Literature DB >> 29977176

Comparative Profiling of MicroRNAs Reveals the Underlying Toxicological Mechanism in Mice Testis Following Carbon Ion Radiation.

Yuxuan He1, Yong Zhang1, Hongyan Li2, Hong Zhang2, Zongshuai Li1, Longfei Xiao1, Junjie Hu1, Youji Ma1, Quanwei Zhang1, Xingxu Zhao1.   

Abstract

This study investigated the toxicity of heavy ion radiation to mice testis by microRNA (miRNA) sequencing and bioinformatics analyses. Testicular indices and histology were measured following enterocoelia irradiation with a 2 Gy carbon ion beam, with the testes exhibiting the most serious injuries at 4 weeks after carbon ion radiation (CIR) exposure. Illumina sequencing technology was used to sequence small RNA libraries of the control and irradiated groups at 4 weeks after CIR. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses implicated differential miRNAs in the regulation of target genes involved in metabolism, development, and reproduction. Here, 8 miRNAs, including miR-34c-5p, miR-138, and 6 let-7 miRNA family members previously reported in testis after radiation, were analyzed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) to validate miRNA sequencing data. The differentially expressed miRNAs described here provided a novel perspective for the role of miRNAs in testis toxicity following CIR.

Entities:  

Keywords:  heavy ion radiation; miRNAs; testis

Year:  2018        PMID: 29977176      PMCID: PMC6024298          DOI: 10.1177/1559325818778633

Source DB:  PubMed          Journal:  Dose Response        ISSN: 1559-3258            Impact factor:   2.658


Introduction

Testis is the key organ involved in maintaining male fertility through testosterone synthesis and production of the male gamete.[1] Additionally, spermatogenesis in the testis occurs via germ cell differentiation at different stages of development.[2] Testis is also among the most radiosensitive organs and can be significantly impaired by ionizing radiation (IR) exposure.[3] The toxic effects of IR interfere with normal spermatogenesis, affecting the proliferation and differentiation of spermatogenic cells, which ultimately leads to cell mutagenesis or apoptosis and results in reduced sperm counts and defective sperm production.[4] Cancer treatment by radiation or exposure to IR usually results in temporary destruction or complete cessation of spermatogenesis.[5,6] Therefore, temporary or permanent infertility is a common problem associated with radiation, especially in young men.[7] In recent years, heavy ion radiation has been used in clinical radiotherapy; however, high linear energy transfer (LET) heavy ions have a higher likelihood of damaging cells when compared to low-LET radiation, including X- or γ-rays. Therefore, it is important to investigate the mechanisms underlying injuries acquired from testis exposure to high-LET radiation.[8,9] MicroRNAs (miRNAs) are produced by genomic transcription[10] and regulate the expression of multiple genes by cleavage or translation inhibition.[11] Investigation of functions related to miRNAs and their regulatory roles contributed to the discovery of information delivery patterns and miRNA-mediated gene regulatory networks, which further clarified different aspects of biological activities.[12] The study of miRNA function in testes allowed insight into human disease mechanisms. Tang et al discovered that upregulation of miR-210 is associated with spermatogenesis by targeting insulin-like growth factor (IGF) 2 in male infertility,[13] and Noveski et al reported that the expression of 5 miRNAs (hsa-miR-34b, hsa-miR-449b, hsa-miR-517c, hsa-miR-181c, and hsa-miR-605) was associated with impaired spermatogenesis in patients.[14] In this study, we determined differential expression profiles for miRNAs based on miRNA-seq analyses following carbon ion radiation (CIR) exposure in mouse testis and investigated the underlying toxicological mechanisms. These results provided insight for evaluating environmental or clinical risks of CIR exposure.

Materials and Methods

Animals and Irradiation Procedure

Healthy male Swiss-Webster mice were purchased from Lanzhou Medical College (Lanzhou, China); the mice aged 4 weeks and weighing 14 to 18 g. Animals were randomly assigned to a control (CK) and CIR (2 Gy) groups (n = 15 in each group) and were acclimatized to the same laboratory conditions for 1 week before use and were housed in a conventional animal facility at 22°C ± 2°C, 60% ± 10% humidity, and a 12-hour light –12-hour dark photoperiod, with 3 mice per cage. All experiments were approved by the Institutional Animal Care Committee. Five-week-old mice were enterocoelia irradiated with a 2 Gy carbon-ion beam at 250 MeV/U and 31.3 keV/μm (at the beam entrance), to give a dose of approximately 0.5 Gy/min, at the Heavy Ion Research Facility in Lanzhou (Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou, China).[15]

Testes Were Weighed, Fixed, and Histopathologic Observation

Five mice from each group were used at 1, 4, and 7 weeks after CIR and were killed by cervical dislocation. The testes of each mouse were taken out and connective tissues were removed. Left testes were fixed in 4% paraformaldehyde solution (4 g paraformaldehyde in 100 mL phosphate buffer saline) and embedded in paraffin blocks, and right testes were frozen immediately in liquid nitrogen and stored at −80°C until analysis.[16]

Histopathologic Observation and Observation of Spermatogenic Cells Apoptosis

The fixed tissues were thoroughly washed in 0.01 phosphate buffer (pH 7.4), dehydrated in graded ethanol, toluene-cleared, and embedded in paraffin. Paraffin sections of testis and cauda epididymis were cut at 5 μm, mounted on slides, and stained with hematoxylin and eosin and observed under a light microscope (Nikon 80i; Nikon, Japan).[6] The in situ Cell Death Detection horseradish peroxidase Kit (Roche, Mannheim, Germany) was used to carry out the terminal 2′-deoxyuridine 5′-triphosphate nick end-labeling (TUNEL) assay. Briefly, paraffin blocks of testis material were cut into 4-μm thick sections and treated with 20 mg/mL proteinase K solution for 20 minutes at 37°C. The TUNEL reaction was then performed in TdT buffer in the presence of dUTP-biotin for 60 minutes at 37°C and then incubated with the secondary antifluorescein-POD-conjugate for 30 minutes. The signal was visualized using diaminobenzidine. Sections were then counterstained with hematoxylin, dehydrated, cleaned, mounted, and observed under a light microscope (Axio10, Zeiss, Germany).

Total RNA Extraction for Testis

The total RNA of testes at 4 weeks after CIR was isolated from the strain using the Trizol reagent according to manufacturer’s instructions (Invitrogen, Carlsbad, California). An additional DNase I digestion step was performed to ensure that the samples were not contaminated with genomic DNA. RNA purity was assessed using the Nanodrop-2000. Each RNA sample had an A260:A280 ratio above 1.8 and A260:A230 ratio above 2.2.

Small RNA Library Construction, Sequencing, and Data Processing

Approximately 1 µg of total RNA was used to prepare small RNA library according to protocol of NEBNext Small RNA Library Prep Set for Illumina. And then, we performed the single-end sequencing (50 bp) on an Illumina Hiseq2500 at ORI-GENE (Beijing, China) following the vendor’s recommended protocol. Raw reads were checked for potential sequencing issues and contaminants using FastQC. Adapter sequences, primers, Ns, polyA/polyT, and reads with quality scores below 20 were trimmed. Reads with a length <10 nt and >34 nt were discarded. The clean reads that were obtained were compared with the Rfam10.1 database using BLAST to annotate the sRNA sequences. The clean reads were aligned against the miRNA precursor/mature miRNA of Homo sapiens and other species in miRBase 20.0 (http://www.mirbase.org/) to identify known miRNAs. The unannotated sequences were mapped to the human genome to analyze their expression and distribution in the genome and then used to predict potential novel miRNA candidates by Mireap (http://sourceforge.net/projects/mireap/). The read counts of each known miRNA were then normalized to the total counts of sequence reads mapped to the miRBase version 20.0 database and are presented as reads per million mapped reads. MicroRNA differential expression based on normalized deep-sequencing counts was analyzed by selectively using permutation test based on the experiments design. The P value was identified by the false discovery rate (FDR), which defines the Benjamini-Hochberg correction to determine different expression levels between the 2 groups. A criterion of |log2 (fold-change)| ≥ 1 and P value <.05 between the 2 groups was used to identify differentially expressed miRNAs.[17]

Prediction of Target Genes and Gene Ontology Analysis

Potential targets of all the miRNAs identified were predicted using psRNATarget (http://plantgrn.noble.org/psRNATarget/) with default parameter settings. Since genome sequence was unavailable for Mus musculus, we used the total expressed sequence tags of mouse as the pool for the putative miRNA targets prediction. The target genes were aligned to the Cluster of Orthologous Groups and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases to predict and classify possible functions. Functional annotation was also assigned according to the Gene Ontology (GO) database (http://www.geneontology.org/). The GO enrichment analysis was performed for target genes of thermogenesis-related miRNAs using BiNGO.[18]

Real-Time Quantitative Polymerase Chain Reaction

Total RNA was extracted from the testis by using Trizol reagent according to the manufacturer’s protocol (Invitrogen, Life Technologies, Carlsbad, CA, USA). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses for miRNAs identified by miRNA sequencing were performed using PrimeScript RT Reagent Kit with gDNA Eraser (Takara-Bio, Otsu, Japan). Reverse transcription reactions were performed at the following parameters: 42°C, 5 minutes; 42°C (miRNA), 30 minutes; and 85°C, 2 minutes. The PCR reactions were performed at the following parameters: 95°C for 2 minutes followed by 40 cycles of 95°C, 15 seconds and 59°C, 30 seconds. A U6 small nuclear RNA was used as endogenous control for data normalization of miRNAs. U6: forward primer: forward 5′-CGCTTCGGCAGCACATATAC-3′; reverse 5′-AAATATGGAACGCTTCACGA-3′. The universal primer of miRNA antisense strand: R primer: CCAGTGCAGGGTCCGAGGTATT. Relative expression was calculated by the comparative threshold cycle method. The sequences of primers used for reverse transcription and qRT-PCR were purchased from RiboBio Company (Guangzhou, China).[19,20]

Statistical Analyses

All values are presented as mean ± standard error of mean (SEM). For small RNA-sequencing data, the threshold values we used to identify the differentially expressed miRNAs are |log2 (fold-change)| ≥ 1, and P value <.05. For RT-PCR data, statistical analysis was performed in Statistical Package for Social Sciences 16.0. The fold changes were calculated through relative quantification with 2−ΔΔCT. P < .05 was considered statistically significant.

Results

The Effect of CIR on Histology and Spermatogenic Cell Apoptosis of Testis

To investigate the intrinsic causes of testes weight reduction, we compared testicular histological changes and rates of spermatogenic cell apoptosis at 1, 4, and 7 weeks after CIR exposure. Photomicrographs of testis sections in each group are shown in Figure 1. The control group exhibited smooth seminiferous tubules and regular arrangement of all spermatogenic cells. Compared to controls, at 1 week, the number of vacuoles increased (asterisks), and spermatogenic cells were severely disorganized. At 4 weeks, spermatogenic cells were severely disorganized and the thickness of the epithelium decreased. At 7 weeks, spermatogenic cells gradually returned to normal arrangements with the exception of numerous vacuoles.
Figure 1.

Histological examination of testis in mice at 1, 4, and 7 weeks after carbon ion radiation (CIR). Photomicrographs of sections stained with hematoxylin and eosin (H&E; magnification × 200; scale bar = 100 μm). Arrows indicate spermatogenic cells in the seminiferous tubule, severe degeneration of spermatogenic cells in the seminiferous tubule (*). CK indicates control; lu, lumen; ls, leptotene-stage spermatocyte; ps, pachytene spermatocyte; sg, spermatogonia.

Histological examination of testis in mice at 1, 4, and 7 weeks after carbon ion radiation (CIR). Photomicrographs of sections stained with hematoxylin and eosin (H&E; magnification × 200; scale bar = 100 μm). Arrows indicate spermatogenic cells in the seminiferous tubule, severe degeneration of spermatogenic cells in the seminiferous tubule (*). CK indicates control; lu, lumen; ls, leptotene-stage spermatocyte; ps, pachytene spermatocyte; sg, spermatogonia. Rates of apoptosis in spermatogenic cells following CIR were examined by terminal deoxynucleotidyl transferase dUTP nick-end labeling assay (Figure 2). The control group showed a normal apoptotic profile, with almost no positively stained (apoptotic) cells in seminiferous tubules. By contrast, additional spermatogenic cells appeared in the CIR group at 1 and 4 weeks, with the most severe damage observed in spermatogonia and primary spermatocytes. However, at 7 weeks, there were no significant differences between control and CIR groups.
Figure 2.

Photomicrographs of apoptotic spermatogenic cells in mice at 1, 4, and 7 weeks after carbon ion radiation (CIR; magnification ×400; scale bar = 100 μm). Arrows indicate terminal dUTP nick end-labeling (TUNEL)-positive cells in the seminiferous tubule. CK indicates control; lu, lumen; ps, pachytene spermatocyte.

Photomicrographs of apoptotic spermatogenic cells in mice at 1, 4, and 7 weeks after carbon ion radiation (CIR; magnification ×400; scale bar = 100 μm). Arrows indicate terminal dUTP nick end-labeling (TUNEL)-positive cells in the seminiferous tubule. CK indicates control; lu, lumen; ps, pachytene spermatocyte.

Screening of Differentially Expressed miRNAs

We used Illumina sequencing technology to sequence small RNA libraries of the control and irradiated groups. After filtering out adapter and low-quality sequences and removing ribosomal, transfer, and small nucleolar RNAs and repeat regions, we identified mature miRNAs using BLAST to compare miRNA sequences from the miRBase database with miRNA sequences from other species. Our results indicated that the sequences derived from this study were known according to sequencing data related to mature miRNAs. We identified mature miRNAs in the sequencing data by means of database comparison and bioinformatics prediction and based on structural analysis to ensure consistency with known miRNA structures and mechanisms. MicroRNA sequences not identified in current databases were defined as novel miRNAs. For sequences not identified as known miRNAs, they were first mapped to the reference genome using Bowtie2 (http://bowtie-bio.sourceforge.net/bowtie2/index.shtml), and the MIREAP program (https://sourceforge.net/projects/mireap/) was used to predict novel miRNAs based on localization results. A total of 8508 known mature miRNAs and 105 novel miRNAs were identified in the control and CIR groups, respectively. The length distribution of the sequences identified as mature miRNAs (1432 miRNAs) was mainly in the range of 21 to 23 nt, exhibiting a typical normal distribution and with 22 nt accounting for the highest proportion (41.8%; Figure 3A). Sequences in ranges of 22 to 23 nt were in line with typical characteristics associated with Dicer enzyme cleavage. The specificity of Dicer-cleavage sites results in sequences beginning with a uridine base, giving these sequences stronger preference for development from precursor to mature miRNA. We analyzed the base distribution of each locus for all miRNA sequences (Figure 3B) to derive profiles of identified miRNAs in different species (Figure 3C) and calculated the reads per million for all miRNAs in individual testis of control and irradiated mice determine similarities in miRNA expression levels between the 2 groups (Figure 3D).
Figure 3.

The basic information of microRNAs (miRNAs) in mice testis at 4 weeks after carbon ion radiation (CIR). The length distribution of the sequences identified as mature miRNAs (A); CK, control; A, 2 Gy CIR exposure. The base distribution of each locus for all miRNA sequences (B). The profiles of identified miRNAs in different species (C). The reads per million for all miRNAs in individual testis of control (CK) and irradiated mice (A) determine similarities in miRNA expression levels between the 2 groups (D).

The basic information of microRNAs (miRNAs) in mice testis at 4 weeks after carbon ion radiation (CIR). The length distribution of the sequences identified as mature miRNAs (A); CK, control; A, 2 Gy CIR exposure. The base distribution of each locus for all miRNA sequences (B). The profiles of identified miRNAs in different species (C). The reads per million for all miRNAs in individual testis of control (CK) and irradiated mice (A) determine similarities in miRNA expression levels between the 2 groups (D). Among the known miRNAs, there were 70 differentially expressed (|log2(fold-change)| ≥ 1 and P value <.05) between the control and CIR groups. When compared to controls, 56 miRNAs were upregulated and 14 were downregulated in the CIR group. Details for the downregulated miRNAs are listed in Table 1, and those for the upregulated miRNAs are listed in Table 2. A volcano plot (Figure 4) illustrates the height differential related to miRNAs expression, a criterion of |log2(fold-change)| ≥ 1 and P value <.05 between the 2 groups was used to identify differentially expressed miRNAs. The miRNAs expression profiles heatmap shown in Figure 5 was constructed using mirPathv.3 Online Software (http://snf-515788.vm.okeanos.grnet.gr/dianauniverse/index.php?r=mirpath).
Table 1.

The Details for the Downregulated microRNAs (miRNAs) in Mice Testis at 4 Weeks After CIR.

miRNAmiRNA SequenceFold Change (A/CK)Log2 Fold Change P Value
aca-miR-34b-3p_R15-1L22TATGATCTAACCTGTATTCTTGCTGATT0.426477−1.22946.042665
bdi-miR169l_R1-17L21TAGCCAAGGATGAATTGATTAGCTTATC0None.001283
cel-miR-255-5p_R15-1L22TGAAAATTCGATTAGACAAAGATTTCTTACA0.299071−1.74144.021688
chi-miR-483_R7-21L22TAAGAAGAGTCACTTCTCCTCCCGTCTTCCC0.295917−1.75673.006581
efu-miR-9189e_R18-4L24TTCCAGGGAACCCGGGTTCAATTCCCAGC0.462986−1.11096.046978
efu-miR-9239_R20-6L22TACCTTCGTGGAGCTACAAAGTGATACTATGC0.452137−1.14517.037228
efu-miR-9360_R18-4L18TGATGAACTCCTGCAGGGCCCCAGC0.479584−1.06015.044845
gra-miR8672_R21-7L24ATCTATCTTGAAGACTTTCATACAATCATT0.424297−1.23685.041653
mdo-miR-7344-5p_R19-5L22TGTGGATGGCACTCAAGGGAAGAGCAATC0.375755−1.41214.020257
mmu-miR-138-5p_R1-23L23AGCTGGTGTTGTGAATCAGGCCGTT0.485429−1.04267.008146
mmu-miR-5623-5p_R19-4L24TCGCTCTGACTTGCCAGCTGTATGGCTTC0.299939−1.73726.044782
mse-miR-34_R2-23L23_19G-AAGGCAGTGTGGTTAGCTGATTGT0.438542−1.18921.028403
oha-miR-34c-5p_8G-TAGGCAGTTTAGTTAGCTGATTGT0.289266−1.78953.006227
str-miR-34b-5p_R5-22L22AGGAAGTGTAGTTAGCTGGTTGT0.325623−1.61873.007615

Abbreviations: A, 2 Gy CIR exposure; CIR, carbon ion radiation; CK, control; miRNA, microRNA.

Table 2.

The Details for the Upregulated miRNAs in Mice Testis at 4 Weeks After CIR.

miRNAmiRNA SequenceFold Change (A/CK)Log2 Fold Change P Value
api-let-7_R1-21L21TGAGGTAGTTGGTTGTATAGTC2.5586111.355361.015772
bta-miR-2340_R6-22L22TCCCTGGTGGTCTTGTGGTTAGGATTCGGCGCTC3.115911.639654.046913
chi-miR-1248-5p_R1-15L20ACCTTCTTGTATAAG8.0756673.013581.042288
dre-miR-199-3-3p_R1-21L21ACAGTAGTCCGCACATTGGTTA2.9054311.538752.015805
dre-miR-30a-5p_R4-22L22TGGAAACATTCCCGACTGGAAGC3.2725991.710437.047175
hhi-let-7j_R1-22L22TGAGGTAGTTGTTTGTACAGTTT2.3389411.225856.006712
lva-let-7-5pTGAGGTAGTAGGTTATATAGTT2.5827921.368931.028594
mdo-miR-7334-5p_R3-17L27AAGCTGTGATGAATTTGAATCCACTGATCTTCCG2.3777971.249625.030171
mmu-let-7a-5p_R1-22L22TGAGGTAGTAGGTTGTATAGTTC2.1223231.085644.045588
mmu-let-7b-5p_R1-20L22TGAGGTAGTAGGTTGTGTGGC2.1205381.08443.048089
mmu-let-7c-5p_R4-21L22TGTGGTAGTAGGTTGTATGGTA2.274311.185429.044656
mmu-let-7e-5p_R1-21L22TGAGGTAGGAGGTTGTATAGTC2.1847511.127469.015838
mmu-let-7f-5p_R1-22L22TGAGGTAGTAGATTGTATAGTTA2.6509221.406494.032903
mmu-let-7i-5p_R4-21L22TGGGGTAGTAGTTTGTGCTGTC2.4509481.29334.039731
mmu-miR-10b-3p_R1-20L22ACAGATTCGATTCTAGGGGAAC2.1884051.12988.048433
mmu-miR-1198-5p_R4-22L22TAGGTGTTCCTGGCTGGCTTGG2.4251071.278048.029492
mmu-miR-125b-2-3p_R1-19L22ACAAGTCAGGTTCTTGGGA2.1838581.126879.036914
mmu-miR-129-5p_R4-21L21CTGTTTGCGGTCTGGGCTTGCA2.6375091.399176.048279
mmu-miR-145a-3p_R1-20L22ATTCCTGGAAATACTGTTCTAT2.6119411.385122.038685
mmu-miR-181b-5p_R1-19L23AACATTCATTGCTGTCGGTA2.0801111.056661.006614
mmu-miR-1843b-5p_R1-20L21ATGGAGGTCTCTGTCTGACTG2.037831.027034.043665
mmu-miR-187-3p_R1-21L22TCGTGTCTTGTGTTGCAGCCGTT6.4480712.688868.010346
mmu-miR-1947-5p_R1-22L22AGGACGAGCTAGCTGAGTGCTGT2.1345321.09392.006326
mmu-miR-199b-3p_R5-21L22ACAATAGTCTGCACATTGGTT2.3641761.241337.031889
mmu-miR-1a-3p_17A-CTGGAATGTAAAGAAGTCTGTAT2.4976551.320574.000983
mmu-miR-200a-3p_R1-21L22TAACACTGTCTGGTAACGATGC2.3262161.217985.006096
mmu-miR-200b-3p_R1-22L22TAATACTGCCTGGTAATGATGACA3.1009531.632711.038718
mmu-miR-214-5p_R1-21L22TGCCTGTCTACACTTGCTGTG2.0233341.016734.016391
mmu-miR-221-5p_R1-21L26ACCTGGCATACAATGTAGATT2.0961451.067738.046504
mmu-miR-27a-5p_R5-21L22AGGACTTAGCTGCTTGTGAGC3.4257751.77643.032381
mmu-miR-27b-5p_R1-22L22CAGAGCTTAGCTGATTGGTGAACA2.941281.556444.046567
mmu-miR-292a-5p_R1-20L22ACTCAAACTGGGGGCTCTTT2.0345261.024693.033673
mmu-miR-3071-3p_R22-2L22AGGACTCCATTTGTTTTGATGA6.1082762.610765.00203
mmu-miR-322-3p_R1-19L21CAAAACATGAAGCGCTGCAACG2.4334331.282993.016092
mmu-miR-365-1-5p_R1-22L23AGGGACTTTTGGGGGCAGATGT3.2873781.716937.039922
mmu-miR-3970_R1-15L20TGAGGTTGTAGTTTGTACAGT3.3426561.740995.049239
mmu-miR-409-3pGAATGTTGCTCGGTGAACCCCT6.677152.739232.047799
mmu-miR-409-5pAGGTTACCCGAGCAACTTTGCAT3.158841.659395.049728
mmu-miR-411-3p_R1-21L22TATGTAACACGGTCCACTAACT3.0927541.628892.042532
mmu-miR-450a-5p_R1-21L22TTTTGCGATGTGTTCCTAATA2.7318151.44986.047235
mmu-miR-486b-5p_R1-22L22TCCTGTACTGAGCTGCCCCGAGTT2.6159841.387354.018421
mmu-miR-503-3p_R1-21L22GGAGTATTGTTTCCACTGCCTGA4.6370842.213218.021239
mmu-miR-503-5p_R5-20L23TAGAAGCGGGAACAGTACTG2.5123091.329014.013754
mmu-miR-5121_R2-21L21GCTTGTGATGAGACATCTCC2.2775131.187459.036423
mmu-miR-542-3p_R1-18L22TGTGACAGATTGATAACT2.2353361.160492.04376
mmu-miR-547-3p_R4-21L21CTGGGTACATCTTTGAGTGAG2.0063241.004554.021002
mmu-miR-676-5p_R2-22L22CTCTACAACCTTAGGACTTGC2.816631.49397.024758
mmu-miR-760-3p_R1-17L20TCGGCTCTGGGTCTGTGG2.0084041.00605.03554
mmu-miR-98-5p_R1-18L22TGAGGTAGTAAGTTGTATAGTT2.6327031.396545.044292
mmu-miR-99b-3p_R1-19L22CAAGCTCGTGTCTGTGGGT2.3010111.202268.039889
odi-let-7d_R1-16L22TGAGGTAGTGGGTTGTGTGGTT2.8218861.496659.008429
pma-miR-100b_R1-20L22AACCCGTAGATTCGAACTTGT2.4104771.269319.026821
pma-miR-4566_R18-4L22GAACGTTGCACACTGCCAGATGGAAGTCCTT2.0997941.070248.017057
ssa-miR-8156-5p_R15-1L21TCCAGGACAGTCAGGACTATT2.7321641.450044.019892
tch-miR-26a-2-5p_R1-20L22TTCAAGTAACCCAGGATAGG2.4957261.31946.001223
zma-miR2275c-5p_R21-7L21CTTACGGACGTGAGGGTTCAAGTCCCTCTCTTC4.3110122.108026.019223

Abbreviations: A, 2 Gy CIR exposure; CIR, carbon ion radiation; CK, control; miRNA, microRNA.

Figure 4.

A volcano plot illustrates the height differentially expressed microRNAs (miRNAs) in mice testis at 4 weeks after carbon ion radiation (CIR), a criterion of |log2(fold-change)| ≥ 1 and P value <.05 between the 2 groups was used to identify differentially expressed miRNAs. X-axis represents the log2 (fold change value), while y-axis represents −log10 (false discovery rate, FDR). Gray spots show no difference in expression. Green spots show the difference in expression based on the primary screening criteria (|log2(fold-change)| ≥ 1 and P value <.05). Red spots show the difference in expression based on the high screening criteria (|log2(fold-change)| ≥ 1 and P value <.05, at least the |log2(fold-change)| ≥ 1 in one compared group).

Figure 5.

The differentially expressed microRNA (miRNA) in mice testis at 4 weeks after carbon ion radiation (CIR) profiles heatmap was constructed using mirPathv.3 Online Software. Red signals indicate downregulated expression and green signals indicate upregulated expression. A indicates 2 Gy CIR exposure; CK, control.

The Details for the Downregulated microRNAs (miRNAs) in Mice Testis at 4 Weeks After CIR. Abbreviations: A, 2 Gy CIR exposure; CIR, carbon ion radiation; CK, control; miRNA, microRNA. The Details for the Upregulated miRNAs in Mice Testis at 4 Weeks After CIR. Abbreviations: A, 2 Gy CIR exposure; CIR, carbon ion radiation; CK, control; miRNA, microRNA. A volcano plot illustrates the height differentially expressed microRNAs (miRNAs) in mice testis at 4 weeks after carbon ion radiation (CIR), a criterion of |log2(fold-change)| ≥ 1 and P value <.05 between the 2 groups was used to identify differentially expressed miRNAs. X-axis represents the log2 (fold change value), while y-axis represents −log10 (false discovery rate, FDR). Gray spots show no difference in expression. Green spots show the difference in expression based on the primary screening criteria (|log2(fold-change)| ≥ 1 and P value <.05). Red spots show the difference in expression based on the high screening criteria (|log2(fold-change)| ≥ 1 and P value <.05, at least the |log2(fold-change)| ≥ 1 in one compared group). The differentially expressed microRNA (miRNA) in mice testis at 4 weeks after carbon ion radiation (CIR) profiles heatmap was constructed using mirPathv.3 Online Software. Red signals indicate downregulated expression and green signals indicate upregulated expression. A indicates 2 Gy CIR exposure; CK, control.

Functional Analysis of Differentially Expressed miRNAs

The GO threshold of significance was defined as P < .001 and an FDR < .05. A total of 539 GO-enriched terms were identified describing predicted functions of overexpressed miRNAs and included positive regulation of transcription from the RNA polymerase II promoter, protein homodimerization activity, and positive regulation of transcription from a DNA template. By contrast, 527 GO terms associated with downregulated miRNAs included protein homodimerization activity, poly(A) RNA-binding, and positive regulation of transcription from RNA polymerase II promoter. Significant GO-enriched terms are presented in Figure 6. Based on GO-enrichment analyses, the target gene of the differentially expressed miRNAs were enriched.
Figure 6.

Gene ontology (GO) enrichment analysis of the differentially upregulated microRNA (miRNA; A) and the downregulated miRNA (B) in mice testis at 4 weeks after carbon ion radiation (CIR). A indicates 2 Gy CIR exposure; CK, control.

Gene ontology (GO) enrichment analysis of the differentially upregulated microRNA (miRNA; A) and the downregulated miRNA (B) in mice testis at 4 weeks after carbon ion radiation (CIR). A indicates 2 Gy CIR exposure; CK, control.

Prediction of Target Genes of Differentially Expressed miRNAs

The target genes of the 70 differentially expressed miRNAs were predicted using TargetScan software (http://www.targetscan.org/mouse). The 56 upregulated miRNAs had 15 838 potential target genes, with 539 significant GO terms describing predicted target gene functions. The significant GO-enriched terms for the target genes of upregulated miRNAs are presented in Figure 7A. The 14 downregulated miRNAs had 14 519 potential target genes, with 527 significant GO terms describing predicted target gene functions. The significant GO-enriched terms for the target genes of downregulated miRNAs are presented in Figure 7B. These GO terms represented a wide range of biological processes, including metabolic, single organism, organelle, cellular, binding, cell, cell components. Based on KEGG analyses, KEGG pathway analysis of the target genes indicated 175 pathways involving target genes of the upregulated miRNAs and 163 pathways involving target genes of the downregulated miRNAs, including MAPK, Ras, cancer pathways, ubiquitin-mediated proteolysis, and apoptosis. The significant functions and pathways associated with the differentially expressed miRNA and their target genes are presented in Figure 7.
Figure 7.

Pathway analysis of the target genes of differentially upregulated microRNA (miRNA; A) and the downregulated miRNA (B) in mice testis at 4 weeks after carbon ion radiation (CIR). A indicates 2 Gy CIR exposure; CK, control.

Pathway analysis of the target genes of differentially upregulated microRNA (miRNA; A) and the downregulated miRNA (B) in mice testis at 4 weeks after carbon ion radiation (CIR). A indicates 2 Gy CIR exposure; CK, control.

Quantitative Reverse Transcription-Polymerase Chain Reaction Analysis

Based on KEGG results for the predicted target genes, we found that apoptosis plays an important role in spermatogenic cells in the testis following CIR exposure, indicating that this pathway may be related to reductions in testis weight and spermatogenic cell damage. Therefore, we used miRNAs involved in the apoptosis pathway to validate the quality of the sequencing results. The let-7 miRNA family members as well as miR-34c and miR-138 were reported in testis following IR exposure; therefore, we chose 6 upregulated let-7 miRNA family members (mmu-let-7a-5p_R1-22L22, mmu-let-7b-5p_R1-22L22, mmu-let-7c-5p_R1-22L22, mmu-let-7e-5p_R1-22L22, mmu-let-7f-5p_R1-22L22, and mmu-let-7i-5p_R4-22L22), as well as miR-34c and miR-138, and determined their expression by qRT-PCR analysis. The primers used are listed in Table 3, and the results of qRT-PCR are showed in Figure 8. Our results demonstrated that miR-34c and miR-138 were downregulated, and mmu-let-7a-5p_R1-22L22, mmu-let-7b-5p_R1-22L22, mmu-let-7c-5p_R1-22L22, mmu-let-7e-5p_R1-22L22, mmu-let-7f-5p_R1-22L22, and mmu-let-7i-5p_R4-22L22 were upregulated. These results agreed with those obtained by miRNA sequencing analysis (Tables 1 and 2).
Table 3.

The Primers of Each Selected miRNA.

miRNALoop Primer/F Primer
mmu-let-7a-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACAACTATAC/TGCGCTGAGGTAGTAGGTTGTA
mmu-let-7b-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACAACCACAC/TGCGCTGAGGTAGTAGGTTGTG
mmu-let-7c-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACAACCATAC/TGCGCTGAGGTAGTAGGTTGTA
mmu-let-7e-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACAACTATAC/TGCGCTGAGGTAGGAGGTTGTA
mmu-let-7f-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACAACTATAC/TGCGCTGAGGTAGTAGATTGTA
mmu-let-7i-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGT ATTCGCACTGGATACGACAACAGCAC/TGCGCTGAGGTAGTAGTTTGTG
oha-miR-34c-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGTA TTCGCACTGGATACGACACAATCAG/TGCGCAGGCAGTGTAGTTAGCTG
mmu-miR-138-5p5′-GTCGTATCCAGTGCAGGGTCCGAGGT ATTCGCACTGGATACGACCGGCCTGA/TGCGCAGCTGGTGTTGTGAATCA

Abbreviation: miRNA, microRNA.

Figure 8.

Relative expression of 8 selected microRNA (miRNA) was quantified by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Values represent averages ± SEM. Asterisks denote values that are different from controls: *P < .05, **P < .01, and ***P < .001 with Student t test analysis.

The Primers of Each Selected miRNA. Abbreviation: miRNA, microRNA. Relative expression of 8 selected microRNA (miRNA) was quantified by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Values represent averages ± SEM. Asterisks denote values that are different from controls: *P < .05, **P < .01, and ***P < .001 with Student t test analysis.

Discussion

Radiation treatment can induce apoptosis in germ cells, resulting in complete or temporary interruption of spermatogenesis. The testes are among the most sensitive organs to radiation due to the extreme sensitivity of highly mitotic, immature spermatogonia to radiation.[21] Understanding the regulatory role of miRNAs in the testes is important to the investigation of network-related mechanisms related to testicular injury following CIR exposure. The results of this study suggested that differentially expressed miRNAs directly or indirectly regulate testicular function following CIR exposure. A model of radiation injury was developed based on radiation dosage and time following CIR exposure. We used a dose of 2 Gy, which was equivalent to the fractional radiation dose commonly used in patients,[22] followed by monitoring of essential reproductive indices at 1, 4, and 7 weeks following CIR exposure to simulate dynamic changes in the male reproductive system following CIR exposure. We then selected time points at which the most severe injury was observed before comparing changes in miRNA expression in mouse testis following 2 Gy CIR exposure. Testis injury was evaluated by comparing the relative weight of the testis, testicular histology, and the rate apoptosis in spermatogenic cells. Our results indicated that CIR exposure caused long-term damage to testis and spermatogenesis, and that this damage was most acute at 4 weeks after CIR exposure. Therefore, this time point was chosen to investigate alterations in miRNA expression in mouse testis. MiRNAs are involved in the regulation of gene expression and protein translation,[23] and due to miRNA stability, they can be easily detected and are considered as predictive tools and important intervention targets for many diseases.[24] Although previous studies reported changes in miRNA expression in testes following IR exposure, Khan et al demonstrated that 14 miRNAs were differentially expressed in mouse testis exposed to whole-body proton irradiation (2 Gy).[25] However, there were no studies investigating the role of miRNAs in spermatogenesis following CIR exposure. As important regulators of spermatogenesis and germ cell apoptosis, miRNAs might help explain the effects of CIR on testis function. In order to investigate changes in miRNA expression in testis after CIR exposure, we investigated miRNA expression profiles following irradiation (2 Gy) and compared to controls. We identified 70 differentially expressed miRNAs associated with multiple biological processes, including response to insulin, apoptosis, intracellular signaling cascades, and the inflammatory response. We then mapped differentially expressed miRNAs to specific gene targets to establish potential regulatory networks given that miRNA target genes can regulate cell development and differentiation, the cell cycle, and apoptosis as well as play important regulatory roles in cell biology.[26] To elucidate the function of miRNA targets, KEGG pathway and GO analyses were performed on the target genes. Radiation may disrupt the balance between spermatogenic cell proliferation and apoptosis, and excessive apoptosis of spermatogenic cells might induce spermatogenic disorders related to male infertility.[27] Wang et al found that CIR exposure induced spermatogenic cell apoptosis.[28] Here, we focused on the apoptosis pathway to validate the roles of differentially expressed miRNAs. Deep sequencing and qRT-PCR validated that the expression levels of identified miRNAs between irradiated mice testis and controls were largely consistent with sequencing analysis. miR-34c is preferentially expressed in spermatogonial stem cell-enriched populations and is highly expressed in spermatocytes and round spermatids.[29,30] Inhibition of miR-34c in primary spermatocytes prevent germ cells from testosterone-deprivation-induced apoptosis.[31] miR-34c-5p levels in the testis from asthenozoospermic or oligoasthenozoospermic patients differed from those observed in normozoospermic men.[32] In this study, downregulation of miR-34c-5p prevented spermatogenic cells proliferation and induced apoptosis in spermatogenic cells following CIR exposure. miR-138 plays various roles in a variety of cancers[33] and negative regulation of anti-mullerian hormone (AMH). Additionally, elevated temperatures induce masculinization in Nile tilapia, during which miR-138 expression increased rapidly.[34,35] Furthermore, decreased miRNA expression promotes testicular differentiation by decreasing AMH levels in testes.[36] Hu et al found that miR-138 was downregulated in response to 17α-E2 treatment in mouse testicular Leydig tumor cells. Here, miR-138 downregulation suggested that decreased miR-138 expression promoted spermatogenic cell differentiation,[37] because IR exposure increased spermatogenic cell apoptosis and enhanced proliferation to maintain dynamic balance in testis.[38] The let-7 miRNA family is involved in the differentiation of spermatogonia from undifferentiated spermatogonia to A1 spermatogonia,[39] and let-7 miRNAs regulate the differentiation of spermatogonia by regulating IGF-1 signal pathway.[40] High-throughput sequencing revealed that 10 let-7 family members are present in channel catfish.[41] Mirlet7 family miRNAs are involved in retinoic acid-induced spermatogonial differentiation and are mainly expressed in spermatogonia and spermatocytes. We show that Mirlet7c, strongly expressed in the testis and spermatocyte stage, may be involve in regulating several distinct steps during spermatogenesis.[42] In this study, results of miRNA sequencing and qRT-PCR analysis revealed upregulation of 6 let-7 family members, consistent with results reported by Wang, showing significant upregulation of mmu-let-7d in response to proton radiation in mouse testis. These results agreed with a variety of previously observed changes in let-7 family members upon exposure to radiation. To our knowledge, this study is the first to investigate the role of miRNA expression in mouse testes following CIR exposure. Differentially expressed miRNAs can provide novel insights into mechanisms related to testicular damage, although differentially expressed miRNAs are not key to testicular injury and may not participate in the same processes in humans. Therefore, miRNA and targeted gene studies should be performed in human cells or samples to confirm the results presented here.

Conclusions

In summary, the expression of multiple miRNAs was altered in mouse testes following CIR exposure, indicating that testicular damage may be due to changes in the expression of several of the identified miRNAs. Additionally, our results suggested that miRNAs might be potential biomarkers of testicular damage. The results of this study provided insight into the potential contribution of miRNA regulation of testicular function and may promote development of prenatal diagnostic biomarkers for testis.
  40 in total

1.  Altered profile of seminal plasma microRNAs in the molecular diagnosis of male infertility.

Authors:  Cheng Wang; Cuihua Yang; Xi Chen; Bing Yao; Chen Yang; Chen Zhu; Limin Li; Junjun Wang; Xiaojun Li; Yong Shao; Yang Liu; Jiang Ji; Junfeng Zhang; Ke Zen; Chen-Yu Zhang; Chunni Zhang
Journal:  Clin Chem       Date:  2011-09-20       Impact factor: 8.327

2.  Identification and profiling of microRNAs from ovary of estrous Kazakh sheep induced by nutritional status in the anestrous season.

Authors:  Heng Yang; Shan Lin; Xiaoping Lei; Cong Yuan; Zhanwei Tian; Yaosheng Yu; Zongsheng Zhao; Jingbo Chen
Journal:  Anim Reprod Sci       Date:  2016-10-19       Impact factor: 2.145

3.  Upstream and downstream mechanisms for the promoting effects of IGF-1 on differentiation of spermatogonia to primary spermatocytes.

Authors:  Guoqiu Shen; Rongpei Wu; Bo Liu; Wenhan Dong; Zhong Tu; Jiarong Yang; Zhe Xu; Tiejun Pan
Journal:  Life Sci       Date:  2014-02-26       Impact factor: 5.037

4.  Comparative proteomics reveals the underlying toxicological mechanism of low sperm motility induced by iron ion radiation in mice.

Authors:  Hongyan Li; Yuxuan He; Jiawei Yan; Qiuyue Zhao; Cuixia Di; Hong Zhang
Journal:  Reprod Toxicol       Date:  2016-07-25       Impact factor: 3.143

5.  Distinctive microRNA expression signatures in proton-irradiated mice.

Authors:  Shahid Yar Khan; Muhammad Akram Tariq; James Patrick Perrott; Christopher Drew Brumbaugh; Hyunsung John Kim; Muhammad Imran Shabbir; Govindarajan T Ramesh; Nader Pourmand
Journal:  Mol Cell Biochem       Date:  2013-07-02       Impact factor: 3.396

6.  Regulation of miRNA processing and miRNA mediated gene repression in cancer.

Authors:  Sarah Bajan; Gyorgy Hutvagner
Journal:  Microrna       Date:  2014

7.  The association of rectal equivalent dose in 2 Gy fractions (EQD2) to late rectal toxicity in locally advanced cervical cancer patients who were evaluated by rectosigmoidoscopy in Faculty of Medicine, Chiang Mai University.

Authors:  Ekkasit Tharavichtikul; Pooriwat Meungwong; Taned Chitapanarux; Somvilai Chakrabandhu; Pitchayaponne Klunklin; Wimrak Onchan; Somsak Wanwilairat; Patrinee Traisathit; Razvan Galalae; Imjai Chitapanarux
Journal:  Radiat Oncol J       Date:  2014-06-30

8.  miRNA signature in mouse spermatogonial stem cells revealed by high-throughput sequencing.

Authors:  Tao Tan; Yanfeng Zhang; Weizhi Ji; Ping Zheng
Journal:  Biomed Res Int       Date:  2014-07-20       Impact factor: 3.411

9.  Up-Regulation of microRNA-210 is Associated with Spermatogenesis by Targeting IGF2 in Male Infertility.

Authors:  Dongdong Tang; Yuanyuan Huang; Weiqun Liu; Xiansheng Zhang
Journal:  Med Sci Monit       Date:  2016-08-18

Review 10.  Current practices in fertility preservation in male cancer patients.

Authors:  E Charles Osterberg; Ranjith Ramasamy; Puneet Masson; Robert E Brannigan
Journal:  Urol Ann       Date:  2014-01
View more
  4 in total

1.  An investigation of the effects of N-acetylcysteine on radiotherapy-induced testicular injury in rats.

Authors:  Atilla Topcu; Filiz Mercantepe; Sema Rakici; Levent Tumkaya; Huseyin Avni Uydu; Tolga Mercantepe
Journal:  Naunyn Schmiedebergs Arch Pharmacol       Date:  2018-11-13       Impact factor: 3.000

Review 2.  Role of Mitochondria in Radiation Responses: Epigenetic, Metabolic, and Signaling Impacts.

Authors:  Dietrich Averbeck; Claire Rodriguez-Lafrasse
Journal:  Int J Mol Sci       Date:  2021-10-13       Impact factor: 5.923

Review 3.  MicroRNA: a novel implication for damage and protection against ionizing radiation.

Authors:  Yonglin Chen; Jian Cui; Yaqi Gong; Shuang Wei; Yuanyun Wei; Lan Yi
Journal:  Environ Sci Pollut Res Int       Date:  2021-02-03       Impact factor: 4.223

Review 4.  MicroRNAs Responding to Space Radiation.

Authors:  Yujie Yan; Kunlan Zhang; Guangming Zhou; Wentao Hu
Journal:  Int J Mol Sci       Date:  2020-09-09       Impact factor: 5.923

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.