Mutation EthAW21R confers co-resistance to prothionamide and ethionamide in both Mycobacterium bovis BCG and Mycobacterium tuberculosis H37Rv.

Ethionamide (ETA) and prothionamide (PRO) are interchangeably used in tuberculosis (TB) chemotherapy regimens. Subtle discrepancies between biochemical and genetic information on the modes of sensitivity and resistance of isoniazid (INH) and ETA warrants further studies. We report a new mutation - EthAW21R - in Mycobacterium bovis Bacillus Calmette-Guérin that corresponds with co-resistance to both PRO and ETA, which to the best of our knowledge has not been reported before. Our findings suggest that mutation EthAW21R could be used as a marker site for testing PRO and ETA cross-resistance.

The thioamide, ethionamide (ETA), and its propyl-analog prothionamide (PRO) are interchangeably used in tuberculosis (TB) chemotherapy regimens to treat multidrug-resistant TB (MDR-TB),1–3 drug-susceptible TB meningitis (TBM), and miliary TB in some settings, due to their good cerebrospinal fluid (CSF) penetration ability.4

PRO is associated with better tolerance compared with ETA in the treatment of MDR-TB, and both are structurally similar to isoniazid (INH).2,5,6 The only notable distinction in their mechanism(s) of action is the lack of cross-resistance to INH.7,8

Both ETA and PRO are prodrugs whose enzymatic activation by Mycobacterium tuberculosis’ EthA inhibits InhA, which subsequently inhibits the M. tuberculosis’ mycolic acid synthesis (Figure 1).2,9 Mutations in the ethA gene often underlie ETA and PRO monoresistance.2 Hanoulle et al10 postulated that both are further transformed by EthA enzyme to a metabolite that accumulates intracellularly and acts as the final toxic compound. As illustrated in Figure 1,11 activated ETA and PRO form adducts with nicotinamide adenine dinucleotide (NAD), which is the inhibitor of the InhA enzyme in M. tuberculosis.1,12,13 Thee et al2 suggested that the correlation between mutations conferring ETA resistance and the MIC warrants further studies because of the subtle discrepancies between biochemical and genetic information on the modes of sensitivity and resistance in the cases of INH and ETA.

Figure 1

The mechanism of action for ETA.

Notes: ETA is activated by monooxygenase EthA to form a reactive species that binds to NAD+. The resulting ETH–NAD adduct inhibits the enoyl-ACP reductase InhA of the FASII system, resulting in mycolic acid biosynthesis inhibition. ©2014 American Society for Microbiology. Used with permission. No further reproduction or distribution is permitted without the prior written permission of American Society for Microbiology.11

Abbreviations: ETA, ethionamide; NAD, nicotinamide adenine dinucleotide.

Here, we report a new mutation – EthAW21R – in Mycobacterium bovis Bacillus Calmette-Guérin (BCG) that corresponds with co-resistance to PRO and ETA, which to the best of our knowledge has not been reported before.

We screened wild-type M. bovis BCG Tice on high PRO concentrations and obtained one drug-resistant colony at 30 µg/mL PRO-containing 7H11 plate. To confirm the phenotypic resistance of the single colony, we similarly retested it on 30 and 40 µg/mL PRO-containing 7H11 plate. We sequenced the six reported genes (ethR, ethA, inhA katG, ndh, and ahpC; Table 1; BGI, Shenzhen, China) associated with ETA and PRO resistance and found a single-nucleotide mutation in ethA gene leading to W21R mutation while the other five genes had no mutation(s).

Table 1

PCR and sequencing primers used to delineate target-based spontaneous genotypic resistance mechanisms of M. bovis BCG Tice

Resistance to	Primer pairs	Nucleotide sequences (5′–3′)	Upstream extension (base)	Downstream extension (base)	Product length (bp)
PRO	EthRf5/EthRr5	TTTTCCAGGATGGCGTAGC/CCGACCGGATCGTCAACA	185	263	1099
	EthAf/EthAr	CCTGGCAGCTTACTACGTGTC/CGGCATCATCGTCGTCTG	75	54	1599
	inhAf/inhAr	TCACGGCGGTAGAAGAGCA/CCACGCAGATGTCGCAAAGA	548	326	1684
	KatGf/KatGr	TGCGAAAGATCCAACCCTC/AGACCAACCGTGTAGGCAAAT	276	317	2816
	Ndhf/Ndhr	ACTTGGCTCCGCACGGCTAT/ATCCGGCGACGGCATTCA	217	109	1718
	ahpCf/ahpCr	CGACTGGCTCATATCGAGAAT/AATACCTGCGGATTTCGTGT	216	180	984
EthAf2	GGAATTCCATATGACCGAGCACCTCGACGTT
EthAr2	CCCAAGCTTCTAAACCCCCACCGGGGCA
hyg-f	GTGACACAAGAATCCCTG
hyg-r	TCAGGCGCCGGGGGCGGTG

Note: Primers for each gene amplification were extended with ~150 bp upstream and downstream of start and stop codons.

Abbreviations: M. bovis, Mycobacterium bovis; PRO, prothionamide.

We then overexpressed this mutated 1.4kb ethAW21R and the M. bovis ethAwt genes by cloning them at the NdeI and HindIII sites of extrachromosomal p60LuxN plasmid bearing the M. tuberculosis hsp60 promoter (Figure 2).14 Recombinant plasmids p60ethAW21R and p60ethAwt constructs were verified by enzyme digestion and sequencing (BGI). Wild-type M. bovis BCG Tice and M. tuberculosis H37Rv strains were transformed with the plasmids p60ethAW21R and p60ethAwt through electroporation as described previously with some modifications.15 Positive selection was confirmed by PCR amplification of the hygromycin resistance marker gene (hyg) in p60ethAW21R and p60ethAwt using primers hyg-r and hyg-f (Table 1).

Figure 2

E. coli–mycobacteria shuttle plasmids p60ethAMt/Wt.

Notes: OriE, origin of replication region in E. coli; OriM, origin of replication in mycobacteria; hyg, hygromycin-resistant gene; ethA, ethAwt or ethAW21R.

Abbreviation: E. coli, Escherichia coli.

We then evaluated the MICs of PRO and ETA against the recombinant and parental strains (control) using the classical agar plate method.16 We show that after overexpressing the mutated ethAW21R in wild-type BCG and M. tuberculosis H37Rv, both PRO and ETA MIC rose by 256- and 128-fold, respectively (Table 2). Additionally, no observable differences were noted in the MICs of the overexpressed ethAwt recombinants and the parent strains (MIC =0.25 and 0.5 µg/mL; Table 2). Our findings suggest that the mutation ethAW21R could be used as a marker site for testing PRO and ETA cross-resistance.

Table 2

MICs of PRO and ETA for wild-type and recombinant strains

Serial number	Strain	Mutations	MICs (µg/mL)
			PRO	ETA
1	M. tuberculosis H37Rv:p60ethAMt	W21R	32	32
2	M. tuberculosis H37Rv:p60ethAWt	–	0.25	0.25
3	M. tuberculosis H37Rv Wt	–	0.5	0.5
4	M. bovis BCG Tice BCG:p60ethAMt	W21R	32	32
5	M. bovis BCG Tice BCG:p60ethAWt	–	0.5	0.5
6	M. bovis BCG Tice Wt	–	0.25	0.25

Abbreviations: ETA, ethionamide; M. bovis, Mycobacterium bovis; M. tuberculosis, Mycobacterium tuberculosis; PRO, prothionamide.