGTTTGGC
		Reverse: GCTGGGAACAGCGGTAGTATC

PCR: Polymerase chain reaction; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; MUC5AC: Mucin 5AC; Nrf2: Nuclear factor erythroid 2-related factor 2.

Western blotting

After LPS stimulation for 24 h, H292 cells were lysed in lysis buffer (Beyotime) and protease inhibitor cocktail (Roche Diagnostics, IN, USA), then subjected to 8–10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Millipore, USA). Membranes were blocked with 5% skim milk and incubated with various primary antibodies in antibody diluent overnight at 4°C. The membrane was washed with Tris-buffered saline (TBS) containing 0.1% Tween 20 (TBS-T) and then incubated with the corresponding secondary antibody for 1 h. Immunoreactive bands were visualized with enhanced chemiluminescence (ECL, Thermo Scientific, USA).

Statistical analysis

Statistical analyses were performed using SPSS 19.0 software (SPSS Inc., Chicago, IL, USA). All calculations were performed using GraphPad Prism version 5.0 statistical software (GraphPad Software, San Diego, CA, USA). Data were analyzed by a one-way analysis of variance (ANOVA). Student's t-test was used when two groups were compared. Data are presented as mean ± standard deviation (SD). A value of P < 0.05 was considered statistically significant.

RESULTS

Effect of curcumin on lipopolysaccharide-induced mucin 5AC expression in NCI-H292 cells

To confirm whether LPS can induce MUC5AC production in NCI-H292 cells, we evaluated the MUC5AC mRNA expression after addition of LPS to the cells at various concentrations for different times. Consistent with previous reports, we found that stimulation with LPS led to a time-dependent and dose-independent increase in MUC5AC expression. This effect was most apparent after treatment with 10 μg/ml LPS for 24 h [Figure 1a and 1b]. Compared with the control group, the expression of MUC5AC mRNA and protein in LPS group is 7.169 ± 1.785 (t = −5.981, P < 0.01) and 2.340 ± 0.209 (t = −11.101, P < 0.01), respectively [Figure 1].

Figure 1

Effect of curcumin on MUC5AC expression induced by lipopolysaccharide in NCI-H292 cells. (a) MUC5AC mRNA expression induced by LPS at different concentrations. (b) MUC5AC mRNA expression induced by LPS in time-dependent manners. (c) Curcumin reduced MUC5AC mRNA expression in dose-dependent manners. (d) Curcumin inhibited LPS-induced MUC5AC protein expression. The values are expressed as mean ± standard error; *P < 0.05, compared with control group; †P < 0.05, compared with LPS group. MUC5AC: Mucin 5AC; LPS: Lipopolysaccharide; CUR: Curcumin; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

In order to assess the effect of CUR on LPS-induced MUC5AC expression in human NCI-H292 cells, mRNA, and protein expression of MUC5AC was measured by real-time PCR and Western blotting. Cells were pretreated with CUR for 30 min before the addition of 10 μg/ml LPS. There was no significant damage to NCI-H292 cells when the concentration of CUR was <40 μmol/L (data not shown). Compared with LPS group, the expression of MUC5AC mRNA (2.424 ± 0.318 vs. 7.169 ± 1.785, t = 4.534, P < 0.05) and protein (1.060 ± 0.197 vs. 2.340 ± 0.209, t = 7.716, P < 0.05) significantly decreased after treatment with CUR in a dose-dependent manner, respectively [Figure 1c and 1d].

Curcumin reduced levels of reactive oxygen species in NCI-H292 cells

ROS levels, as determined by flow cytometry, were significantly higher in the LPS group than those in the control group. However, pretreatment with CUR resulted in significant decrease in ROS production after exposure to LPS [Figure 2].

Figure 2

Curcumin decreased LPS-induced ROS content in NCI-H292 cells. NCI-H292 cells were treated with curcumin and LPS, stained with Total ROS detection reagent and analyzed using flow cytometry. Untreated cells were used as a control. The fluorescence intensity was measured using a flow cytometry. ROS content in (a) group control, (b) group LPS, (c) group LPS + CUR. (d) Comprehensive comparison of three groups. LPS: Lipopolysaccharide; CUR: Curcumin; ROS: Reactive oxygen species.

Curcumin induced nuclear factor erythroid 2-related factor 2 activation in NCI-H292 cells

In order to investigate the possible role of Nrf2 in CUR-mediated inhibition of mucus production, we further analyzed mRNA and protein expression of Nrf2 in NCI-H292 cells that had been preincubated with 40 μmol/L CUR for 30 min before exposure to 10 μg/ml LPS for 24 h. CUR significantly increased Nrf2 mRNA and protein expression in NCI-H292 cells, compared with the LPS group (1.952 ± 0.340 vs. 1.142 ± 0.176, t = −3.661, and 2.010 ± 0.209 vs. 1.089 ± 0.132, t = −6.453, both P < 0.05, respectively) [Figure 3a and 3b].

Figure 3

Curcumin inhibited LPS-induced MUC5AC hypersecretion via nuclear factor erythroid 2-related factor 2 in NCI-H292 cells. (a) Curcumin induced Nrf2 mRNA activation in NCI-H292 cells. (b) Curcumin activated Nrf2 protein expression. Nrf2 siRNA suppressed the inhibitory activity of curcumin against MUC5AC mRNA (c) and protein (d) production induced by LPS in NCI-H292 cells. The values are expressed as mean ± standard error; *P < 0.05, compared with LPS group; †P < 0.05, compared with LPS + negative siRNA group; ‡P < 0.05, compared with LPS + Nrf2 siRNA group. MUC5AC: Mucin 5AC; Nrf2: Nuclear factor erythroid 2-related factor 2; LPS: Lipopolysaccharide; CUR: Curcumin; siRAN: small interfering RNA.

Nuclear factor erythroid 2-related factor 2 small interfering RNA suppressed the protective effect of curcumin on lipopolysaccharide-induced mucin 5AC expression in NCI-H292 cells

To confirm the involvement of Nrf2 in CUR's inhibition of LPS-induced MUC5AC mucin production, we used Nrf2 siRNA to knockdown Nrf2. MUC5AC expression in NCI-H292 cells were examined by real-time PCR and Western blotting. As shown in Figure 3c and 3d, Nrf2 siRNA (100 nmol/L) significantly decreased expression of Nrf2 mRNA and protein in NCI-H292 cells. Compared with the negative-siRNA + LPS group, knockdown of Nrf2 with Nrf2 siRNA increased MUC5AC mRNA expression by 47.7% (6.845 ± 1.478 vs. 3.391 ± 0.517, t = −3.821, P < 0.05). Using mouse monoclonal antibody to MUC5AC (clone 45 M1, 1:100), we confirmed that Nrf2 siRNA markedly increased MUC5AC protein expression in NCI-H292 cells. These results suggest that Nrf2 is partly involved in the inhibitory activity of CUR against LPS-induced MUC5AC expression in airway epithelial cells.

Effect of curcumin on lipopolysaccharide-induced mucin 5AC and nuclear factor erythroid 2-related factor 2 production in vivo

After establishing that CUR inhibits LPS-induced MUC5AC expression through Nrf2 in vitro, we sought to evaluate the same phenomenon in vivo. We found that CUR (50 mg/kg) significantly decreased LPS-induced mRNA and protein expression of MUC5AC in mouse lung (1.672 ± 0.721 vs. 5.961 ± 2.452, t = 2.906, and 0.480 ± 0.191 vs. 2.290 ± 0.834, t = 3.665, respectively; both P < 0.05) [Figure 4a and 4c], and also suppressed mucin production as demonstrated by Alcian blue/PAS stain [Figure 4d]. As shown in Figure 4b and 4c, CUR significantly increased Nrf2 mRNA and protein expression, compared with levels observed in the LPS group (2.076 ± 0.097 vs. 0.953 ± 0.263, t = −6.924, and 2.303 ± 0.295 vs. 1.089 ± 0.132, t = −6.499; both P < 0.01, respectively).

Figure 4

Effect of curcumin on LPS-induced MUC5AC and Nrf2 production in vivo. Curcumin significantly decreased LPS-induced MUC5AC mRNA (a) and protein (c) expression in mouse lung tissue, with activation of Nrf2 mRNA (b) and protein (c) expression. (d) AB/PAS staining shows that curcumin suppressed mucin production (arrows, ×200). Protein expression as normalized to GADPH. All values are expressed as mean ± standard error; n = 7 per group; *P < 0.05, compared with LPS group. MUC5AC: Mucin 5AC; Nrf2: Nuclear factor erythroid 2-related factor 2; LPS: Lipopolysaccharide; CUR: Curcumin; AB/PAS: Alcian blue/periodic acid-Schiff.

Curcumin decreased lipopolysaccharide-induced inflammatory cells in bronchoalveolar lavage fluid and lung tissue of mice

As a major component of gram-negative bacteria, LPS increases airway mucin secretion and induces airway inflammation. To evaluate the effects of CUR on LPS-induced inflammation in mouse lung, we counted the numbers of inflammatory cells and neutrophils in BALF and lung tissue of mice pretreated with CUR for 2 h before exposure to LPS for 7 days. Compared with LPS group, the numbers of total inflammatory cells (247 ± 30 vs. 334 ± 24, t = 3.901, P < 0.05) and neutrophils (185 ± 22 vs. 246 ± 20, t = 3.566, P < 0.05) in BALF decreased in the LPS + CUR group [Figure 5a and 5b]. Inflammatory cell infiltration in lung tissue was also reduced in CUR-treated mice, compared with LPS-challenged mice [Figure 5c]. These data suggest that CUR might be involved in the regulation of LPS-induced airway inflammation in vivo.

Figure 5

Curcumin decreased LPS-induced inflammatory cells in bronchoalveolar lavage fluid and lung tissue of mice. Curcumin decreased LPS-induced total inflammatory cells (a) and neutrophils (b) in BALF. (c) Curcumin reduced the infiltration of inflammatory cells in lung tissues (arrows, H and E, ×200). All values are expressed as mean ± standard error; n = 7 per group; *P < 0.05, compared with LPS group. LPS: Lipopolysaccharide; CUR: Curcumin; BALF: Bronchoalveolar lavage fluid.

DISCUSSION

The study demonstrates that CUR inhibits LPS-induced MUC5AC mucin production and that this effect is mediated by Nrf2. The results presented above show that CUR suppressed LPS-induced MUC5AC mRNA and protein production, accompanied increased expression of Nrf2 in alveolar epithelial NCI-H292 cells and mouse lung. Nrf2 siRNA significantly blocked the protective activity of CUR against MUC5AC mucin expression induced by LPS in NCI-H292 cells.

Excessive mucus secretion is an important pathophysiological characteristic of chronic inflammatory airway diseases, and the regulation of mucus overproduction is a major therapeutic target. CUR has been reported to show anti-inflammatory, antioxidative stress and anticancer effects in respiratory epithelial cell. Heo et al. and Chang et al.[1112] reported that CUR could inhibit the expression of MUC5AC induced by EGF or IL-1beta in NCI-H292 cells, respectively. LPS is a well-known pathogen for respiratory diseases, and also plays a significant role in the induction of MUC5AC expression. However, no previous study has reported that CUR regulates LPS-induced MUC5AC overproduction. We examined the effect of CUR on LPS-induced MUC5AC gene expression and mucin production in NCI-H292 cells and C57BL mice. The results presented above show that CUR suppressed the MUC5AC expression induced by LPS in vitro and in vivo; this effect was dose independent. CUR also inhibited the production of MUC5AC mucin protein induced by LPS. These results suggest that CUR regulates the mRNA and protein expression of mucin induced by LPS.

The mechanism by which CUR inhibits mucus production remains unclear. Numerous studies have reported the indispensable role of oxidative stress in LPS-induced mucin regulation. Our laboratory has reported that ROS and Duox1, one of the NADPH oxidases, are involved in LPS-induced MUC5AC expression in A549 cells and primary mouse tracheal epithelial cells.[14] As an important transcription factor responsible for anti-oxidative stress and cytoprotection, the role of Nrf2 in mucins regulation has been investigated. Qi et al.,[16] demonstrated that Nrf2 could regulate neutrophil elastase-induced MUC5AC expression in human airway epithelial cells. We found that Nrf2 ameliorated cigarette smoking-induced mucus overproduction in airway epithelium and mouse lungs.[20] Soetikno et al.[24] demonstrated that CUR alleviated oxidative stress, inflammation, and renal fibrosis in remnant kidney through the Nrf2-keap1 pathway. Kim et al.[25] showed that CUR-mediated anti-inflammatory effects in LPS-stimulated macrophages through Nrf2 signaling. Liu et al.[26] showed that CUR ameliorates asthmatic airway inflammation by activating Nrf2/HO-1 signaling pathway. However, there is none answer whether or not Nrf2 directly regulated the protective activity of CUR against MUC5AC mucin production induced by LPS. In the present study, we confirmed CUR attenuate LPS-induced ROS production and induce Nrf2 expression in NCI-H292 cells and mouse lungs. When Nrf2 expression was knockdowned by siRNA, the inhibitory effect of CUR against LPS-induced MUC5AC mucin expression was suppressed. These findings suggest that CUR might regulate LPS-induced mucus production through Nrf2 signaling.

The study had certain limitations. We should have included a rescue experiment by adding back Nrf2 after siRNA knockdown. Experiments on Nrf2-/- mice would have been useful to confirm the role of Nrf2 in mediating CUR's inhibition of LPS-induced mucin overproduction.

In conclusion, the results presented above demonstrate that CUR inhibits LPS-induced mucus production partly through activation of Nrf2. The findings presented in this study might provide novel insight into the development of new drugs against mucus hypersecretion. CUR represents a promising candidate for a therapeutic intervention in inhibit mucus hypersecretion in chronic inflammatory airway disease.

Financial support and sponsorship

This study was supported in part by grants from the Youth Research Project of Fujian Provincial Bureau (No. 40935), the Natural Science Foundation of Fujian Province (No. 2013J01289), and National Key R and D Program of China (No. 2016YFC1304000).

Conflicts of interest

There are no conflicts of interest.