Molecular assessment of accessory gene regulator (agr) quorum sensing system in biofilm forming Staphylococcus aureus and study of the effect of silver nanoparticles on agr system.

BACKGROUND AND OBJECTIVES: Staphylococcus aureus is an opportunistic human pathogen that causes a variety of diseases. Staphylococcal biofilms are a source of chronic and continual infections. This study was conducted to estimate the distribution of agr among different isolates of S. aureus and their relationship with biofilm. Also, it was aimed to check the association of operon agr with virulence factors (seb, eta, spa and tst v8) and study the effect of biosynthesis silver nanoparticles on the function of the agr system.
MATERIALS AND METHODS: Out of 580 clinical specimens, 100 S. aureus isolates were isolated and identified based on cultural, morphological, and different biochemical tests, in addition to molecular identification using PCR with specific primer 16SrRNA. For biofilm detection, the fungi synthesized silver nanoparticles were used to check its effect on agr system.
RESULTS: The biofilm producer among S. aureus was 61% and non-biofilm producer isolates were 39%. It was found that the total number of agr - bearing isolates was 31 (50.82%), with a significant difference in the distribution percentage of virulence factors genes in isolates of biofilm-forming S. aureus carried agr. The results also revealed a relationship between the agr-quorum sensing system and the prevalence of virulence genes in the isolated S. aureus. Silver nanoparticles (AgNPs) were synthesized by Agaricus compestris, and it was found that it activates the agr system in 31 (100%) of biofilm-forming and carrying operon agr after treatment with sub-MIC of AgNPs.
CONCLUSION: The findings of this study revealed that not all isolates of S. aureus have agr system. Also, it was found that AgNPs have a positive effect on bacterial virulence factors production and could be used for treatment or in cooperation with antibiotics to decrease resistance.

INTRODUCTION

Biofilms are sets of microorganisms in which cells affix to each other on a surface that is a polymeric mixture generally composed of proteins, extracellular DNA and polysaccharides (1). Staphylococcal biofilms are a source of chronic and continual infections (2). They are contributed to a wide variety of bacterial infections, such as gastrointestinal tract, dental plaque, urinary tract infections, and infections of permanent indwelling devices (3). The pathogenicity of S. aureus is a complex processor involving a diverse array of virulence factors that are expressed through different stages of infection by a web of virulence regulators (4). The sensing system upregulates different exoproteins related to host-cell damages and downregulates several genes encoding for cell-surface proteins engaged in colonization processes (5). The agr system consists of 2 divergently transcribed loci (3 kb) controlled by means of 2 promoters P2 and P3. Most of clinical isolates of acute infections have a functional agr system and all, like strains, produce RNAIII in vitro and in vivo (6). Agr deficiency has been related to increased biofilm formation because RNAIII reduces the expression of surface adhesins and increases the production of capsule, toxins, and proteases (7). The agr system is supposed to regulate over 70 genes, 23 of which are renowned virulence factors (8). There are 2 classes of virulence factors regulated by agr. The first class includes virulence factors implicated in attachment to the host and immune evasion, whereas the second class contains genes engaged in the production of exoproteins related to invasion and toxin production (9). The activation of the agr system switches the bacterium from an adhesive, colonizing commensal into an invasive and aggressive pathogen (7). Agr dysfunction in the agr locus causes changes in the expression of genes and has global effects on bacterial phenotypes including pathogenicity (10). Major virulence factors in S. aureus, exfoliative toxins (ETs), toxic shock syndrome toxin (TSST-1), and staphylococcal enterotoxins (SEs) are involved in host colonization, invasion of damaged skin and mucus, gastrointestinal infection, and prevarication of host defense mechanisms (11).

Among metal nanoparticles, AgNPs have a great importance because of their application in various fields as nanomedicines and antimicrobial agents (12). When considering the mechanism for the synthesis of silver nanoparticles, it was hypothesized that the reduction of silver ions was done by enzymes NADH-dependent nitrate reductase (13). Biologically synthesized nanoparticles method is preferred to be compared to chemical and physical approaches because these methods use toxic chemicals, and sometimes reactions occur at a very high temperature (14). However, biological methods for synthesis are eco-friendly, toxic free, and cost-effective in production of AgNPs.

The present study was conducted to estimate the distribution of agr among different isolates. The association of operon agr with virulence factors (seb, eta, spa and tst v8) was determined. Moreover, the effect of biosynthesis silver nanoparticles on the function of the agr system was studied.

MATERIALS AND METHODS

Bacterial isolates.

During December 2015 to April 2016, a total of 100 isolates of S. aureus were obtained from 580 patients in different hospitals in Erbil, Iraq. The included specimens were as follow: 120 specimens from urinary tract infections, 65 from nose infections, 127 from wound infections, 78 from burns, 85 from tonsillitis, 45 from vaginitis, and 60 specimens from ear infections. All isolates were identified based on cultural, morphological, and different biochemical tests, in addition to molecular identification using PCR with specific primer to amplify 16SrRNA.

DNA isolation.

Bacterial DNA was isolated using Presto Mini™ gDNA bacterial kit (Geneaid, Taiwan).

Molecular identification.

To confirm the identity of the isolated S. aureus, a PCR was applied using specific primer pairs of 16SrRNA gene, which was designed in this study using primers program on the NBCI website, which was supplied by Bioneer (Korea) as shownin Table 1. This primer amplifies a 1487bp region in 16SrRNA gene fragment of S. aureus. PCR reaction kit was supplied by AccuPower PCR PreMix (Bioneer, Korea). PCR reaction occurred in 20 μL: Primer 2 μL (10 Pmol/μL) of each was forward and reverse, 2 μL of DNA template, and 14 μL of ddH2O. PCR amplification was performed using thermal cycler (Eppendorf, Germany) as follows: initial denaturation for 5 min at 94°C, followed by 35 cycles of denaturation at 94°C for 1 min, annealing for 1min at 55°C, and extension for 1:30 min at 72°C, followed by single cycle of final extension for 7 min at 72°C. All PCR products were electro-phoresed in 1.5% agarose gel.

Table 1.

Primers sequences and their product size

Primer name	Primer sequences	Product size (bp)	Annealing temperature°C
16srRNAF	CCTGGCTCAGGATGAACG	1478	55
16srRNAR	AATCATTTGTCCCACCTTCG
agr F	ATGCACATGGTGCACATGCA	1242	57
agr R	CATAATCATGACGGAACTTG
seb F	ACCAGATGAGTTGCACAAAGCGA	342
seb R	TGCTCAGTTACACCACCATACA
spa F	ACCCAAGCCAAAGCGCTAACCT	516
spa R	TGTCAGCAGTAGTGCCGTTTGCT
V8 F	TCCACAACAAACGCAGTCAAGCA	654	58
V8 R	ACACCGCCCCAATGAATTCCGA
tst F	ACACAGATGGCAGCATCAGCCT	128
tst R	AGTTCCTTCGCTAGTATGTTGGCT
eta F	GAGCATGGTCGAAGATGTCGGC	262
eta R	TCCTGCGCCATTCGTTACACTCC

16srRNA gene: 16s ribosomal RNA, R: Reverse; F: Forward, agr: accessory gene regulator, eta: exfoliative toxin A, seb: staphylococcal enterotoxin b, tst: toxic shock syndrome toxin, V8: serine protease, spa: staphylococcal protein

Quantitative biofilm formation assay.

All isolates were tested for biofilm formation using the quantitative method of Microtitre plate method (MTP) (15), and isolates were classified according to biofilm production.

Molecular detection of agr and virulence factor genes.

The operon agr was detected in biofilm-forming S. aureus using monoplex PCR as mentioned in PCR amplification for 16SrRNA gene, with replacing primer for agr; and the same PCR program was applied with replacing annealing temperature at 57°C instead of 55°C. Virulence factors genes (seb, eta, spa, V8, tst) were detected using multiplex PCR. All designed primers for this study are demonstrated in Table 1.

Biosynthesis of silver nanoparticles from mushroom.

The fungus used in this study was obtained from local markets in Erbil, Iraq, and was classified as A. compestris in Education College/ Salahaddin University, Erbil. The A. compestris was washed with distilled water and then dried in shade at room temperature.

Five grams of dried A. compestris was powdered into fine particles using an electric grinder and suspended into 350 mL of sterile distilled water and heated for 10 minutes at 55°C. Then, it was filtered using Whatman’s filter paper No. 1 and stored at 4°C.

The prepared extract was used as a reducing agent for 1 mM of AgNO3 and for the synthesis of AgNPs as described (16).

Description of silver nanoparticles.

The preliminary indication for AgNPs production using fungus extract was confirmed by the color change from yellow to dark brown during 1 hour. Moreover, the analysis was performed to identify the absorption of optical spectra of UV-visible spectra, with a resolution of 2.0 nm and between 200 to 600 nm wavelength (16).

Examination of shape and size of the silver nanoparticles manufactured from the reduction of silver nitrate by the fungus extract was done by TEM.

Determining the minimum inhibitory concentration (MIC) of silver nanoparticles biosynthesis.

The MIC concentration of silver nanoparticles biosyn-thesis was determined using broth dilution method. Different AgNPs concentrations (0.5– 8% v/v) were prepared in 5 mL of Mueller-Hinton broth (Oxoid, England), and the tubes were inoculated with bacterial suspension (about 105 CFU/ml). Then, the tubes were incubated overnight at 37°C, and the MIC was at the lowest concentration of AgNPs, which inhibited visible bacterial growth after overnight incubation.

The effect of the silver nanoparticles on the function of the Agr system.

After determining the MIC of AgNPs, the effect of these particles on the function of the agr-quorum sensing system was studied for biofilm forming S. aureus (17), with some modification, the inoculate was obtained from the incubated tubes, which contained brain heart infusion broth with sub-MIC concentration of AgNPs plus bacteria. Then, it was cultured on the blood agar plate adjacent to bacterial isolate producing beta-hemolycin at the center of the dish (instead of beta-hemolysin disc) and incubated at 37°C for 24 hours.

Statistical analysis.

Statistical analysis was performed using chisquare test and the results were considered statistically significant at P< 0.05 level.

RESULTS

In this study, 100 (17.24%) S. aureus strains were isolated from different clinical sources including wound infections (31%), burns (12%), UTI (15%), tonsillitis (8%), vaginitis (3%), ear infections (13%), and nose infections (18%). All isolates of S. aureus were identified by conventional phenotypic tests. The results agreed 100% with the results of PCR amplification of 1478 bp fragment of the species-specific gene 16SrRNA gene.

Biofilm detection, agr gene, and virulence genes.

The results of MtP method revealed that 61% were biofilm producer and 39% were non-biofilm producer isolates. In addition, all biofilm-forming S. aureus were tested for agr gene using PCR (figure not shown). The results of the present study showed that the number of biofilm-forming S. aureus isolates was associated with the type of infection. Chisquare test showed a significant difference at a mean level of less than 0.05 for the distribution percentage of agr gene in S. aureus isolates, which was isolated from different diseases (Table 2). The percentage of distribution for agr gene among different infection cases was 16 (64.00%) for wound infection, followed by urinary tract infection, ear infection, burns, tonsillitis, and nose infection with percentage 5 (55.56%), 2 (50.00%), 4 (44.44%), 2 (40.00%) and 2 (28.57%), respectively. No isolate carried agr gene in vaginitis cases (0%). The total number of isolates bearing agr was 31 (50.82%).

Table 2.

Distribution of agr gene in biofilm forming S. aureus isolates in different sources of infections

Type of infections	No. of biofilm-forming S. aureus isolates	No. of biofilm-forming S. aureus isolates that carried agr gene	Percentage of biofilm-forming S. aureus isolates thatcarried agr gene
Wound infections	25	16	64.00%
Burns	9	4	44.44%
Urinary tract infections	9	5	55.56%
Tonsillitis	5	2	40.00%
Nose infection	7	2	28.57%
Vaginitis	2	0	0.00%
Ear infection	4	2	50.00%
Total number	61	31	50.82%
Chisquare			16.21*

Significance level was set at P< 0.05 level.

The results of some virulence genes (v8, tst, eta, spa, seb) in all isolates of biofilm-forming S. aureus, using the multiplex PCR, are presented in Table 3.

Table 3.

The prevalence of virulence genes among Staphylococcus aureus isolates

Type of isolation	No. (%) S. aureus isolates were carried tst	No. (%) S. aureus isolates were carried eta	No. (%)S. aureus isolates were carried seb	No. (%)S. aureus isolates were carried spa	No. (%)S. aureus isolates were carried v8	Chi-square
Isolates that carried agr operon (n=31)	5 (16.13%)	2 (6.45%)	10 (32.26%)	9 (29.03%)	27 (87.10%)	116.09**
Isolates that did not carry agr operon (n=30)	0 (0%)	0 (0%)	0 (0%)	0 (0%)	0 (0%)
Total No. 61 (100%)	5 (8.20%)	2 (3.28%)	10 (16.39%)	9 (14.75%)	27 (44.26%)	59.76 **

Significance level was set at P< 0.05 level.

The results of this study indicated a relationship between agr-quorum sensing system and prevalence of virulence genes in isolated S. aureus. The prevalence of virulence genes in agr- deficient isolates was 0 (0%), while the prevalence of virulence genes in S. aureus isolates that carried agr gene was 5 (16.13%) for tst gene and 2 (6.45) for eta gene. Moreover, the prevalence of v8, spa and seb was 10 (32.26%), 9 (29.03%) and 27 (87.10%), respectively, as presented in Table 3. The results of this study showed that the number of biofilm-forming S. aureus isolates was associated with the type of infection. Statistical analysis revealed a significant difference at a mean level of less than 0.05 for the distribution percentage of virulence factor genes in biofilm forming S. aureus isolates that carried agr operon. Furthermore, a significant difference was found for the distribution percentage of virulence factor gene in all biofilm forming S. aureus isolates at a mean level of less than 0.05.

Silver nanoparticles.

Silver nanoparticles were visually detected by a change in the color from yellow to dark brown in the reaction suspension, which contained the extract of dried A. compestris and silver nitrate (Fig. 1). However, the control did not change its initial color when incubated under the same conditions. The samples containing the synthesized silver nanoparticles showed a peak at 410 nm.

Fig. 1.

Fungi extract before AgNO3 and after addition of AgNO3

On the other hand, the characterization of size and shape of silver nanoparticles synthesized by A. compestris with transmission electron microscopy (TEM) revealed that the particles were spherical in shape and ranged from 10 to 14 nm (Fig. 2). Also, the MIC of silver nanoparticles was tested against all biofilm forming S. aureus isolates that carried agr operon, and the results showed that MIC ranged from 8 μg /mL to 64 μg/mL (Table 4).

Fig. 2.

TEM micrograph of AgNPs biosynthesized from Dry A. compestris

Table 4.

Minimum inhibition concentrations of AgNPs nanoparticles against biofilm forming S. aureus isolates that carried agr operon

MIC of AgNPs (μg/mL)	NO. (%) of isolates
8	6 (19.35%)
16	13 (41.94%)
32	10 (32.26%)
64	2 (6.45%)

The results indicated that 31 (100%) isolates had agr dysfunction, which was indicated by non-production of delta hemolysin. Also, this study examined the effect of AgNPs on the function of agr, and the results showed an activation of agr in 31 (100%) biofilm-forming S. aureus that carried operon agr after treatment with sub-MIC of AgNPs. Then, they were compared with the control treatment, and it was found that there was no change in the function of operon agr (Fig. 3).

Fig. 3.

The estimation of operon agr efficacy

DISCUSSION

In the present study, 100 (17.24%) isolates of S. aureus were obtained from different clinical specimens by applying phenotypical and biochemical tests, in addition to themolecular identification of PCR and species-specific 16SrRNA pairs. The MTP method was the most reliable quantitative detection technique in vitro that helped the clinicians to make a precise decision about the treatment of such infections. The results of this study showed that 61% of isolates were biofilm producer and 39% were non-biofilm producer isolates. These results were similar with those of a previous study (18) that indicated that 64.89% of S. aureus isolates were biofilm producers and 35.11% strains were non-biofilm producers. On the other hand, the results showed that the total number of agr gene in S. aureus isolates was 31 (50.82%). This result was close to results obtained by Mirani et al. while it was different from the results obtained by Momtaz et al. (19). This difference of obtained results may be due to differences of geographical location and source of isolation. The pathogenicity of S. aureus was attributed to the different virulence factors including a large number of cell-surface-bound proteins that were expressed during colonization of the host, and secreted proteins such as hemolysins, proteases, and lipases that were required for acute infections (20). The prevalence of virulence genes in 30 agr deficient isolates was 0 (0%). Also, the prevalence of virulence genes in 31 biofilm forming S. aureus that carried agr gene was 5 (16.13%) for tst gene and 2 (6.45) for eta gene, respectively, while it was 10 (32.26%), 9 (29.03%), and 27 (87.10%) for v8, spa and seb, respectively. Abd El-Hamid and Bendary, (21) found that S. aureus isolates carried agr (100%), eta (53.33%), tst (33.33%), and seb (0%) genes. The results of one study (22) were similar with those of the present study in the proportion of the V8 gene (51; 92.7%). However, the 2 studies were different in the proportion of spa, eta and tst genes, which was 55 (100%), 23 (42.0%) and 14 (25.4%), respectively, in the other study. The percentage of seb gene (13% vs. 23.6%) was lower in the current study, and the difference in the percentage of virulence genes in the 2 studies may be due to the differences in geographical areas, the source of isolation, and sample size.

Clinicians and researchers have been persuaded to find new alternative molecules to solute the resistant biofilms of pathogenic bacteria (23). Therefore, in this study, the effect of A. compestris as AgNPs nanoparticles producer against biofilm forming S. aureus isolates was studied. This method was an eco-friendly and cost-effective way of synthesis of silver nanoparticles under laboratory as well as room conditions. The preliminary confirmation of AgNPs from this mushroom species was the color change from yellow to dark brown. The color change was due to the excitation of free electrons present in AgNPs. The intensifies in to brown color after 24 hours (24). The exact mechanism is behind the conversion of AgNo3 to silver nanoparticles in mushroom extract are not known, but the extracellular enzymes might be responsible for the biosynthesis of nanoparticles (25). In other studies, the biosynthesis of AgNPs from Pleurotus florida and Microporus xanthopus was observed at the maximum absorbance peak of 435nm and 425nm, respectively (26).

TEM analysis is a reliable method, which is done on the morphology and size of the nanomaterials. In the present study, the results showed that the size of AgNPs production ranged from 10 nm to 14nm, and it was spherical in shape. The production of AgNPs from Pleurotus florida and Pleurotus sajorcajor ranged from 20 to 50 nm and 5 to 50nm, respectively (26). The MIC determination test showed the efficiency of these Ag nanoparticles against biofilm forming S. aureus isolates that carried operon agr. The mechanism of inhibition was unknown, but the possible hypothesis might be due to ionic binding of the AgNPs on the surface of the bacteria, causing an increase in the proton motive force, while the other hypothesis states that the nanoparticles enter into the cell and bind to the enzymes containing thiol groups (27).

Also, the agr activity was studied by streaking S. aureus isolate adjacent to beta-hemolysin isolate to facilitate the determination of agr activity. The results showed that 31 (100%) isolates had agr dysfunction, which was indicated by non-production of delta hemolysin. The present study examined the effect of AgNPs on the function of agr and the results showed the activation of agr in 31 (100%) of biofilm-forming S. aureus that carried operon agr after treatment with sub-MIC of AgNPs. Then, they were compared with the control treatment and it was found that there was no change in the function of operon agr. The phenotypic change in S. aureus during infection, from adhesiveness and colonizing to invasiveness and tissue-damaging, is in part coordinated by agr operon (1). Therefore, the coordinated regulation of agr operon expression is an important criterion for the pathogenic success of S. aureus (28). The inactivate agr was sometimes found in clinical isolates (2). In addition, agr dysfunction has been associated with persistent bacteremia in MRSA.

The final conclusion of this work is that agr gene not found in all S. aureus clinical isolate and the AgNPs have a good effect on agr operon system.