| Literature DB >> 2991567 |
Abstract
Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.Entities:
Mesh:
Substances:
Year: 1985 PMID: 2991567 PMCID: PMC254951
Source DB: PubMed Journal: J Virol ISSN: 0022-538X Impact factor: 5.103