Literature DB >> 29915706

Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida).

Brent M Robicheau1,2, Emily E Chase1, Walter R Hoeh3, John L Harris4, Donald T Stewart1, Sophie Breton5.   

Abstract

Freshwater mussels (order: Unionida) represent one of the most critically imperilled groups of animals; consequently, there exists a need to establish a variety of molecular markers for population genetics and systematic studies in this group. Recently, two novel mitochondrial protein-coding genes were described in unionoids with doubly uniparental inheritance of mtDNA. These genes are the f-orf in female-transmitted mtDNA and the m-orf in male-transmitted mtDNA. In this study, whole F-type mitochondrial genome sequences of two morphologically similar Lampsilis spp. were compared to identify the most divergent protein-coding regions, including the f-orf gene, and evaluate its utility for population genetic and phylogeographic studies in the subfamily Ambleminae. We also tested whether the f-orf gene is phylogenetically informative at the species level. Our preliminary results indicated that the f-orf gene could represent a viable molecular marker for population- and species-level studies in freshwater mussels.

Entities:  

Keywords:  Bivalvia; DNA barcode; Doubly uniparental inheritance of mtDNA; Freshwater mussels; Mitochondrial DNA; Molecular markers; Unionida

Year:  2018        PMID: 29915706      PMCID: PMC6004104          DOI: 10.7717/peerj.5007

Source DB:  PubMed          Journal:  PeerJ        ISSN: 2167-8359            Impact factor:   2.984


Introduction

Freshwater mussels (Bivalvia: Unionida) occur globally, except in Antarctica, with more than 800 estimated species (Bogan & Roe, 2008). Despite high diversity, many species are critically imperilled (Regnier, Fontaine & Bouchet, 2009; Lopes-Lima et al., 2017). Approximately 70% of the ∼300 North American species are endangered at some level (Lopes-Lima et al., 2017). Freshwater mussels are well recognized for their water filtration capabilities, and for the production of obligate parasitic larvae that metamorphose on fish hosts (Regnier, Fontaine & Bouchet, 2009; Lopes-Lima et al., 2017). They also possess an unusual system of mitochondrial transmission called doubly uniparental inheritance (DUI), a characteristic shared with various other bivalves (Gusman et al., 2016). DUI is the only exception to the strictly maternal inheritance of mitochondrial DNA (mtDNA) in animals and is characterized by having two types of mtDNA in males (the male-transmitted or M-type mtDNA in germline cells and the female-transmitted or F-type mtDNA in soma), and usually one type (the F-type) in females (Breton et al., 2007). DNA divergence between M and F mtDNAs within a single male freshwater mussel can reach >40% (Doucet-Beaupré et al., 2010). Moreover, each sex-associated mtDNA contains a novel protein-coding gene in addition to the 13 typical genes involved in ATP production (m-orf in M-type and f-orf in F-type mtDNA; Breton et al., 2009; Breton, Stewart & Hoeh, 2010; Milani et al., 2013). These genes are among the fastest evolving mt genes in freshwater mussels (Breton et al., 2011a; Breton et al., 2011b; Mitchell et al., 2016). They also have hypothesized roles in the maintenance of DUI and sex determination in bivalves (Breton et al., 2011a; Breton et al., 2011b), with recent in silico analyses supporting such hypotheses (Mitchell et al., 2016). Molecular techniques are commonly used to study freshwater mussels (Mulvey et al., 1997; Krebs, 2004; Campbell et al., 2008) since shell morphology alone is often inadequate to define populations, species or subfamilies. Environmental conditions can affect shell developmental patterns and obfuscate taxonomic identification (Bogan & Roe, 2008). Recent divergence (and retention of ancestral morphological characteristics) and hybridization phenomena also make shell characters only partially efficient in discriminating certain populations or lineages (Hoeh et al., 1995; Cyr et al., 2007). For example, significant genetic differences have been discovered in Utterbackia populations with little to no apparent differences in shell morphology (Hoeh et al., 1995). Several studies have used both F- and M-type mtDNA sequences. For example, fragments of the 16S rRNA and cytochrome c oxidase subunit I (cox1) genes obtained with the universal primers 16Sar-5 and 16Sbr-3 (Palumbi et al., 1991) and HCO2198 and LCO1490 (Folmer et al., 1994), respectively (or with modified versions of the latter two (Walker et al., 2006)), have been used to answer systematic, phylogenetic (Krebs, 2004; Krebs et al., 2013; Doucet-Beaupré et al., 2012) and phylogeographical (Mioduchowska et al., 2016) questions about freshwater mussels. Since the M-type mt genomes typically evolve faster than their F-type counterpart in freshwater mussels (Krebs, 2004; Gusman et al., 2016), relatively older (i.e., species- or family-level) divergences may be tracked more accurately with analyses of the more slowly evolving F-type mtDNA, while analyses of relatively recent (e.g., population-level) divergences may be facilitated by analyses of the faster evolving M-type mtDNA. For example, only the faster evolving male form of the 16S rRNA gene provided strong evidence of geographical isolation among Pyganodon grandis populations from the southern region of the Lake Erie watershed (Ohio, USA) (Krebs, 2004). However, because the male mtDNA is restricted to the testes, this requires identification of males, and this is impossible with juvenile specimens or with larvae (glochidia). Moreover, the precarious situation of several freshwater mussel species sometimes require non-destructive sampling of animals (e.g., using mantle snips and thus with no access to the M-type mtDNA), which are then returned to the river bottom (Inoue et al., 2013). To explore species boundaries, evolutionary relationships and geographic distribution of freshwater mussel species, researchers also tried other protein-coding loci of the F-type mtDNA such as cytochrome c oxidase subunit II (cox2; Doucet-Beaupré et al., 2012) and NADH dehydrogenase subunit 1 (nad1; Campbell et al., 2005). For example, Campbell et al. (2005) used nad1 together with cox1 and 16S rRNA to study the phylogenetic diversity of the subfamily Ambleminae, but their data could not resolve all the tribes (Amblemini, Lampsilini, Pleurobemini, Quadrulini) as monophyletic assemblages. The same three gene fragments were also found to be poor at resolving recent relationships (intrageneric level) by other researchers (e.g., Sommer, 2007; McCartney et al., 2016). Recently, Wares (2014) used a straightforward approach and compared whole mitochondrial genome sequences of recently-diverged taxa to identify the most divergent protein-coding region and verify its utility for population genetics (see also Shearer & Coffroth, 2008) and systematic studies in scleractinian corals. Although its results suggested that this region alone (cytochrome b, cytb) was unlikely to improve researchers’ ability to separate coral taxa using DNA sequence-based methods, the proposed pipeline, i.e., to find the most divergent region and to analyze its divergence across available GenBank data, could certainly be adopted to find another useful F-type mitochondrial region for population genetics and systematic studies in freshwater mussels. Following Wares’ pipeline, we focused on Ambleminae, an important freshwater mussel subfamily with several species listed as threatened or endangered (IUCN, 2015), and searched for another useful region in the F-type mtDNA to explore phylogenetic diversity and phylogeographic or population genetic structure in this taxa. We compared F mt genomes between two putative species (i.e., two species that are difficult to tell apart morphologically), the Arkansas Fatmucket, Lampsilis powellii (I. Lea, 1852) and the Fatmucket, Lampsilis siliquoidea (Barnes, 1823) (Harris et al., 2004; Harris et al., 2010; Krebs et al., 2013), and identify highly divergent protein-coding regions such as the f-orf gene. We then analyzed sequence divergence in this region (and test whether it is phylogenetically informative) across available amblemine data as a first step to see if it could represent a viable molecular marker for population- and species-level studies in freshwater mussels.

Materials and Methods

Lampsilis mussels were collected from two major river drainages in the state of Arkansas: Ouachita River drainage - Ouachita River (Polk County = isolate H2610), and Red River drainage - Mountain Fork Little River (Polk County = isolate H2655). Specimens were obtained under permit, including Arkansas Game and Fish Commission Scientific Collection Permits Nos. 022220078 and 062220101, and Federal Fish and Wildlife Permit No. TE079883-2 issued to JL Harris. Samples were identified as Lampsilis siliquoidea or L. powellii according to Harris et al. (2004) and Harris et al. (2010), i.e., based on external shell morphology (color rays absent, pit rays present, nacre color matte yellow to tan = L. powellii; color rays present, pit rays absent, nacre color shiny yellow to tan = L. siliquoidea). Each individual was sexed through microscopic examination of gonad tissues. Total DNA was extracted from female mantles to obtain the female-transmitted mtDNA using a QIAGEN DNeasy animal kit following the manufacturer’s protocol. Complete mtDNAs were PCR amplified, according to the method of Breton et al. (2011b) using primers listed in Table 1. Purified products were sequenced using FLX sequencing (McGill University and Genome Quebec Innovation Centre).
Table 1

Primers pairs used in the amplification of the entire F genomes.

Mitotype Region (Amplicon size)Primer namePrimer sequence (5′ to 3′)
F genome
cox2 –rrnL(∼11 kb)*UNIOCOII.2aAmbl16SForcCAGTGGTATTGGAGGTATGAGTA CTGGGTTTGCGACCTCGATGTTGGCTTAGGGAAA
cox1 –rrnL(∼5.5 kb)*HCO-700y2bAmbl16SRevcTCAGGGTGACCAAAAAAYCA TTTCCCTAAGCCAACATCGAGGTCGCAAACCCAG

Notes.

For primer names: Ambl and *, Amblemine-specific primers.

From Curole & Kocher (2002).

From Walker et al. (2006).

See Breton et al. (2011b).

Notes. For primer names: Ambl and *, Amblemine-specific primers. From Curole & Kocher (2002). From Walker et al. (2006). See Breton et al. (2011b). Sequences were assembled with MacVector v10.0 (Rastogi, 1999), annotated using MITOS (Bernt et al., 2013), and compared to published freshwater mussel mtDNAs. Further assessment of tRNA genes used tRNAScan-SE v1.21 (Lowe & Eddy, 1997). MUSCLE (Edgar, 2004) was used within Geneious v10.0.9 (Kearse et al., 2012) to align complete mtDNAs. Nucleotide divergence K(JC) across F-to-F mt genomes was determined with DnaSP v5 (sliding-window = 500 bp; step size = 25 bp) (Librado & Rozas, 2009). DNA alignments of individual genes were produced via MUSCLE in MEGA7 (Kumar, Stecher & Tamura, 2016). MEGA7 was used to: determine p-distances and dN/dS values (dN = nonsynonymous substitutions/nonsynonymous sites; dS = synonymous substitutions/synonymous sites), calculate Z-tests, and generate trees. The best substitution model for each gene was chosen via a model selection test in MEGA7, alignments were manually trimmed to start/end positions without gaps, and Maximum-likelihood (ML) trees were generated with 500 bootstrap replicates (complete deletion was used to account for gaps in ML trees). Bayesian inference trees were produced via BEAST v2.4.6 (Drummond et al., 2012), using a Hasegawa-Kishino-Yano model for f-orf and a Tamura-Nei evolutionary model for cox1 (based on BEAST modeltest results), a Yule speciation process, and 80 million Markov chain Monte Carlos steps (sampling every 1000 steps). A 10% burn in was used and resulting trees were compiled into the highest probability topology using TreeAnnotator v1.4 (Rambaut & Drummond, 2002). Graphs were produced using ggplot2 within R Team (2015). Specimens used in our phylogenetic analyses and in analysis of f-orf and cox1 sequences variability are described in Table 2. Nomenclature followed Williams et al. (2017). Mitochondrial genomes were deposited in GenBank (accession nos. MF326971 and MF326973).
Table 2

Cox1 and f-orf sequences used in Ambleminae phylogenies and in analysis of f-orf and cox1 sequences variability.

Speciescox1f-orf
AccessionReferenceAccessionReference
Ellipsaria lineolata AY654994 Campbell et al. (2005) HM849378aBreton et al. (2011b)
GU085285aBoyer et al. (2011)
HM849071 Breton et al. (2011b)
Fusconaia flava DQ298537aBurdick & White (2007) HM849380 Breton et al. (2011b)
DQ298538 Burdick & White (2007) HM849381aBreton et al. (2011b)
EF033261 Chapman et al. (2008) HM849382 Breton et al. (2011b)
HM849073 Breton et al. (2011b)
Lampsilis ornata AF385112 Roe, Hartfield & Lydeard (2001) AY365193aSerb & Lydeard (2003)
AY365193aSerb & Lydeard (2003)
Lampsilis powellii HM849075aBreton et al. (2011b) MF326971aThis study
HM849384 Breton et al. (2011b)
Lampsilis siliquoidea HM849076 Breton et al. (2011b) MF326973*This study
HM849385 Breton et al. (2011b)
Lemiox rimosus AY655002aCampbell et al. (2005)
EF033256 Chapman et al. (2008)
HM849093 Breton et al. (2011b)
Megalonaias nervosa AY655007aBreton et al. (2011b) HM849404aBreton et al. (2011b)
Potamilus metnecktayi HM849099aBreton et al. (2011b) HM849405aBreton et al. (2011b)
HM849406 Breton et al. (2011b)
Quadrula quadrula FJ809750aBreton et al. (2009) FJ809750aBreton et al. (2009)
KX853888KX853982 Mathias et al. (2018)
Reginaia ebenus AY654999 Unpublished HM849379aBreton et al. (2011b)
HM849072 Breton et al. (2011b)
KF035133aInoue et al. (2013)
Cyclonaias houstonensis KT285649aPfeiffer et al. (2016) HM849440aBreton et al. (2011b)
HM849441 Breton et al. (2011b)
Cyclonaias tuberculata GU085284aBoyer et al. (2011) HM849376aBreton et al. (2011b)
HM849069, HM849070 Breton et al. (2011b) HM849377 Breton et al. (2011b)
Toxolasma lividum AF231756aBogan & Hoeh (2000) HM849451, HM849452, HM849453, HM849454, HM849455 Breton et al. (2011b)
JF326436 Campbell & Lydeard (2012) HM849456aBreton et al. (2011b)
Toxolasma sp. aff. paulum 1 HM849131aBreton et al. (2011b) HM849458 Breton et al. (2011b)
HM849133 Breton et al. (2011b) HM849459, HM849460, HM849461, HM849462, HM849463,Breton et al. (2011b)
HM849464aBreton et al. (2011b)
Toxolasma sp. aff. paulum 2 HM849129aBreton et al. (2011b) HM849465, HM849466, HM849467, HM849468, HM849469, HM849470, HM849471, HM849472, HM849473 Breton et al. (2011b)
HM849130 Breton et al. (2011b) HM849474aBreton et al. (2011b)
HM849132 Breton et al. (2011b) HM849475 Breton et al. (2011b)
Toxolasma pullus MF326970aThis study
Toxolasma texasiense AY655023aCampbell et al. (2005) HM849476 Breton et al. (2011b)
HM849477aBreton et al. (2011b)
Truncilla macrodon HM849165aBreton et al. (2011b) HM849478aBreton et al. (2011b)
KT285658 Pfeiffer et al. (2016)
Venustaconcha ellipsiformis EF033260aChapman et al. (2008) FJ809753 Breton et al. (2009)
HM849529aBreton et al. (2011b)
HM849530 Breton et al. (2011b)
Villosa iris HM849199aBreton et al. (2011b) HM849531 Breton et al. (2011b)
HM849200, HM849201 Breton et al. (2011b) HM849532aBreton et al. (2011b)
HM849533 Breton et al. (2011b)

Notes.

Cox1 sizes range from 339 to 1,541 bp. F-orf sizes range from 240 to 410 bp. Note that for trees sequences were trimmed to a common start and end position in alignments.

Sequences that were specifically used in Ambleminae phylogenies.

Notes. Cox1 sizes range from 339 to 1,541 bp. F-orf sizes range from 240 to 410 bp. Note that for trees sequences were trimmed to a common start and end position in alignments. Sequences that were specifically used in Ambleminae phylogenies.

Results

Mitochondrial genome sizes (F = 16,043 and 16,990 bp for L. powelli and L. siliquoidea, respectively), gene order and compositions are consistent with those of other freshwater mussels (Doucet-Beaupré et al., 2010). We detected one large, potentially species-specific indel: a 51 bp indel in the cox2/nad3 spacer region between the two F genomes. Individual gene p-distances and dN/dS ratios are given in Fig. 1. Our results show, consistent with the degree of nucleotide divergence across mt genes in F genomes (Fig. S1), that the f-orf gene is among the least conserved genes in F genomes (Fig. 1). Only atp8 has a higher dN/dS ratio (>0.4) than f-orf, although a Z-test for selection indicated that the probability of rejecting the null hypothesis of dN = dS (neutrality) for this gene was 0.092.
Figure 1

Nucleotide distances calculated for individual mitochondrial gene comparisons.

(A) dN/dS ratios/scores; (B) p-distance scores.

Nucleotide distances calculated for individual mitochondrial gene comparisons.

(A) dN/dS ratios/scores; (B) p-distance scores. Phylogenetic analyses focused on the f-orf gene because several f-orf sequences are available in GenBank compare to atp8. Three Bayesian phylogenetic trees were built for Ambleminae using: the f-orf gene (Fig. 2A), the standard animal mitochondrial cox1 DNA barcode (Hebert, Ratnasingham & De Waard, 2003; Fig. 2B), and both genes concatenated (Fig. 2C). Corresponding ML analyses are in Fig. S2. The f-orf sequences led to better bootstrap values than cox1. Moreover, members of Toxolasma were grouped as a single clade only in the f-orf containing trees. Similar results were obtained with ML analyses. BI and ML trees with the highest bootstrap values were obtained using both f-orf and cox1 together.
Figure 2

Bayesian inference (BI) trees produced in BEAUti and BEAST 2.4.6 for (A) f-orf, (B) cox1, and (C) concatenated f-orf and cox1 sequences also used in maximum likelihood trees of Fig. S2.

(A) was produced using a Hasegawa-Kishino-Yano model, (B) a Tamura-Nei model and (C) both these models of nucleotide substitution. Sequences used in BI trees refer to those listed and starred in Table 2.

Bayesian inference (BI) trees produced in BEAUti and BEAST 2.4.6 for (A) f-orf, (B) cox1, and (C) concatenated f-orf and cox1 sequences also used in maximum likelihood trees of Fig. S2.

(A) was produced using a Hasegawa-Kishino-Yano model, (B) a Tamura-Nei model and (C) both these models of nucleotide substitution. Sequences used in BI trees refer to those listed and starred in Table 2. We further examined Ambleminae f-orf variability, again using cox1 for comparison (Fig. 3). For the f-orf gene, intraspecific comparisons have lower variability and smaller p-distances (range = 0.000–0.011) versus cox1 (range = 0.000–0.031), and intrageneric comparisons for the f-orf gene have overall greater p-distances.
Figure 3

The distribution of pair-wise p-distance scores for f-orf and cox1 genes within Ambleminae.

The taxa compared are listed in Table 2. Intrageneric comparisons exclude intraspecific comparisons.

The distribution of pair-wise p-distance scores for f-orf and cox1 genes within Ambleminae.

The taxa compared are listed in Table 2. Intrageneric comparisons exclude intraspecific comparisons.

Discussion

Our research objective was to provide guidance towards the identification of another useful region in the F-type mtDNA to explore phylogenetic diversity and phylogeographic or population genetic structure in freshwater mussels. As pointed out by Wares (2014), finding gene regions that provide sufficient information, above and beyond the variation found within a population, might be challenging and we agree with him that it may be more optimal to first explore available genomic data (mitochondrial or whole mtDNA) rather than only use available primer regions or the same gene region that has proven useful in other animal species. In this study, we show that f-orf, and also atp8, have high divergence between morphologically similar members of Lampsilis. Although atp8 had the highest dN/dS ratios, the pattern was consistent with neutrality. This gene has historically been either missing and/or found to be the least conserved in bivalve mtDNAs (Breton, Stewart & Hoeh, 2010). Therefore, it is not surprising that it evolves in a different manner than all other mt genes. Based on divergence data, f-orf and atp8 could thus represent valuable molecular markers in the context of population genetic studies in Ambleminae. Such genes, and in particular f-orf, could also potentially help test the hypothetical involvement of mitochondria and their genomes in establishing reproductive barriers and speciation events (Gershoni, Templeton & Mishmar, 2009). The general research trend has shown the involvement of sex-linked genes in reproductive isolation (Qvarnström & Bailey, 2009), therefore, demonstrating the participation of F- and M-ORF proteins in sex determination, as predicted by Breton et al. (2011b), would particularly corroborate the potential of mitochondrial genetic speciation mechanisms. There were not enough atp8 sequences (or whole mitochondrial genome sequences) available in GenBank for Ambleminae to see if they could be more informative for population genetic or species delineation studies, however, enough f-orf sequences were available to achieve the brief goal of our study. At the species level, an optimal marker should have a fairly high level of sequence variability, but at the same time it should be sufficiently conserved to reduce phylogenetic noise. Analyses have suggested the systematic usefulness of the f-orf gene, while atp8 appears too noisy. We proceeded with phylogenetic analyses using f-orf compared to cox1 to evaluate the systematic utility of this gene. The f-orf BI phylogeny, like cox1, was able to distinguish L. siliquoidea from L. powellii with high bootstrap support. Overall, our data suggest that both genes are somewhat limited in fully resolving Ambleminae phylogenies on their own, which is illustrated by each tree having relatively low bootstrap values. However, in combination, f-orf+cox1 produced a phylogeny with higher bootstraps, indicating their value for systematic studies. We further determined p-distances in f-orf and cox1 for more sequences within the same lineages. These preliminary data suggest that at the population level, the f-orf gene displays relatively fewer nucleotide differences within species, while within genera, there are a relatively larger number of differences (compared to cox1). This point is exemplified by f-orfs typically having >20% sequence differences between species of the same genus (with the exception of the anomalous Toxolasma species pair that had a p-distance of <0.05).

Conclusion

This preliminary study indicates that the f-orf gene in freshwater mussels could represent a viable molecular marker for population- and species-level studies. This is based on: (1) the f-orf gene experiencing a high degree of relaxed purifying selection; (2) the f-orf gene, especially when used in combination with cox1 (and it remains to be seen whether it is the case with other genes), can be phylogenetically informative, and (3) our detection of generally low within-species variability for the f-orf, and relatively high between-species variability for most closely related taxa.

Sliding window analysis of nucleotide divergence between F-versus-F genomes

Analysis was conducted using a window size of 500 bp and 25 bp jumps. JC, Jukes Cantor correction. Light grey blocks represent protein-coding OXPHOS and ribosomal RNA gene regions, while the novel f-orf gene is highlighted dark grey. Dashed lines indicate the midpoint of genes. Click here for additional data file.

Maximum-likelihood Ambleminae trees for f-orf (A), cox1 (B), and concatenated f-orf +cox1 sequences (C)

Samples/sequences used are described in Table 2. Substitution models selected (Hasegawa-Kishino-Yano (HKY) +G for f-orf, Tamura-Nei (TN93) +G +I for cox1, and TN93 +G for f-orf +cox1) were based on running alignments through MEGA’s model selection analysis. The best models for individual gene alignments had the lowest BIC scores for each gene. The top most similar model between the two individual model tests was chosen as the best model for the concatenated gene tree (again based on lowest BIC scores). Bootstrap percentage values based on 500 replicates are shown to the left of nodes. Click here for additional data file.

Mitochondrial genome sequences

Lampsilis spp. F and M mtDNAs. Click here for additional data file.
  33 in total

1.  Novel protein genes in animal mtDNA: a new sex determination system in freshwater mussels (Bivalvia: Unionoida)?

Authors:  Sophie Breton; Donald T Stewart; Sally Shepardson; Richard J Trdan; Arthur E Bogan; Eric G Chapman; Andrew J Ruminas; Helen Piontkivska; Walter R Hoeh
Journal:  Mol Biol Evol       Date:  2010-12-20       Impact factor: 16.240

Review 2.  Mitochondrial bioenergetics as a major motive force of speciation.

Authors:  Moran Gershoni; Alan R Templeton; Dan Mishmar
Journal:  Bioessays       Date:  2009-06       Impact factor: 4.345

3.  tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence.

Authors:  T M Lowe; S R Eddy
Journal:  Nucleic Acids Res       Date:  1997-03-01       Impact factor: 16.971

4.  Ancient sex-specific extension of the cytochrome c oxidase II gene in bivalves and the fidelity of doubly-uniparental inheritance.

Authors:  Jason P Curole; Thomas D Kocher
Journal:  Mol Biol Evol       Date:  2002-08       Impact factor: 16.240

5.  Combining paternally and maternally inherited mitochondrial DNA for analysis of population structure in mussels.

Authors:  Robert A Krebs
Journal:  Mol Ecol       Date:  2004-06       Impact factor: 6.185

6.  MITOS: improved de novo metazoan mitochondrial genome annotation.

Authors:  Matthias Bernt; Alexander Donath; Frank Jühling; Fabian Externbrink; Catherine Florentz; Guido Fritzsch; Joern Pütz; Martin Middendorf; Peter F Stadler
Journal:  Mol Phylogenet Evol       Date:  2012-09-07       Impact factor: 4.286

7.  DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

Authors:  O Folmer; M Black; W Hoeh; R Lutz; R Vrijenhoek
Journal:  Mol Mar Biol Biotechnol       Date:  1994-10

8.  Evidence for a fourteenth mtDNA-encoded protein in the female-transmitted mtDNA of marine Mussels (Bivalvia: Mytilidae).

Authors:  Sophie Breton; Fabrizio Ghiselli; Marco Passamonti; Liliana Milani; Donald T Stewart; Walter R Hoeh
Journal:  PLoS One       Date:  2011-04-27       Impact factor: 3.240

9.  Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.

Authors:  Matthew Kearse; Richard Moir; Amy Wilson; Steven Stones-Havas; Matthew Cheung; Shane Sturrock; Simon Buxton; Alex Cooper; Sidney Markowitz; Chris Duran; Tobias Thierer; Bruce Ashton; Peter Meintjes; Alexei Drummond
Journal:  Bioinformatics       Date:  2012-04-27       Impact factor: 6.937

10.  Phylogenetic and morphometric analyses reveal ecophenotypic plasticity in freshwater mussels Obovaria jacksoniana and Villosa arkansasensis (Bivalvia: Unionidae).

Authors:  Kentaro Inoue; David M Hayes; John L Harris; Alan D Christian
Journal:  Ecol Evol       Date:  2013-07-03       Impact factor: 2.912

View more
  1 in total

1.  Did doubly uniparental inheritance (DUI) of mtDNA originate as a cytoplasmic male sterility (CMS) system?

Authors:  Sophie Breton; Donald T Stewart; Julie Brémaud; Justin C Havird; Chase H Smith; Walter R Hoeh
Journal:  Bioessays       Date:  2022-02-16       Impact factor: 4.653

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.