Bioinformatics delimitation of the psychrophilic and psychrotolerant actinobacteria isolated from the Polar Frontal waters of the Southern Ocean.

Identification of microorganisms plays a key role in the determination of the composition of microbial diversity for bioprospecting of biotechnologically important biomolecules. Digitalization is the process that solve discrepancies in microbial identification and cataloguing their diversity in distinct ecological habitats. In view of this connection, the psychrophilic and psychrotolerant actinobacteria were isolated from the water samples of the Polar Frontal region of the Southern Ocean. 16S rRNA gene sequencing for identification of psychrophiles was carried out and sequences were deposited in NCBI GeneBank. 16S rRNA gene sequences were used to create QR codes, CGR, FCGR and GC plot. This generated digital data help to relate the diversity amongst the isolated actinobacterial strains. The digital data showed considerable divergence among the actinobacterial strains. This generated bioinformatics data is helpful in the delimitation of the psychrophilic and psychrotolerant actinobacteria. Thus, the present study is a robust and accurate method for the identification of Polar microorganisms in a fixed boundary. Hence, this work will help to assign a unique digital identity to microorganisms in near future [9-19].

Specification table

Value of the data

Bioinformatics data of the psychrophilic and psychrotolerant actinobacteria of the Polar Frontal waters have significant importance in the biodiversity and biotechnology of microorganisms found in the polar regions and other cold environments.

An earnest attempt was made to digitize the 16S rRNA gene sequence of the psychrophilic and psychrotolerant actinobacteria of the Polar Frontal waters of the Antarctic Ocean.

The work is also significant on the score that it helps to build a database on microbial communities of Antarctica and to assign a unique digital identity to microorganisms.

Experimental design, materials and methods

Seawater samples were collected during the 7th Indian Scientific Expedition to the Indian Ocean Sector of the Southern Ocean (SOE-2012-13). The samples were collected at two sampling stations viz., Polar Front-1 (53°07′90″S; 47°48′061″E) and Polar Front-2 (56°29′956″S; 54°41′213″E) using CTD (SEABIRD 911 plus, USA). The isolation of psychrophilic and psychrotolerant actinobacteria was done following the recommended protocol [1].

The actinobacterial strains were identified based on their morphological (aerial mass colour, melanoid, reverse side and soluble pigments), physiological (carbon source assimilation), and chemo-taxonomical characteristics (cell wall amino acid and whole-cell sugar) by following the recommended method of Shirling and Gottlieb [2], and Lechevalier and Lechevalier [3]. The actinobacterial strains were warranted at genus level by comparing the data with the identification key developed by Nonomura [4].

16S rRNA gene sequencing was performed to identify the taxonomic position of the actinobacterial strains. Genomic DNA was extracted [5] and amplified using using the universal bacterial primers 27f (5′-GAGTTTGATCCTGGCTCAG-3′) and 1492r (5′-TACGGCTACCTTGTTACGACTT-3′) following the PCR conditions described by Karuppiah et al. [6]. The amplified products were purified using QIA quick PCR cleanup kit (Qiagen Inc., Chatsworth) and were sequenced using ABI automated sequencer (Applied Biosystems-3100) at Macrogen Inc., Republic of Korea. The forward and reverse sequences were assembled using EZ-Taxon database (https://www.ezbiocloud.net) and the sequence similarity was tested in the BLASTn program of the NCBI-GenBank database (http://www.ncbi.nlm.nih.gov/BLAST/). The phylogenetic tree was constructed to understand the actinobacterial lineage using the neighbour-joining method of Saitou and Nei [7]. The topology of the phylogenetic tree was evaluated, using the bootstrap resampling method of Felsenstein [8] with 1000 replicates.

Data

Nine 16S rRNA gene sequences of psychrophilic (PSY13, PSY15, PSY21, and PSY25) and psychrotolerant (PST1, PST2, PST3, PST4, and PST5) actinobacteria were submitted to NCBI Gen Bank database under the accession numbers KY120275-KY120283. The digitization of the actinobacterial sequences was carried as per algorithm and guidelines developed by Rekadwad et al., [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19].

QR codes were generated through QR Code GeneratorPro tool (Fig. 1) and the unique barcode sequences were retried using DNA BarID (http://www.neeri.res.in/DNA_BarID/DNA_BarID.htm) (Table 1). The Chaos Game Representation (CGR) and Chaos Game Representation Frequencies (FCGR) were digitally presented using the open source BioPHP bioinformatics tool (Fig. 2, Fig. 3). The graphical representation of the G+C content of the 16S rRNA gene sequences of the psychrophilic and psychrotolerant (Fig. 4 and Table 2) was done using the Webgenetics tool (https://www.webgenetics.com/acts/wg?prog=gcplot).

Fig. 1

Quick Response (QR) codes of 16S rRNA gene sequences of the psychrophilic and psychrotolerant actinobacteria.

Table 1

Digital data harbouring the unique barcode sequences of the psychrophilic and psychrotolerant actinobacteria.

Accession no.	Sequence length	Barcode start	Barcode end	Unique barcode sequences
KY120275	1466	71	140	CACGTGAGCAACCTGCCCCTGACTCTGGGAAATTCCTAAGCGGTGGAAACGCCGTCTAATACCGGATACG
KY120276	1443	71	140	ACACGTGAGCAACCTGCCCCTGACTCCGGGATAAGCGGTGGAAACGCCGTCTAATACCGGATACGCCGCC
KY120277	1437	71	140	TAACACGTGAGCAACCTGCCCCTGACTCTGGGATAAGCGGTGGAAACGCCGTCTAATACCGGATACGACC
KY120278	1483	71	140	GCGAACGGGTGAACACGTGGGCAATCTGCCCTGCACTCTGGGACAAGCCCTGGAAACGGGCTAATACCGG
KY120279	1376	71	140	CTCTGGGACAAGCCCTGGAAACGGGGTCTAATACCGGATATGACTGTCCATCGCATGGTGGATGGTGTAA
KY120280	1451	71	140	ACGGGTGAGTAACACGTGGGCAACCTGCCCTGCACTCTGGGACAAGCCCTGGAAACGGGGTCTGGCACTA
KY120281	1470	71	140	CCGGGTGAGTAACACGTGGGCAATCTGCCCAGCACTCTGGGTCAAGCCCTGGAAACGGGGTCTAAGACAA
KY120282	1466	71	140	CTGCCCTGCACTCTGGGACAAGCCCTGGAAACGGGGTCTAATACCGGATACTGACCCGCTTGGGCATCCA
KY120283	1450	71	140	TAGTGGCGAACGGGTGAGTAACACGTGGGCAATCTGCCCTGCACTCTGGGACAAGCCCTGGAAACGGGGT

Fig. 2

Chaos Game Representation (CGR) of 16S rRNA gene sequences of the psychrophilic and psychrotolerant actinobacteria.

Fig. 3

Chaos Game Representation of Frequencies (FCGR) of 16S rRNA gene sequences of the psychrophilic and psychrotolerant actinobacteria.

Fig. 4

Graphical representations of G + C content of 16S rRNA gene sequences of the psychrophilic and psychrotolerant actinobacteria.

Table 2

G+C percentage of 16S rRNA gene sequences of the psychrophilic and psychrotolerant actinobacteria.

Accession number.	Species	Strain designation	Average G+C content (%)
KY120275	Nocardiopsis dassonvillei	PSY13	58.59
KY120276	Nocardiopsis prasina	PSY15	58.07
KY120277	Nocardiopsis alba	PSY21	58.52
KY120278	Streptomyces albus	PSY25	59.47
KY120279	Streptomyces albidoflavus	PST1	59.45
KY120280	Streptomyces exfoliatus	PST2	59.41
KY120281	Streptomyces pactum	PST3	58.98
KY120282	Streptomyces griseorubens	PST4	59.48
KY120283	Streptomyces althioticus	PST5	58.97

Subject area	Marine Microbiology
More specific subject area	Polar Microbiology
Type of data	Quick Response (QR) codes, Chaos Game Representation (CGR), Chaos Game Representation Frequencies (FCGR) and GC percentage graph
How data was acquired	Wet lab isolation, 16S rRNA gene sequencing, and bioinformatics analysis
Data format	Raw and analysed
Experimental factors	Bioinformatics tools were used for analysis
Experimental features	Polar Frontal region (PF1–53°07′90″S; 47°48′061″E and PF2–56°29′956″S; 54°41′213″E), Southern Ocean
Data source location	Repository of Marine Actinobacteria, Centre of Advanced Study in Marine Biology, Faculty of Marine Sciences, Annamalai University, Parangipettai-608 502, Tamil Nadu, India
Data accessibility	Data available within this paper