Literature DB >> 29978105

Detection of Listeria Spp. and Listeria Monocytogenes in Biological Samples by SYBR Green I and TaqMan Probe-based Real-time PCRs.

Agnieszka Kędrak-Jabłońska1, Sylwia Budniak1, Marek Krupa1, Anna Szczawińska1, Monika Reksa1, Krzysztof Szulowski1, Wojciech Iwaniak1.   

Abstract

INTRODUCTION: The aim of the study was the application and comparison of real-time PCR methods based on the fluorescence of SYBR Green I intercalating dye and TaqMan probes for the detection of the 23S rDNA gene of Listeria spp. and the hlyA gene of Listeria monocytogenes in biological samples of the liver, brain, and blood.
MATERIAL AND METHODS: Five strains of L. monocytogenes and single strains of each species L. ivanovii, L. innocua,L. grayi, L. welshimeri, and L. seeligeri were used for the experiments. Additionally, five strains of other species of bacteria were used for evaluation of the specificity of tests. In the first stage of the study SYBR Green I real-time PCRs, one allowing detection of the 23S rDNA gene and two based on the amplification the hlyA gene, were performed. In the next part, three TaqMan probe-based real-time PCRs allowing confirmation of belonging to Listeria spp. and L. monocytogenes were conducted.
RESULTS: The observation of amplification curves in real-time PCRs enabled the detection of both genes. A high regression coefficient of 0.99 was found for all reactions. Specific amplification products were obtained for the 23S rDNA and hlyA genes which confirm their belonging to Listeria spp. and L. monocytogenes, respectively. Other microbial species did not reveal real-time PCR products.
CONCLUSION: Both real-time PCR methods for the detection of Listeria spp. and L. monocytogenes in biological samples demonstrated a significant sensitivity and high specificity.

Entities:  

Keywords:  Listeria monocytogenes; SYBR Green I; TaqMan probe; real-time PCR

Year:  2017        PMID: 29978105      PMCID: PMC5937340          DOI: 10.1515/jvetres-2017-0069

Source DB:  PubMed          Journal:  J Vet Res        ISSN: 2450-7393            Impact factor:   1.744


Introduction

Among the species belonging to Listeria, only Listeria monocytogenes has epizootic and epidemiological significance. Infections caused by L. ivanovii, L. innocua, or L. seeligeri occur sporadically in humans and animals. Listeriosis was described for the first time in 1926 by Murray et al. (15) in rabbit. Nyfeldt was the first who isolated L. monocytogenes from a man in 1929 (9). Although Murray et al. (15) suspected the oral route of infection, a clear link of Listeria infections to contaminated food was not made until the occurrence of the 1980s outbreaks and sporadic cases of listeriosis in humans (13, 19, 21, 25). Food contaminated with L. monocytogenes is considered the main source of infection in humans and animals. In animals listeriosis may occur as meningoencephalitis or meningoencephalomyelitis. In cattle, the infection also involves spontaneous abortions, respiratory tract and udder inflammations but in suckling calves mostly takes the form of septicaemia. In sheep and goats, the clinical course of listeriosis is similar to that in cattle. In horses it occurs incidentally in adults and foals as encephalitis and septicaemia, respectively. Listeriosis in pigs occurs very rarely, predominantly in piglets which die due to septicaemia without the characteristic symptoms of the infection. The cerebral form is sometimes found in older animals. Outbreaks of listeriosis in cats and dogs are very rare. In domestic birds the infection occurs sporadically in the form of septicaemia and as an enzootic disease in acute or chronic form. Of fur animals, chinchillas were especially susceptible, demonstrating sometime enzootic disease with signs of septicaemia (2, 9, 13). The EFSA reports in 2015 show that in the European Union Listeria spp. and most of L. monocytogenes occur mainly in cattle, sheep, and goats. These infections were also reported in pigs, horses, broilers, cats, dogs, foxes, and other wild and zoo animals (7). Pregnant women, newborns, elderly people, people with weak or suppressed immune system, and chronically ill are especially susceptible to listeriosis. The main clinical manifestations of listeriosis are meningoencephalitis, spontaneous abortions in pregnant women, and septicaemia. Listeriosis cases in humans are regularly listed in Europe, Australia, and USA. Although in most cases listeriosis occurs sporadically, the infection is characterised by high fatality rate (6, 13, 22, 24). In the European Union, 270 deaths among 2,206 cases of listeriosis were reported in 2015. The incidence rate was 0.46 per 100,000 population (7). In the same year, Poland reported 70 cases, with the incidence rate of 0.18 per 100,000 (16). The application of molecular biology techniques for laboratory diagnosis improved the detection of the microorganisms. PCRs and real-time PCRs are rapid, sensitive, and specific methods. The aim of the study was application and comparison of real-time PCR methods based on the fluorescence of SYBR Green I intercalating dye and TaqMan probes for the detection of the 23S rDNA gene of Listeria spp. and the hlyA gene of L. monocytogenes in experimentally contaminated biological samples (bovine liver, brain, and blood).

Material and Methods

Bacterial strains

The study involved five strains of L. monocytogenes:L. monocytogenes ATCC 7644, L. monocytogenes ATCC 13932, L. monocytogenes ATCC 19111, L. monocytogenes ATCC 19112, and L. monocytogenes ATCC 19115. To assess the specificity of the tests, the strains of other species of the genus Listeria, including single strains of L. ivanovii ATCC 19119, L. innocua ATCC 33090, L. grayi ATCC 19120, L. welshimeri ATCC 35897, and L. seeligeri, originating from the collection of the Department of Microbiology, National Veterinary Research Institute in Pulawy, Poland, were used. In addition, the experiments involved strains of other species, including Bacillus cereus ATCC 11778, Staphylococcus aureus ATCC 6538, Escherichia coli ATCC 25922, Salmonella Typhimurium ATCC 14028, and Klebsiella pneumoniae ATCC 13883.

Isolation of DNA

Each strain was streaked on TSYEA medium. Cultures were incubated for 24 h at 37°C. Then bacterial suspension with a density of 1 McF was prepared. Samples of 1 mL were centrifuged for 10 min at 13,000 rpm. The supernatant was removed and the pellet was used to contaminate bovine liver, brain, and blood samples. To isolate DNA, a DNeasy Blood and Tissue Kit (Qiagen, USA) was used. The sensitivity and linearity of real-time PCRs were determined by 10-fold dilution technique. The initial concentration of L. monocytogenes ATCC 13932 was about 1.5 × 106 CFU/reaction.

SYBR Green I real-time PCR

Real-time PCR was performed in 25 µL QuantiTect SYBR Green PCR Kit (Qiagen) containing the appropriate concentration of each primer, and 5 µL of DNA. One pair of primers detecting the 23S rDNA gene of the genus Listeria (20) and two pairs of primers amplifying the hlyA gene of L. monocytogenes (11, 17) were selected (Table 1). The primers were synthesised by Genomed (Poland). Primer concentrations of 0.1 µM, 0.25 µM, 0.5 µM, 1.0 µM, 1.5 µM, and 2.0 µM were evaluated to optimise the reaction. Reactions were run on the Rotor-Gene Q (Qiagen) and Rotor-Gene Q Series Software Version 2.0.2 with the following programme: 10 min at 95°C, and 40 cycles of 15 s at 95°C, 60 s at 60°C, and 90 s at 72°C. To confirm amplification specificity, the melting temperature of PCR products was determined by gradual raising the temperature of the reaction mixture from 55°C to 95°C and continuous fluorescence measurements.
Table 1

The characteristics of the primers for SYBR Green I and TaqMan probe-based real-time PCRs

 PrimersSequence (5’ - 3’)Concentration
23S rDNA geneL23SQ-FAGGATAGGGAATCGCACGAA1.0 μM

L23SQ-RTTCGCGAGAAGCGGATTT

Lin23SQ-FRTTCGCAAGAAGCGGATTTG

hlyA genehlyA-146-FGGGAAATCTGTCTCAGGTGATGT1.0 μM

hlyA-146-RCGATGATTTGAACTTCATCTTTTGC

hlyA-177-FTGCAAGTCCTAAGACGCCA0.5 μM
hlyA-177-RCACTGCATCTCCGTGGTATACTAA
The characteristics of the primers for SYBR Green I and TaqMan probe-based real-time PCRs

TaqMan probe-based real-time PCR

Real-time PCR was performed in 25 µL QuantiTect Probe PCR Kit (Qiagen) containing the appropriate concentration of each primer and probe, and 5 µL of DNA. Based on the literature data (11, 17, 20), the sequences of three different pairs of primers and probes were selected (Tables 1 and 2). The primers and probes were also synthesised by Genomed (Poland). Primer concentrations of 0.1 µM, 0.25 µM, 0.5 µM, 1.0 µM, 1.5 µM, and 2.0 µM, and probe concentrations of 0.05 µM, 0.1 µM, and 0.2 µM were evaluated to optimise the reaction. The reactions profile was as follows: 2 min at 50°C, 10 min at 95°C, and 50 cycles of 15 s at 95°C and 60 s at 63°C.
Table 2

The characteristics of the probes for TaqMan probe-based real-time PCRs

 ProbesSequenceConcentration
23S rDNA geneL23SQ-TM5’-VIC-TCTCACACTCACTGCTTGGACGC-Tamra-3’0.1 μM

hlyA genehlyA-146-TM5’-Fam -CAAAAATTCTTCCTTCAAAGCCGTAATTTACGG -Tamra-3’0.2 μM

hlyA-177-TM5’Fam -CGATTTCATCCGCGTGTTTCTTTTCG -Tamra-3’0.1 μM
The characteristics of the probes for TaqMan probe-based real-time PCRs

Results

In the first stage, three SYBR Green I real-time PCRs were applied for the detection of the 23S rDNA gene of Listeria spp. and the hlyA gene of L. monocytogenes. The influence of different primer concentrations was determined. The concentration for detecting the 23S rDNA gene with the L23SQ-F, L23SQ-R, and Lin23SQ-FR primers was set at the level of 1.0 μM. In the case of hlyA gene detection with the hlyA-146-F and hlyA-146-R primers, the optimal concentration was 1.0 μM, whereas the concentration of 0.5 μM was selected for the hlyA-177-F and hlyA-177-R primers. In the next stage, genus-specific SYBR Green I real-time PCR was performed using the L23SQ-F, L23SQ-R and Lin23SQ-FR primers with template DNA obtained from the liver, brain, and blood samples contaminated experimentally with 10 Listeria spp. strains. Ct values ranged from 17.47 to 22.8 for the liver, 14.93 to 21.13 for the brain, and 16.99 to 21.25 for blood samples. The specificity of amplification was confirmed by determination of the PCR product melting temperature. It was found that the melting temperature of the reaction products was about 80ºC. The sensitivity of the real-time PCR was 1.5 × 101 CFU/reaction for each type of biological samples (Fig. 1).
Fig. 1

Determination of the sensitivity (a) and linearity (b) of genus-specific SYBR Green I real-time PCR using L23SQ-F/R and Lin23SQ-FR primers for the detection of L. monocytogenes ATCC 13932 strain in the liver samples

Determination of the sensitivity (a) and linearity (b) of genus-specific SYBR Green I real-time PCR using L23SQ-F/R and Lin23SQ-FR primers for the detection of L. monocytogenes ATCC 13932 strain in the liver samples Then, a species-specific SYBR Green I real-time PCR was applied using the hlyA-146-F and hlyA-146-R primers for biological samples contaminated with five L. monocytogenes strains. Ct values were from 12.59 to 18.77 for the liver, 11.89 to 16.99 for the brain, and 12.8 to 16.6 for blood samples. Specific amplification products dissociated at about 81ºC. The sensitivity was 1.5 × 101 CFU/reaction for all samples (Fig. 2).
Fig. 2

Determination of the sensitivity (a) and linearity (b) of species-specific SYBR Green I real-time PCR using hlyA-146-F/R primers for the detection of L. monocytogenes ATCC 13932 strain in the brain samples

Determination of the sensitivity (a) and linearity (b) of species-specific SYBR Green I real-time PCR using hlyA-146-F/R primers for the detection of L. monocytogenes ATCC 13932 strain in the brain samples Amplification curves of biological samples contaminated with five L. monocytogenes strains were obtained with the hlyA-177-F and hlyA-177-R primers. Ct values ranged from 16.38 to 20.83 for the liver, 17.11 to 20.72 for the brain, and 17.72 to 20.13 for blood samples. It was shown that the melting temperature of the reaction products was about 76ºC. The sensitivity was established at 1.5 × 102 CFU/reaction for all samples (Fig. 3).
Fig. 3

Determination of the sensitivity (a) and linearity (b) of species-specific SYBR Green I real-time PCR using hlyA-177-F/R primers for the detection of L. monocytogenes ATCC 13932 strain in the blood samples

Determination of the sensitivity (a) and linearity (b) of species-specific SYBR Green I real-time PCR using hlyA-177-F/R primers for the detection of L. monocytogenes ATCC 13932 strain in the blood samples In the case of all SYBR Green I real-time PCRs, a high regression coefficient (0.99) was demonstrated for amplification of concentrations from 1.5 × 106 to 1.5 × 101 or 1.5 × 102 CFU/reaction, which indicates a high degree of reaction linearity (Figs 1b-3b). In the second stage of the study, three TaqMan probe-based real-time PCRs were performed. It was found that in the case of TaqMan probe-based real-time PCR detecting the 23S rDNA gene with the L23SQ-F, L23SQ-R, and Lin23SQ-FR primers and L23SQ-TM probe, their optimal concentrations were 1.0 μM for primers and 0.1 μM for the probe. For detection the hlyA gene with the hlyA-146-F and hlyA-146-R primers and hlyA-146-TM probe, the optimal concentrations were 1.0 μM for primers and 0.2 μM for the probe. In the case of the hlyA-177-F and hlyA-177-R primers and hlyA-177-TM probe, the concentration of 0.5 μM for primers and 0.1 μM for the probe were selected. Then, a genus-specific TaqMan probe-based real-time PCR was applied using the L23SQ-F, L23SQ-R, and Lin23SQ-FR primers and L23SQ-TM probe with template DNA obtained from the liver, brain, and blood samples contaminated experimentally with ten Listeria spp. strains. Ct values were 13.88 to 20.04 for the liver, 15.03 to 17.71 for the brain, and 15.03 to 19.22 for blood samples. The same sensitivity of 1.5 × 101 CFU/reaction was found for each type of biological samples (Fig. 4).
Fig. 4

Determination of the sensitivity (a) and linearity (b) of genus-specific TaqMan probe-based real-time PCR L23SQ-F/R and Lin23SQ-FR primers, and L23SQ-TM probe for the detection of L. monocytogenes ATCC 13932 strain in the liver samples

Determination of the sensitivity (a) and linearity (b) of genus-specific TaqMan probe-based real-time PCR L23SQ-F/R and Lin23SQ-FR primers, and L23SQ-TM probe for the detection of L. monocytogenes ATCC 13932 strain in the liver samples Next, a species-specific TaqMan probe-based real-time PCR was performed using the hlyA-146-F and hlyA-146-R primers and hlyA-146-TM probe for biological samples contaminated with five L. monocytogenes strains. Ct values ranged from 17.68 to 22.97 for the liver, 18.7 to 21.66 for the brain, and 21.57 to 23.59 for blood samples. The sensitivity was 1.5 × 101 CFU/reaction for all samples (Fig. 5).
Fig. 5

Determination of the sensitivity (a) and linearity (b) of species-specific TaqMan probe-based real-time PCR using hlyA-146-F/R primers and hlyA-146-TM probe for the detection of L. monocytogenes ATCC 13932 strain in the brain samples

Determination of the sensitivity (a) and linearity (b) of species-specific TaqMan probe-based real-time PCR using hlyA-146-F/R primers and hlyA-146-TM probe for the detection of L. monocytogenes ATCC 13932 strain in the brain samples In the case of the hlyA-177-F and hlyA-177-R primers and hlyA177-TM probe obtained Ct values were 15.79 to 21.06 for the liver, 18.09 to 21.36 for the brain, and 18.62 to 21.1 for blood samples. The sensitivity of the TaqMan probe-based real-time PCR was 1.5 × 102 CFU/reaction for all samples (Fig. 6).
Fig. 6

Determination of the sensitivity (a) and linearity (b) of species-specific TaqMan probe-based real-time PCR using hlyA-177-F/R primers and hlyA-177-TM probe for the detection of L. monocytogenes ATCC 13932 strain in the blood samples

Determination of the sensitivity (a) and linearity (b) of species-specific TaqMan probe-based real-time PCR using hlyA-177-F/R primers and hlyA-177-TM probe for the detection of L. monocytogenes ATCC 13932 strain in the blood samples As in the case of SYBR Green I real-time PCRs, high regression coefficient was also achieved in TaqMan probe-based real-time PCRs with the use of 23S rDNA and hlyA genes (Figs 4b-6b). To demonstrate the specificity of SYBR Green I and TaqMan probe-based real-time PCR methods, the template DNA obtained from the liver, brain, and blood samples experimentally contaminated with five strains of L. monocytogenes, single strains of L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri, and other microbial species including Bacillus cereus, Staphylococcus aureus, Escherichia coli, Salmonella Typhimurium, and Klebsiella pneumoniae was examined. All real-time PCRs were highly specific. The specific amplification products were obtained using the 23S rDNA and hlyA genes which identified the tested strains as Listeria spp. and L. monocytogenes. Isolates of other species failed to yield real-time PCR products.

Discussion

Listeriosis is diagnosed on the basis of clinical symptoms and diagnostic tests. The conventional method of microbiological diagnostics comprises inoculation of biological material on selective media enabling growth of the bacteria, and identification of colonies based on morphological, physiological, and biochemical characteristics. Traditional bacteriological methods are, however, time-consuming because they may last up to a few days (1, 8, 22). L. monocytogenes, being a pathogen of humans and animals, requires faster and less laborious diagnostic methods such as real-time PCR (2, 5). For detection of real-time PCR products non-specific dyes and specific fluorophore-labelled oligonucleotide probes are used. The most commonly used non-specific dye is SYBR Green I, which, when bound to the double-stranded DNA, fluoresces by exposure to the light of an appropriate wavelength. TaqMan-type nucleotide probes are also commonly used. These are oligonucleotides fluorescently labelled with the reporter dye (FAM) and the quenching dye (TAMRA). In the presence of the product, the probe hybridises to it and then is hydrolysed in the presence of DNA polymerase elongating the starter. As a result, the fluorescence of FAM may be detected and measured because it is not suppressed by TAMRA. The intensity of the fluorescence is proportional to the amount of amplified product. Real-time PCR eliminates post-amplification steps such as gel electrophoresis and allows observing the results of the amplification in real time (10, 12). The optimisation of reaction conditions is very important for the efficiency of real-time PCR. The optimal concentration of pairs of primers and probes was selected by testing various concentrations of each primer and probe in SYBR Green I and TaqMan probe-based real-time PCR methods. Several virulence-associated markers are used for the identification of L. monocytogenes in real-time PCR, but the hly gene, which encodes listeriolysin O, is one of the most frequently applied (11, 14, 17, 18, 20, 26). Hough et al. (11) achieved a detection limit 1.4 × 102 CFU in 25 g cabbage with the use of hly gene in TaqMan probe-based real-time PCR. Moreover, Portronieri et al. (18) detected 1 × 101 CFU in 10 g of yoghurt. In turn, Dadkhah et al. (4) obtained the detection limit of 1.58 × 103 CFU/mL in SYBR Green I real-time PCR using iap gene in nutrient broth and milk samples. Their results were similar to the TaqMan method, with the detection limit of 1.43 × 103 CFU/mL. The authors observed the same sensitivity of the two methods. In our study the same results of SYBR Green I and TaqMan probe-based real-time PCRs were obtained for different biological samples. In the case of both real-time PCRs detecting the 23S rDNA gene, the sensitivity was 1.5 × 101 CFU per reaction. The same level of sensitivity was achieved in methods detecting the hlyA gene with hlyA-146-F and hlyA-146-R primers. Only in both real-time PCRs detecting the hlyA gene with hlyA-177-F and hlyA-177-R primers, the sensitivity was observed at a slightly lower level of 1.5 × 102 per reaction. SYBR Green I and TaqMan probe-based real-time PCRs are equally useful for detection of L. monocytogenes, but the last method is more expensive because of the high cost of probe synthesis. In the case of SYBR Green I real-time PCR with the use hlyA gene in food samples, Traunšek et al. (26) achieved a regression coefficient higher than 0.98. In turn, Nogva et al. (17) obtained a regression coefficient higher than 0.993 in TaqMan probe-based real-time PCR using hlyA gene in pure cultures, water, skim milk, and unpasteurised whole milk. Their results were comparable to those reported by Murphy et al. (14) in pure cultures (0.998) and Hough et al. (11) in cabbage (0.997). Moreover, Rodríguez-Lázaro et al. (20) achieved a regression coefficient above 0.995 in TaqMan probe-based real-time PCR using hly and the 23S rDNA genes in pure cultures. In our studies we obtained a high regression coefficient (0.99) in SYBR Green I and TaqMan probe-based real-time PCR with the use the 23S rDNA and hlyA genes, which indicated a high degree of reaction linearity. Barkallah et al. (2) and Skerniškyté et al. (23) achieved 100% specificity in TaqMan probe-based real-time PCR using hly gene. Our results also demonstrated specificity reaching 100% in all SYBR Green I and TaqMan probe-based real-time PCRs with the use 23S rDNA and hlyA genes. In our studies real-time PCR methods based on the fluorescence of SYBR Green I intercalating dye and TaqMan probes, which were used for the detection of Listeria spp. and L. monocytogenes in biological samples, showed a significant sensitivity and high specificity. These methods improve the detection sensitivity in comparison to conventional PCR (3). In conclusion, real-time PCRs can be used as an alternative to classical methods for accurate, quick, and sensitive detection of contaminated samples.
  16 in total

Review 1.  The real-time polymerase chain reaction.

Authors:  Mikael Kubista; José Manuel Andrade; Martin Bengtsson; Amin Forootan; Jiri Jonák; Kristina Lind; Radek Sindelka; Robert Sjöback; Björn Sjögreen; Linda Strömbom; Anders Ståhlberg; Neven Zoric
Journal:  Mol Aspects Med       Date:  2006-02-03

Review 2.  Epidemiology of human listeriosis.

Authors:  A Schuchat; B Swaminathan; C V Broome
Journal:  Clin Microbiol Rev       Date:  1991-04       Impact factor: 26.132

3.  Real time quantitative PCR.

Authors:  C A Heid; J Stevens; K J Livak; P M Williams
Journal:  Genome Res       Date:  1996-10       Impact factor: 9.043

Review 4.  A review of Listeria monocytogenes and listeriosis.

Authors:  J C Low; W Donachie
Journal:  Vet J       Date:  1997-01       Impact factor: 2.688

Review 5.  Listeria monocytogenes and listeric infections.

Authors:  M L Gray; A H Killinger
Journal:  Bacteriol Rev       Date:  1966-06

6.  Epidemic listeriosis--evidence for transmission by food.

Authors:  W F Schlech; P M Lavigne; R A Bortolussi; A C Allen; E V Haldane; A J Wort; A W Hightower; S E Johnson; S H King; E S Nicholls; C V Broome
Journal:  N Engl J Med       Date:  1983-01-27       Impact factor: 91.245

7.  Application of 5'-nuclease PCR for quantitative detection of Listeria monocytogenes in pure cultures, water, skim milk, and unpasteurized whole milk.

Authors:  H K Nogva; K Rudi; K Naterstad; A Holck; D Lillehaug
Journal:  Appl Environ Microbiol       Date:  2000-10       Impact factor: 4.792

8.  Simultaneous quantitative detection of Listeria spp. and Listeria monocytogenes using a duplex real-time PCR-based assay.

Authors:  David Rodríguez-Lázaro; Marta Hernández; Maria Pla
Journal:  FEMS Microbiol Lett       Date:  2004-04-15       Impact factor: 2.742

9.  Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

Authors:  Angela J Hough; Sally-Ann Harbison; Marion G Savill; Laurence D Melton; Graham Fletcher
Journal:  J Food Prot       Date:  2002-08       Impact factor: 2.077

10.  Construction and evaluation of a microbiological positive process internal control for PCR-based examination of food samples for Listeria monocytogenes and Salmonella enterica.

Authors:  N M Murphy; J McLauchlin; C Ohai; K A Grant
Journal:  Int J Food Microbiol       Date:  2007-06-13       Impact factor: 5.277

View more
  3 in total

1.  Evaluation of Real-time PCR Based on SYBR Green I Fluorescent Dye for Detection of Bacillus Anthracis Strains in Biological Samples.

Authors:  Agnieszka Kędrak-Jabłońska; Sylwia Budniak; Anna Szczawińska; Monika Reksa; Marek Krupa; Krzysztof Szulowski
Journal:  J Vet Res       Date:  2018-12-31       Impact factor: 1.744

Review 2.  New insights into application of nanoparticles in the diagnosis and screening of novel coronavirus (SARS-CoV-2).

Authors:  Abhimanyu Tharayil; R Rajakumari; Amresh Kumar; Manabendra Dutta Choudhary; Parth Palit; Sabu Thomas
Journal:  Emergent Mater       Date:  2021-03-31

3.  Rapid Differential Detection of Japanese Encephalitis Virus and Getah Virus in Pigs or Mosquitos by a Duplex TaqMan Real-Time RT-PCR Assay.

Authors:  Yan Zhang; Yuhao Li; Zhixin Guan; Yang Yang; Junjie Zhang; Qing Sun; Beibei Li; Yafeng Qiu; Ke Liu; Donghua Shao; Zhiyong Ma; Jianchao Wei; Peng Li
Journal:  Front Vet Sci       Date:  2022-04-07
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.