Despite advances in surgery and chemotherapy, the prognosis of patients with hepatocellular carcinoma (HCC) remains poor. In the present study, the role of S100A1 in the progression of HCC was investigated. Immunohistochemical staining was used to measure the expression of S100A1 in HCC tissues. S100A1 was knocked down by siRNA. A battery of experiments was used to evaluate the biology functions of S100A1. It was found that S100A1 was upregulated in HCC tissues, and its upregulation was associated with a large tumor size, low differentiation and shorter survival time. The biological experiments demonstrated that S100A1 functions as an oncogene in HCC. It was also found that S100A1 knockdown enhanced the inhibitory effects of cisplatin on HCC cells. The results showed that the downregulation of S100A1 induced the phosphorylation of yes‑associated protein (YAP), and treatment with CHX demonstrated that the downregulation of S100A1 accelerated YAP protein degradation. The downregulation of S100A1 did not alter the expression of mammalian sterile 20‑like kinase (MST)1/2 or phosphorylated MST1/2, but upregulated the phosphorylation of large tumor suppressor kinase 1 (LATS1). It was further confirmed that S100A1 interacted with LATS1. LATS1 depletion significantly reduced the effects of S100A1 on cell growth rate and apoptosis, and there was a positive correlation between phosphorylated LATS1 and S100A1 in clinical samples, indicating that LATS1 was responsible for the S100A1-induced changes in cancer cell growth and Hippo signaling. In conclusion, the results of the present study indicated that S100A1 functions as an oncogene and may be a biomarker for the prognosis of patients with HCC. S100A1 exerted its oncogenic function by interacting with LATS1 and activating YAP. S100A1 may serve as a target for novel therapies in HCC.
Despite advances in surgery and chemotherapy, the prognosis of patients with hepatocellular carcinoma (HCC) remains poor. In the present study, the role of S100A1 in the progression of HCC was investigated. Immunohistochemical staining was used to measure the expression of S100A1 in HCC tissues. S100A1 was knocked down by siRNA. A battery of experiments was used to evaluate the biology functions of S100A1. It was found that S100A1 was upregulated in HCC tissues, and its upregulation was associated with a large tumor size, low differentiation and shorter survival time. The biological experiments demonstrated that S100A1 functions as an oncogene in HCC. It was also found that S100A1 knockdown enhanced the inhibitory effects of cisplatin on HCC cells. The results showed that the downregulation of S100A1 induced the phosphorylation of yes‑associated protein (YAP), and treatment with CHX demonstrated that the downregulation of S100A1 accelerated YAP protein degradation. The downregulation of S100A1 did not alter the expression of mammalian sterile 20‑like kinase (MST)1/2 or phosphorylated MST1/2, but upregulated the phosphorylation of large tumor suppressor kinase 1 (LATS1). It was further confirmed that S100A1 interacted with LATS1. LATS1 depletion significantly reduced the effects of S100A1 on cell growth rate and apoptosis, and there was a positive correlation between phosphorylated LATS1 and S100A1 in clinical samples, indicating that LATS1 was responsible for the S100A1-induced changes in cancer cell growth and Hippo signaling. In conclusion, the results of the present study indicated that S100A1 functions as an oncogene and may be a biomarker for the prognosis of patients with HCC. S100A1 exerted its oncogenic function by interacting with LATS1 and activating YAP. S100A1 may serve as a target for novel therapies in HCC.
Hepatocellular carcinoma (HCC) has become the leading cause of cancer-associated mortality worldwide, particularly in China (1). Despite advances in surgery and chemotherapy, the prognosis of patients with HCC remains poor (2). There is substantial interest in obtaining an improved understanding of the potential molecular targets associated with HCC.The Hippo signaling pathway is a conserved kinase cascade in mammals and controls tissue homeostasis. Yes-associated protein (YAP) is the downstream effector of this pathway (3). Activation of the Hippo signaling pathway is a common phenomenon in the progression of HCC (4). YAP is expressed at high levels in HCC specimens and serves as an independent prognostic marker for disease-free survival and overall survival rates in patients with HCC (5). Inhibition of the activity of YAP may offer a novel therapeutic approach for patients with HCC.S100A1 is an important member of the S100 family of Ca(2+)-binding proteins (6). Upregulation of the expression of S100A4 has been associated with the progression of various tumors (7,8). The expression of S100A1 increased with increasing Silverberg grade in serous tumors and is associated with decreased relapse-free survival (9). S100A1 also enhances the ovarian cancer cell proliferation and migration (10). However, the mechanisms underlying the role of S100A1 in HCC remain to be fully elucidated.In the present study, it was demonstrated that S100A1 protein was upregulated in human HCC, and was associated with tumor size, differentiation and tumor-node-metastasis (TNM) stage in patients with HCC. A high expression of S100A1 was found to be an independent prognostic factor for poor outcome in patients with HCC. Its biological effects and the potential molecular mechanism were also investigated in HCC cell lines.
Materials and methods
Study population
A total of 104 HCC tissues and matched adjacent tissues were collected from The Third Xiang-Ya Hospital of Central South University (Changsha, China) between October 2008 and October 2015. The information of the patients was obtained from their medical records. The present study was approved by the Ethics Committee of the Third Xiangya Hospital of Central South University. Writ ten inform consent was obtained from all participants involved in the study.
Cell culture
The HL7702human normal hepatocyte cell line and the MHCC97-H, HCCLM3, Hep3B, SMMC-7721 and Huh7human HCC cell lines were obtained from the Chinese Academy of Medical Sciences (Beijing, China). The cells were cultured with Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and maintained in a humidified atmosphere of 5% CO2 in air at 37°C.
Antibodies
The following antibodies were used in the present study: GAPDH (cat. no. sc-293335) from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA); S100A1 (cat. no. #5066), P-glycoprotein (p-gp) (cat. no. 13342), multidrug-resistant (MDR) (cat. no. # 13978S), multidrug resistance-associated protein (MRP) (cat. no. 14685), mammalian sterile 20-like kinase (MST)1/2 (cat. no. 14946), phosphorylated (p-)MST1/2 (cat. no. #3681), large tumor suppressor kinase 1 (LATS1) (cat. no. 3477), p-LATS1 (cat. no. 9157), p-YAP (cat. no. 13008) and YAP (cat. no. 15028) from Cell Signaling Technology, Inc. (Danvers, MA, USA); and Lamin B1 (cat. no. ab133741), B-cell lymphoma 2 (Bcl-2) (cat. no. ab32124), Bcl-2-associated X protein (Bax) (cat. no. ab32503) and Bcl-2 antagonist/killer (Bak) (cat. no. ab32371) from Abcam (Cambridge, UK).
Cell treatment
The lentiviruses containing S100A1 small interfering (si)RNA (siRNA sequences: CCGGGTTGAGCAGACAGCCACATTGCTCGAGCAATGTGGCTGTCTGCTCAAC) or LATS1 siRNA (siRNA sequences: CCGGTAGTCAATTCTTGGTACTTAACTCGAGTTAAGTACCAAGAATTGACTA) and empty control were purchased from Genepharma Company (Beijing, China). The Hep3B and SMMC-7721 cells were transfected with these lentiviruses using Lip3000 (Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocol.To investigate the effect of S100A1 on drug sensitivity, the cells were treated with cisplatin (DDP, 1 μg/ml) for 48 h or the indicated time points (0, 24, 48 and 72 h) at 37°C. To assess the half-life of S100A1, the cells were treated with protein synthesis inhibitor cycloheximide (CHX; 10 μg/ml) for 0, 2, 4 or 6 h at 37°C.
Immunohistochemical staining
The paraffin-embedded tissue sections were serially cut at 4-μm. Slides were regularly deparaffinized and dehydrated, and retrieval was performed with citric acid buffer (pH 6.0) in a microwave oven. Following cooling, the sections were blocked in normal goat serum (cat. no. AR0009, Boster, Wuhan, China), and incubated with primary anti-S100A1 (1:200), or anti-p-LATS1 (1:100) antibody overnight at 4°C. The sections were then washed with PBS and incubated with secondary antibody (cat. no. BA1050 and BA1054, dilution, 1:3,000; Boster) for 2 h at 37°C. The sections were then washed with PBS and stained using a DAB detection kit (Maxim Biological Technology, Xiamen, China). Finally, the sections were counterstained with hematoxylin. Images were captured using a microscope (Eclipse Ni-E/Ni-U, Nikon Corp., Tokyo, Japan). The integral optical density (IOD) of positive signaling was obtained using ImageJ software (version 1.8.0_112, National Institutes of Health, Bethesda, MD, USA). The tumor samples with an IOD higher than the mean were regarded to have a high expression of S100A1.
Total RNA was extracted from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The expression levels of S100A1, Bcl-2, Bax, Bak, p-gp, MDR and MRP was measured using a SYBR-Green qPCR assay (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer’s protocol. The expression of β-actin was used as an endogenous control. The primer sequences are listed in Table I. The qPCR procedure [SYBR Premix (2X) 10 μl, PCR forward primer (10 μM), 0.8 μl, PCR reverse primer (10 μM), 0.8 μl, ROX reference dye (50X), 0.4 μl, cDNA, 2 μl, sterile purified water 6 μl, total volume of 20 μl] was performed under the following conditions: 95.0°C for 3 min, and 39 cycles of 95.0°C for 10 sec and 60°C for 30 sec. Data were processed using the 2-ΔΔCq method (11).
Table I
Primer sequences used in reverse transcription-quantitative polymerase chain reaction analysis.
The cells in the indicated treatment groups were plated in 96-well plates at a density of 3,000 cells in 100 μl medium per well 24 h prior to the experiment. The cell viability was assessed using a CKK-8 assay (Beyotime Institute of Biotechnology, Haimen, China) at the indicated time points according to the manufacturer’s protocol.
Flow cytometry for analysis of apoptosis
Staining was performed using an Annexin V-FITC kit (KeyGen BioTech Co., Ltd., Nanjing, China) following the manufacturer’s protocol. Briefly, 2×105 Hep3B and SMMC-7721 cells were harvested by centrifugation at 1,000 g for 5 min at room temperature and resuspended in 100 μl binding buffer. The cells were incubated with 5 μl Annexin V-FITC for 15 min in the dark at 37°C and then incubated with 10 μl PI with gentle shaking for 10 min. Flow cytometric analysis (BD Biosciences, Franklin Lakes, NJ, USA) was employed for detecting apoptotic events.
Western blot analysis and immunoprecipitation
Total protein was extracted from cells using cold RIPA buffer, and the nuclear protein was extracted using an EpiQuik nuclear extraction kit (EpiGentek, Farmingdale, NY, USA) following the manufacturer’s protocol. The protein concentration was determined using the BCA Protein assay kit (cat. no. AR0197, Boster). A total of 60 μg protein was separated by 10% SDS-PAGE, which was then transferred onto a PVDF membrane (Thermo Fisher Scientific, Inc.). Subsequently, the membrane was incubated in PBS with 5% non-fat dried milk (Mengniu Dairy, Hohhot, China) for 3 h at 4°C. The membrane was then incubated with primary antibodies (GAPDH, dilution, 1:3,000; Lamin B1, dilution, 1:2,000; S100A1, dilution, 1:1,000; p-gp, dilution, 1:1,000; MDR, dilution, 1:1,000; MRP, dilution, 1:1,000; MST1/2, dilution, 1:1,000; p-MST1/2, dilution, 1:1,000; LATS1, dilution, 1:1,000; p-LATS1, dilution, 1:1,000; p-YAP, dilution, 1:1,000; YAP, dilution, 1:1,000; Bcl-2, dilution, 1:1,000; Bax, dilution, 1:1,000; Bak, dilution, 1:1,000) overnight at 4°C, followed by incubation with appropriate secondary antibody [goat anti-rabbit IgG (HRP), cat. no. ab6721, dilution, 1:3,000; or goat anti-mouse IgG (HRP), cat. no. ab205719, dilution, 1:3,000; both from Abcam] for 1 h at 37°C. The immune complexes were detected using an ECL Western Blotting kit (EMD Millipore, Billerica, MA, USA). The relative protein expression was analyzed using Image-Pro plus software 6.0 (Media Cybernetics, Inc., Rockville, MD, USA), and GAPDH was used as the internal reference.For immunoprecipitation, magnetic beads (Bio-Rad SureBeads; Bio-Rad Laboratories, Inc., Hercules, CA, USA) were incubated with antibodies (S100A1, 10 μg/ml; LATS1, 10 μg/ml) for 3 h at 4°C. The bead-antibody complex was then incubated with target protein (S100A1, 10 μg/ml; LATS1, 10 μg/ml) overnight at 4°C. The beads were magnetized using the SureBeads magnetic rack and supernatant was discarded. The elution buffer was then used for western blot analysis.
Luciferase reporter assay
For detecting the change of Hippo signaling and YAP transcription activity, a luciferase assay was performed according to the manufacturer’s protocol (Dual-Luciferase Assay kit, Promega Corporation, Madison, WI, USA). The Hep3B and SMMC-7721 cells were plated in 96-well clusters, and then cotransfected with the luciferase reporter plasmid with 100 ng pGL3-basic vector (NC) or pGL3-S100A1 siRNA. At 48 h post-transfection, luciferase activity was detected using a dual-luciferase reporter assay system and normalized to Renilla activity.
Statistical analysis
In the present study, all experiments were repeated at least three times, and data are expressed as the mean ± standard error of the mean. The SPSS 18.0 software package (SPSS, Inc., Chicago, IL, USA) was used to perform statistical analysis. Differences between two groups were compared using an independent-samples t-test. Differences among three or more groups were compared using one-way analysis of variance with the Bonferroni post hoc test. The clinical association between the expression of S100A1 and clinicopathological variables in the patients with lung cancer was evaluated using χ2 test. Kaplan-Meier analysis was used to analyze the overall survival rate of patients with HCC. Pearson’s correlation was used to analyze the correlation between p-LAST1 and S100A1 in HCC tissues. P<0.05 was considered to indicate a statistically significant difference.
Results
High expression of S100A1 is a predictor of poor prognosis in HCC
To investigate the role of S100A1 in HCC, the present study first evaluated the expression of S100A1 in HCC tissues. It was found that S100A1 was expressed in the cytoplasm and was significantly increased in HCC tissues compared with adjacent control tissues (Fig. 1A). In addition, the expression of S100A1 was higher in HCC tissues than in the matched adjacent tissues (Fig. 1B). In line with the results in the tissues, the expression of S100A1 was significantly increased in HCC cells compared with normal hepatocytes at the mRNA and protein levels (Fig. 1C and D), and the highest expression of S100A1 was found in Hep3B and SMMC-7721 cells.
Figure 1
Clinical significance of S100A1 in HCC. (A) Representative IHC images of protein expression of S100A1 in normal liver tissue and HCC tissue (left), and the IOD of these mages. Magnification, ×100. (B) IOD of S100A1 staining in HCC tissues and matched adjacent tissues. (C) Reverse transcription-quantitative polymerase chain reaction analysis showed that mean mRNA level of S100A1 in HCC cell lines was higher than that in normal HL7702 hepatocytes. (D) Western blot analysis showed that S100A1 protein was significantly elevated in HCC cell lines compared with normal hepatocytes. (E) Kaplan-Meier analysis showed that patients with high S100A1 had poorer overall survival rates compared with patients with low protein expression of S100A1. *P<0.05, vs. HL7702. HCC, hepatocellular carcinoma; IOD, integral optical density.
The patients were divided into two groups according to the mean IOD of S100A1 and it was found that the expression of S100A1 was associated with differentiation (P=0.0027), tumor size (P=0.0065), number of tumor nodes (P=0.0165), lymph node metastasis (P=0.0246), distant metastasis (P=0.0028) and TNM stage (P=0.0018), but was not associated with age (P=0.843), sex (P=0.626) or cirrhosis (P=0.671) (Table II). In addition, the present study investigated the factors that predicate the prognosis of patients with HCC by univariate and multivariate analyses. The univariate analysis indicated that the level of S100A1 (P=0.02), in addition to differentiation (P=0.03), tumor size (P=0.01), lymph node metastasis (P=0.01), distant metastasis (P=0.02) and TNM stage (P=0.02) were significantly associated with patients prognosis (Table III). Multivariate analysis revealed that the level of S100A1 (P=0.01), differentiation (P=0.02), the tumor size (P=0.03), lymph node metastasis (P=0.02), distant metastasis (P=0.02) and TNM stage (P=0.02) were independent factors for predicating the prognosis of patients with HCC (Table IV). Furthermore, it was found that the patients with low S100A1 had higher overall survival rates, compared with patients with high S100A1 (Fig. 1E).
Table II
Clinical association between the expression of S100A1 and clinicopathological variables in patients with hepatocellular carcinoma.
Variable
S100A1
Low expression(n=46)
High expression(n=58)
χ2 test P-value
Age (years)
<50
18
24
0.843
≥50
28
34
Sex
Male
38
45
0.626
Female
8
13
Differentiation
High
18
8
0.0027
Moderate
16
18
Low
12
32
Tumor size
<5 cm
29
21
0.0065
≥5 cm
17
37
Tumor nodes
Single
25
18
0.0165
Multiple
21
40
Lymph node metastasis
N0–1
26
20
0.0246
N2–3
20
38
Distant metastasis
No
31
22
0.0028
Yes
15
36
TNM stage
I–II
30
20
0.0018
III–IV
16
38
Cirrhosis
Yes
35
42
0.671
No
11
16
TNM, tumor-node-metastasis.
Table III
Univariate analysis of prognostic factors of hepatocellular carcinoma.
Variable
Hazard ratio
P-value
Age (≥50/<50 years)
1.16
0.65
Sex (male/female)
1.08
0.92
Tumor size (≥5 cm/<5 cm)
2.34
0.01
Differentiation (high-moderate/low)
3.18
0.03
Lymph node metastasis (N0–1/N2–3)
2.46
0.01
Distant metastasis (yes/no)
3.84
0.02
TNM stage (III–IV/I–II)
2.56
0.02
S100A1 expression (high/low)
3.07
0.02
TNM, tumor-node-metastasis.
Table IV
Multivariate analysis of independent prognostic factors of hepatic carcinoma.
Variable
Hazard ratio
P-value
Tumor size
2.24
0.03
Differentiation (high-moderate/low)
3.13
0.02
Lymph node metastasis
2.17
0.03
Distant metastasis
3.89
0.02
TNM stage
2.32
0.02
S100A1 expression
3.35
0.01
TNM, tumor-node-metastasis.
Knockdown of S100A1 by siRNA inhibits HCC cell growth and sensitizes HCC cells to DDP
The expression of S100A1 was knocked down by siRNA in Hep3B and SMMC7721 cells (Fig. 2A and B), and it was found that the knockdown of S100A1 significantly inhibited cell viability (Fig. 2C), and induced apoptosis (Fig. 2D) in the Hep3B and SMMC7721 cells. In addition, the mRNA levels of apoptosis markers Bcl-2, Bax and Bak were measured. The knockdown of S100A1 significantly reduced the expression of Bcl-2 and increased the expression of Bax and Bak (Fig. 2E). These results revealed that S100A1 functions as an oncogene in liver cancer.
Figure 2
Biological roles of S100A1 in hepatocellular carcinoma cell lines. (A) siRNA transfection downregulated S100A1 mRNA in Hep3B and SMMC7721 cell lines. (B) siRNA transfection downregulated S100A1 protein in Hep3B and SMMC7721 cell lines. (C) CCK-8 showed a time-dependent decrease in cell proliferation following S100A1 siRNA transfection in Hep3B and SMMC7721 cell lines. (D) S100A1 siRNA increased apoptotic rates of Hep3B and SMMC7721 cell lines. (E) Reverse transcription-quantitative polymerase chain reaction analysis showed that S100A1 siRNA transfection decreased mRNA levels of Bcl-2 and increased mRNA levels of Bax and Bak. *P<0.05 and **P<0.01, vs. NC. siRNA, small interfering RNA; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein; Bak, Bcl-2 antagonist/killer; NC, negative control.
The present study further investigated whether knockdown of the expression of S100A1 sensitizes HCC cells to DDP. It was observed that the knockdown of S100A1 significantly reduced cell viability, compared with negative control, in the Hep3B and SMMC7721 cells treated with DDP (Fig. 3A). It was also found that the knockdown of S100A1 enhanced the inhibitory effects of DDP on the promotion of cell apoptosis, indicated by the significant increase in the apoptotic rate compared with the negative control (Fig. 3B). In addition, the knockdown of S100A1 decreased the expression of drug resistance-related genes, including p-gp, MRP and MDR (Fig. 3C–E). Therefore, the knockdown of S100A1 exhibited a synergistic inhibitory effect with DDP on HCC cell growth.
Figure 3
S100A1 downregulation enhances the inhibitory effects of DDP. (A) CCK-8 showed a time-dependent decrease in cell proliferation following S100A1 siRNA transfection in Hep3B and SMMC7721 cell lines treated with DDP. (B) S100A1 siRNA increased the apoptotic rate of Hep3B and SMMC7721 cell lines treated with DDP. Reverse transcription-quantitative polymerase chain reaction analysis showed that S100A1 siRNA transfection decreased the mRNA levels of p-gp, MDR and MRP in (C) Hep3B and (D) SMMC7721 cell lines treated with DDP. (E) Western blot analysis showed that S100A1 siRNA transfection decreased the protein levels of p-gp, MDR and MRP in Hep3B and SMMC7721 cell lines treated with DDP. *P<0.05 and **P<0.01. siRNA, small interfering RNA; DDP, cisplatin; p-gp, p-glycoprotein; MDR, multidrug resistant; MRP, multidrug resistant-associated protein.
S100A1 regulates Hippo signaling through its interaction with LATS1
The present study also investigated the mechanism by which the downregulation of S100A1 suppresses HCC cell growth. Hippo signaling is important in the development of HCC. The present study found that the downregulation of S100A1 significantly increased the phosphorylation of LATS1 and YAP, and decreased total YAP protein, but did not alter the expression of total MST1/2 or p-MST1/2 in the Hep3B and SMMC7721 cells, compared with the control group (Fig. 4A). YAP stabilization is controlled by its nuclear/ cytoplasmic distribution and the phosphorylation of YAP. Western blot analysis was performed using nuclear/cytoplasmic fractionation, which revealed that nuclear YAP was downregulated following S100A1 siRNA treatment, whereas YAP cytoplasm localization was upregulated (Fig. 4B). To further demonstrate whether S100A1 stabilizes YAP protein, the Hep3B and SMMC7721 cells were treated with the protein synthesis inhibitor CHX. Following CHX treatment for 6 h, the knockdown of S100A1 by siRNA significantly downregulated total YAP protein, compared with that in the control group (Fig. 4C), indicating that the half-life of endogenous YAP decreased following siRNA treatment. As YAP acts downstream of LATS1 in Hippo signaling, the present study examined whether S100A1 regulates YAP through LAST1, as the downregulation of S100A1 significantly increased the phosphorylation of LATS1. Co-immunoprecipitation was performed to examine whether there is any interaction between S100A1 and LATS1. The results showed that S100A1 and LATS1 were co-immunoprecipitated in the Hep3B cells overexpressing S100A1 (Fig. 4D). A luciferase reporter assay was then performed to measure the activity of TEA domain (TEAD), which indicates the transcriptional activity of YAP. S100A1 knockdown inhibited the transcription of TEAD (Fig. 4E). Therefore, it was demonstrated that S100A1 stabilized the YAP protein, leading to inhibition of Hippo signaling.
Figure 4
S100A1 regulates the YAP and Hippo signaling pathways. (A) S100A1 siRNA treatment upregulated p-LATS1 and p-YAP, and downregulated total YAP protein, but did not alter the expression of MST1/2 or p-MST1/2. (B) S100A1 siRNA treatment downregulated nuclear-YAP and upregulated cytoplasm-YAP protein. (C) Using CHX treatment, S100A1 depletion downregulated the half-life of YAP protein. (D) Co-immunoprecipitation analysis was performed in Hep3B cell lines. LATS1 co-immunoprecipitated with S100A1. The association was confirmed using a reciprocal approach. (E) Using the TEAD luciferase reporter, S100A1 siRNA downregulated the activity of TEAD in Hep3B and SMMC7721 cell lines. YAP, yes-associated protein; LATS1, large tumor suppressor kinase 1; MST, mammalian sterile 20-like kinase; siRNA, small interfering RNA; TEAD, TEA domain; CHX, cycloheximide; p-, phosphorylated.
Downregulation of S100A1 suppresses HCC cell growth through LATS1/YAP signaling
Due to the regulatory effect between S100A1 and LATS1, the present study further examined the biological function between S100A1 and LATS1. The Hep3B and SMMC7721 cells were transfected with S100A1 siRNA or LATS1 siRNA alone, or with both together. It was found that the downregulation of LATS1 largely attenuated the S100A1 siRNA-mediated induction of cell apoptosis (Fig. 5A), and inhibition of cell survival (Fig. 5B). In addition, compared with the control group, the knockdown of S100A1 inhibited the expression of pro-survival gene Bcl-2 and increased the expression of pro-apoptotic genes Bak and Bax (Fig. 5C). However, these inhibitory effects were reversed by LATS1 siRNA (Fig. 5C). The results indicated that S100A1 inhibited HCC cell proliferation via LATS1/YAP signaling.
Figure 5
Downregulation of S100A1 inhibits hepatocellular carcinoma cell growth through interaction with LATS1. (A) LATS1 siRNA significantly reduced the effect of S100A1 depletion on cell apoptotic rate. (B) LATS1 siRNA significantly reduced the effect of S100A1 depletion on cell growth rate. (C) LATS1 siRNA significantly upregulated the protein expression of Bcl-2 and downregulated the protein expression of Bax and Bak. LATS1 siRNA treatment signifi-cantly reduced the effect of S100A1 depletion on the Bcl-2, Bax and Bak proteins in Hep3B and SMMC7721 cell lines. siRNA, small interfering RNA; LATS1, large tumor suppressor kinase 1; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein; Bak, Bcl-2 antagonist/killer; NC, negative control. *P<0.05.
To further validate the association between S100A1 and Hippo signaling in HCC tissues. The present study examined the association between the protein expression of S100A1 and p-LATS in HCC tissues using immunohistochemistry. S100A1 staining was weak positive in normal liver tissues, whereas p-LATS1 showed strong positive cytoplasmic staining. S100A1 showed marked staining in cancer tissues, whereas p-LATS1 showed weak staining in cancer tissues (Fig. 6A). The correlation analysis showed that S100A1 was negatively correlated with p-LATS1 (Fig. 6B).
Figure 6
Correlation between S100A1 and p-LATS1 in HCC tissues. (A) Representative immunohistochemistry images of the expression of S100A1 and p-LATS1 protein in normal liver tissue and HCC tissue. Magnification, ×100. (B) Expression of S100A1 was negatively correlated with p-LATS1. HCC, hepa-tocellular carcinoma; p-LATS1, phosphorylated large tumor suppressor kinase 1; IOD, integral optical density.
Discussion
In the present study, it was found that S100A1 was upregulated in HCC tissues, and its upregulation was associated with large tumor size, low differentiation, and shorter survival rates. The biological experiments demonstrated that S100A1 functions as an oncogene in HCC. It was also found that S100A1 knockdown enhanced the inhibitory effects of DDP in HCC cells.The S100 protein family consists of 25 relatively small calcium-binding proteins. These proteins have been reported to be involved in tumorigenesis by interacting with enzymes, cytoskeletal proteins, receptors, transcription factors, and nucleic acids (12,13). The interaction between these members is also critical in tumor development. S100A1 interacts with S100A4, and modulates the metastasis-inducing capability of S100A4 (14,15). They have been identified as potential biomarkers for various tumor types, including lung cancer and ovarian cancer (16). Under physiological conditions, the expression of S100A1 is low in kidney, lungs, ovaries and liver (17–19). However, S100A1 is expressed at high levels under pathological conditions, including tumorigenesis. Sviatoha et al found that the expression of S100A1 was low in benign melanocytic tumors and increased in malignant melanomas (20). The expression of S100A1 was also increased with increasing Silverberg grade in serous tumors, and its upregulation predicted a decreased relapse-free survival rate in the endometrioid subtype of ovarian and endometrial cancer (9). S100A1 was found to be differentially expressed in clear cell renal cell carcinoma and papillary renal cell carcinoma, and the differential expression may be a potentially useful marker to differentiate the chromophobe renal cell carcinoma from renal oncocytoma (7,8). S100A1 can also be used to differentiate other tumors (21–25).S100A1 not only functions as a biomarker, but also an oncogene. Tian et al found that the overexpression of S100A1 enhanced ovarian cancer cell proliferation and migration (10). In the present study, it was also shown that S100A1 knockdown inhibited HCC cell growth and induced apoptosis. It was also found that the knockdown of S100A1 exhibited a synergistic inhibitory effect with DDP on HCC cell growth. The modulation of calcium signaling has been demonstrated to alter the sensitivity of chemotherapeutic agents to apoptotic signals (26). S100A4 is overexpressed in several methotrexate-resistant cells. The overexpression of S100A4 decreases the sensitivity of HT29 colon cancerhuman cells to methotrexate, whereas its knockdown causes chemosensitization towards methotrexate (27). Considering the interaction of S100A1 with S100A4 and their regulatory association (13,14,28,29), it is likely that S100A1 sensitizes HCC cells to DDP through S100A4.The present study also investigated the mechanism by which S100A1 promotes HCC cell growth. It was demonstrated that S100A1 inactivated the Hippo signaling pathway. YAP, the downstream effector of Hippo signaling, is frequently overexpressed in various types of humancancer (30). The present study found that the depletion of S100A1 reduced total and nuclear YAP protein, and decreased TEAD luciferase reporter activity, serving as a marker of YAP downstream function (31). The functions of YAP were determined by its phosphorylation status, with p-YAP remaining in the cytoplasm for degradation, and dephosphorylated YAP translocating into the nucleus and binding to TEAD proteins to promote proliferation by activating downstream targets (32). The results of the present study showed that the downregulation of S100A1 induced YAP phosphorylation, and CHX treatment demonstrated that the downregulation of S100A1 accelerated YAP protein degradation. MST1/2 and LATS1 are the upstream regulators of YAP (33). The findings of the present study showed that the downregulation of S100A1 did not alter the expression of MST1/2 or p-MST1/2, but upregulated the phosphorylation of LATS1. It was further confirmed that S100A1 interacted with LATS1. LATS1 depletion significantly reduced the effects of S100A1 on cell growth rate and apoptosis, and there was a positive correlation between p-LATS1 and S100A1 in clinical samples, supporting the hypothesis that LATS1 is responsible for S100A1-induced changes in cancer cell growth and Hippo signaling. A previous study demonstrated that S100A7 repressed the expression of YAP and inhibited the expression of ΔNp63, which directly binds to the region of the YAP promoter and induces its expression, inhibiting the Hippo pathway and enhancing YAP activity. S100A7 also enhances the resistance of squamous cell carcinoma cancer cells by inhibiting the expression and activity of YAP (34). Taken together, the findings of the present study demonstrate that S100A1 regulated the aggressiveness of HCC mainly through the YAP and Hippo signaling pathways. Therefore S100A1 is a novel upstream regulator of the Hippo signaling pathway.In conclusion, the present study supports the hypothesis that S100A1 functions as an oncogene and may be a biomarker for the prognosis of patients with HCC. S100A1 exerted its oncogenic function by interacting with LATS1 and activating YAP. S100A1 may serve as a target for novel therapies in HCC.
Authors: Guozheng Wang; Shu Zhang; David G Fernig; Marisa Martin-Fernandez; Philip S Rudland; Roger Barraclough Journal: Oncogene Date: 2005-02-17 Impact factor: 9.867