Expression of immune genes RIG-I and Mx in mallard ducks infected with low pathogenic avian influenza (LPAI): A dataset.

This article provides data on primer sequences used to amplify the innate immune genes RIG-I and Mx and a set of normalizing reference genes in mallards (Anas platyrhynchos), and shows which reference genes are stable, per tissue, for our experimental settings. Data on the expressional changes of these two genes over a time-course of infection with low pathogenic avian influenza virus (LPAI) are provided. Individual-level data are also presented, including LPAI infection load, and per tissue gene expression of RIG-I and Mx. Gene expression in two outlier individuals is explored in more depth.

Specifications table

Value of the data

Avian influenza virus (AIV) infection of mallards was achieved via a semi-natural, contact infection route to mimic natural transmission of the virus.

Infection with low pathogenic AIV provides a contrast to most previous studies that used highly pathogenic AIV to study immune gene expression in mallards.

A set of reference genes that had been experimentally validated as stable under the given experimental treatment were used to stabilize RT-qPCR.

A table summarizing the methodology and findings of previous studies of Mx and/or RIG-I expression in AIV infected ducks is provided.

Data

The dataset provided here provides additional information for Helin et al. [1]. In that paper, we show that the innate immune genes retinoic acid-inducible gene-I (RIG-I) and myxovirus resistance gene (Mx) are rapidly yet transiently upregulated after infection with low pathogenic avian influenza virus (LPAI) subtype H1N1. Helin et al. aims to provide a series of methodological improvements over previous analyses of immune gene expression in ducks infected with avian influenza virus (AIV).

Table 1 shows that most previous studies have used highly pathogenic avian influenza virus (HPAI), which is rarely detected in wild mallards [2], [3]. Additionally, infection in previous studies was achieved via artificial inoculation comprising potentially unnatural viral doses and infection routes. These previous studies have almost exclusively been conducted on domestic Pekin ducks, rather than the main wildlife reservoir for avian influenza, mallard ducks (Anas platrhynchos). Lastly, most previous studies have used a single, non-validated reference gene (often GAPDH) for normalizing gene expression data. This approach leads to potentially misleading interpretation of data [4].

Table 1

Previous studies of RIG-I and Mx gene expression in mallard and Pekin ducks infected with AIV. Only studies using quantitative real-time PCR to assess patterns of gene expression are included. Only results significantly different from controls are listed, and all fold-changes represent upregulation compared to controls (no study found down-regulation of either gene at any time point). EID50 is 50% egg infectious dose, MOI is multiplicity of infection, PFU is plaque forming units, RGs is reference genes, dpi is days post infection, hpi is hours post infection, N indivs is number of individuals per time point, wk is week.

Innate Gene	LPAI/HPAI	Strain	Viral dose	Innoculation Method	Tissues analysed	RG	Time points	N. indivs	Breed	Resulte	Refs.
RIG-I	HPAI	H5N1	106 of EID50	Dripped into nares, eyes & trachea	Lung, intestine	GAPDH	1, 3 dpi	3	Pekin	Lung: ~200-fold at 1dpi, ~20-fold at 3 dpi	[6]
										Intestine: ~5-fold at 1dpi, ~2.5-fold at 3 dpi
RIG-I	LPAI	H5N2	106 of EID50	Dripped into nares, eyes & trachea	Lung, intestine	GAPDH	1, 3 dpi	2-3	Pekin	No significant changes	[6]
RIG-I	HPAI	H5N1	105 of EID50	Intranasal	Spleen	β-actinb	2 dpi	4	Pekin	13-fold	[7]
RIG-I	LPAI	H7N1	2 × 105 of EID50	Dripped intranasally & intratracheally	Lung, bursa, ileum	18Sc	0.8, 2, 4, 7, 14 dpi	6	Pekin	~7-17-fold at 0.8 dpi in all 3 tissues	[8]
RIG-I	HPAI	H7N1	2 × 105 of EID50	Dripped intranasally & intratracheally	Lung, brain, spleen	18S	0.3, 1, 2, 3, 4, 5, 7 dpi	6	Pekin	Spleen: ~10-fold at 1&2 dpi, 2-4-fold at 3&4 dpi	[9]
										Brain: ~1.8-fold at 2 dpi
										Lung: ~6-8-fold at 1,2&3 dpi, ~2-fold at 4 dpi
RIG-I	HPAI	H5N1a	105 of EID50	Intranasal	Spleen, lung	β-actin	2 dpi	4	Pekin	Spleen: ~65-fold in 5wk old ducks, ~4-fold in 2wk old ducks	[10]
										Lung: ~7-fold in 5wk old ducks, ~2.5-fold in 2wk old ducks
Mx	LPAI	recombinant	0.1 MOI	Cells & virus mixed together	Embryo fibroblast cells	GAPDH	2, 4, 8, 12, 24 hpi	NA	Pekin	~500-1000-fold at 8-24 hpi	[11]
Mx	HPAI	H5N1	1.0 MOI	Cells & virus mixed together	Peripheral blood mononuclear cells	GAPDH	4, 8, 12, 24, 36, 48 hpi	NA	Mallard	25-40-fold at 8-24 hpi	[12]
Mx	LPAI	H1N1	0.1 MOI	Cells & virus mixed together	Primary lung cells	GAPDH	12, 24, 48 hpi	NA	Pekin	No significant changes	[13]
Mx	LPAI	H5N9	0.1 MOI	Cells & virus mixed together	Primary lung cells	GAPDH	12, 24, 48 hpi	NA	Pekin	~5-fold at 12 hpi, 12-fold at 24 hpi, ~8-fold at 48 hpi	[13]
Mx	LPAI	H7N1	107 PFU	Intrachoanal cleft & oral	Illeum	GAPDH	1, 6 dpi	6-7	Pekin	Upregulation at 1 & 6 dpif	[14]
Mx	LPAI	H7N1	107 PFU	Intrachoanal cleft & oral	Illeum	GAPDH	1, 6 dpi	3d	Pekin	Upregulation at 1 & 6 dpi f	[15]

Three strains, derived from chicken, egret and duck.

Authors state β-actin was stable between uninfected and infected, but no details given and no other RGs investigated.

Authors state that 18S had the most stable expression over time and between tissues in ducks, but data is not shown and no indication of which RGs were compared.

Five control individuals.

Many results were inferred from graphs because exact results were not listed. In such cases, ~ is used to indicate fold changes are approximate.

Results not expressed as fold-change. Significant upregulation with one of the two tested viruses only.

Experimental design, materials and methods

To address these methodological issues, in Helin et al. [1] we use a semi-natural infection regime to infect mallards with low pathogenic H1N1 AIV. We then use a set of reference genes (Table 2, Table 3), that we have previously demonstrated to be stable under these experimental settings [5], to normalize RT-qPCR data. A full description of the experimental design, materials and methods is provided in Helin et al. [1].

Table 2

Reference genes used for each tissue type, and the number of samples available per time point per tissue.

Tissue	RGs	Number of samples/time point
		0 dpi	0.5 dpi	1 dpi	2 dpi	4 dpi	7dpi
Blood	RPS13, UBE20, RPL4	5	5	5	5	5	5
Spleen	RPS13, SDHA, GAPDH	5	5	5	5	5	5
GI1	RPS13, RPL4	4	4	4	4	5	4
GI2	RPL4, RPL30	4	3	4	5	5	4
Colon	RPL4, SDHA	5	4	3	4	5	3

Table 3

Primers used in [1]. F denotes the forward primer and R the reverse primer. Annealing temperature (Ta) expressed in °C and length in base pairs (bp).

Gene Symbol	Gene Name		Primers	Ta	Length
RIG-I	Retinoic acid-inducible gene-I	F	GTGTATGGAGGAAAACCCTATTCTTAACT	59	95
		R	GGAGGGGTGATACCTGTTGTTTGAT
Mx	Myxovirus resistance	F	TTCATGACTTCGGCGACAAC	59	128
		R	AACTCGGCCACTGAGGTAAT
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	F	GGTTGTCTCCTGCGACTTCA	60	164
		R	TCCTTGGATGCCATGTGGAC
RPL4	Ribosomal protein L4	F	CCTGGGCCTTAGCTGTAACC	60	115
		R	AAGCTGAACCCATACGCCAA
RPL30	Ribosomal protein L30	F	CTCAATGTTGTTGCCGCTGT	60	119
		R	GCAAAGCCAAGCTGGTCATC
RPS13	Ribosomal protein S13	F	AAGAAAGGCCTGACTCCCTC	59	82
		R	TGCCAGTAACAAAGCGAACC
SDHA	Succinate dehydrogenase complex, subunit A	F	GACACAGTGAAAGGCTCCGA	60	90
		R	CTCCAGCTCTATCACGGCAG
UBE20	Ubiquitin-conjugating enzyme E2O	F	AGCATCCCCCTTTCCATCAA	59	91
		R	CAACCCTGTCTCCTGGCTTA

Datasets describing the fold-change in expression between experimental time-points, and per individual, for each tissue type and gene are provided as Supplementary tables S1–4 and Figs. S1–S4 to this article. Fig. S5 provides a more in-depth analysis of two individuals with extremely high expression, showing that this over-expression was restricted to a specific tissue and a single gene at single time-point.

Subject area	Biology
More specific subject area	Immunology
Type of data	Table, graph, figure
How data was acquired	Mallards were infected with low pathogenic AIV, and sacrificed over a time-course. RNA was extracted from harvested tissues and gene expression of immune genes and reference genes was analyzed via RT-qPCR on a LightCycler 480 (Roche). Data analysis was performed using qBase+ and GraphPad Prism.
Data format	Analyzed
Experimental factors	Ducks were infected with an H1N1 virus. Extracted RNA was treated with DNase.
Experimental features	Infection of mallards was achieved via a semi-natural, contact infection regime. qPCR results were normalized using a panel of reference genes shown to be stable for the experimental conditions under consideration.
Data source location	Infections were performed at the Swedish Veterinary Institute, Uppsala, Sweden. Molecular lab work was conducted at Linnaeus University, Kalmar, Sweden.
Data accessibility	Data are provided with this article