| Literature DB >> 29942287 |
Aimee C McKinnon1, Travis R Glare1, Hayley J Ridgway2, Artemio Mendoza-Mendoza1, Andrew Holyoake1, William K Godsoe1, Jennifer L Bufford1.
Abstract
Entomopathogenic fungi from the genus Beauveria (Vuillemin) play an important role in controlling insect populations and have been increasingly utilized for the biological control of insect pests. Various studies have reported that Beauveria bassiana (Bals.), Vuill. also has the ability to colonize a broad range of plant hosts as endophytes without causing disease but while still maintaining the capacity to infect insects. Beauveria is often applied as an inundative spore application, but little research has considered how plant colonization may alter the ability to persist in the environment. The aim of this study was to investigate potential interactions between B. bassiana and Zea mays L. (maize) in the rhizosphere following inoculation, in order to understand the factors that may affect environmental persistence of the fungi. The hypothesis was that different isolates of B. bassiana have the ability to colonize maize roots and/or rhizosphere soil, resulting in effects to the plant microbiome. To test this hypothesis, a two-step nested PCR protocol was developed to find and amplify Beauveria in planta or in soil; based on the translation elongation factor 1-alpha (ef1α) gene. The nested protocol was also designed to enable Beauveria species differentiation by sequence analysis. The impact of three selected B. bassiana isolates applied topically to roots on the rhizosphere soil community structure and function were consequently assessed using denaturing gradient gel electrophoresis (DGGE) and MicroRespTM techniques. The microbial community structure and function were not significantly affected by the presence of the isolates, however, retention of the inocula in the rhizosphere at 30 days after inoculation was enhanced when plants were subjected to intensive wounding of foliage to crudely simulate herbivory. The plant defense response likely changed under wound stress resulting in the apparent recruitment of Beauveria in the rhizosphere, which may be an indirect defensive strategy against herbivory and/or the result of induced systemic susceptibility in maize enabling plant colonization.Entities:
Keywords: agroecosystems; biocontrol; endophytes; entomopathogenic fungi; multitrophic interactions; plant interaction
Year: 2018 PMID: 29942287 PMCID: PMC6004820 DOI: 10.3389/fmicb.2018.01161
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Table of fungal isolates used in this study.
| Isolate | Accession/ Depository1 | Species | Host (insect/plant)2 | District, New Zealand | Isolated |
|---|---|---|---|---|---|
| BG11 | BMCC, BPRC | Christchurch | A. Clousten | ||
| E1063 | MH165265 | Nelson | N. Cummings | ||
| E1069 | MH165266 | Nelson | N. Cummings | ||
| FBHU | MH165264 | Selwyn | A. McKinnon | ||
| FRh2 | MH165263 | Auckland | S. Reay | ||
| E1079 | MH165253 | Nelson | N. Cummings | ||
| FRh1 | MH165255 | Auckland | S. Reay | ||
| NC142 | MH165256 | Westland | N. Cummings | ||
| NC44 | MH165252 | n.d. | Taupo | N. Cummings | |
| NC49 | MH165254 | Coleoptera | Taupo | N. Cummings | |
| E1059 | MH165247 | Westland | N. Cummings | ||
| E1060 | MH165250 | Westland | N. Cummings | ||
| NC215 | MH165248 | Westland | N. Cummings | ||
| NC220 | MH165249 | Orthoptera: Tettigoniidae | Westland | N. Cummings | |
| NC222 | MH165251 | Westland | N. Cummings | ||
| E1067 | MH165262 | Nelson | N. Cummings | ||
| E1080 | MH165260 | Coleoptera: Scarabaeidae | Nelson | N. Cummings | |
| E1083 | MH165257 | n.d. | Nelson | N. Cummings | |
| E1139 | MH165258 | Nelson | N. Cummings | ||
| E1175 | MH165261 | Nelson | N. Cummings | ||
| NC209 | MH165259 | Westland | N. Cummings | ||
| J1 | MH165245 | Canterbury | J. Brookes | ||
| J8 | MH165246 | Canterbury | J. Brookes | ||
| J10 | MH165244 | Canterbury | J. Brookes | ||
| J18 | MH165267 | Canterbury | J. Brookes | ||
| LU132 | BMCC, BPRC | ||||
| C14 | BMCC, BPRC | n.d. | Canterbury | M.C. Lefort | |
| ICMP-1 | ICMP-11019 | Timaru | W Thomas | ||
| ICMP-2 | ICMP-14476 | Marlborough | M. Braithwaite |
Novel primer pairs designed for a 2-step nested PCR protocol.
| Primer ID | Sequence (5′ → 3′) | TM | Amplicon (bp) | PCR type |
|---|---|---|---|---|
| EF3F | ACGGTGCCCGTCGGT | 60 | 406 | |
| EF5R | ACTTGATGAACTTGGGGTTGTTC | 55 | ||
| EF4F | GTCGCTGGTGACTCCAAGAA | 59 | 176 | |
| EF4R | GTACGGCGGTCGATCTTCTC | 60 |
PCR primers and thermal cycling conditions used for each target group in preparation for denaturing gradient gel electrophoresis (DGGE).
| Group | Primer sets | Thermal cycling conditions |
|---|---|---|
| Alphaproteobacteria | F203A and L1401 341GC and 518R | 96°C 4 min, 30 × (94°C 1 min, 64°C 2 min, 74°C 1 min), 74°C 10 min. 96°C 4 min, 30 × (96°C 1 min, 56°C 30 s, 74°C 1 min), 74°C 10 min. |
| Betaproteobacteria | β359F and β682R 518FGC and β682R | 96°C 4 min, 30 × (94°C 1 min, 63°C 1 min, 74°C 1 min), 74°C 10 min. 96°C 4 min, 30 × (96°C 1 min, 60°C 1 min, 74°C 1 min), 74°C 10 min. |
| Fungi | AU2 and AU4 FF-390 and FR1-GC | 95°C 3 min, 35 × (94°C 1 min, 50°C 1 min, 72°C 1 min), 72°C 7 min. 95°C 2 min, 8 x (95°C 30 s, 55-48°C1 30 s, 72°C 1 min), 27 × (95°C 30 s, 47°C 30 s, 72°C 1 min) 72°C 7.5 min. |
| Arbuscular mycorrhizal fungi | AML1 and AML2 Glo-1 and NS 31-GC | 95°C 3 min, 35 × (94°C 1 min, 50°C 1 min, 72°C 1 min), 72°C 7 min. 95°C 3 min, 35 × (94°C 45 s, 52°C 45 s, 72°C 1 min), 72°C 7 min. |