| Literature DB >> 29896232 |
Yueying Liu1, Jieru Chen1, Meifang Jin1, Zhenhong Li1, Tian Tian1, Lili Li1, Hong Ni1.
Abstract
The aim of the present study was to establish a recurrent convulsion model during the developmental stage using inhalation of flurothyl, and to observe the relationship between the changes in mitochondrial function in hippocampal neurons and hippocampal neuronal apoptosis after recurrent convulsion. A total of 36 Sprague-Dawley male rats were selected and randomly divided into the control (NS) group and recurrent-seizure (RS) group for 0, 1.5, 3, 12 and 24 h. After the last seizure the rats were subdivided with 6 animals in each group. Rats in the seizure group inhaled flurothyl repeatedly to induce status convulsivus, 30 min once daily, for 7 consecutive days, while the same operation was conducted in the control group without inhalation of flurothyl. At each time-point after the last seizure, blood was taken from the heart, followed by decapitation and immediate removal of the brain. Half of the brain tissue was immediately fixed in 10% paraformaldehyde to prepare paraffin-embedded tissues for hematoxylin and eosin (H&E) histological staining. Hippocampus was taken from the other half of the brain and stored at -80°C. Changes in mitochondrial membrane potential (ΔΨm) in hippocampal neurons were detected by flow cytometer. Dynamic changes of mitochondrial fusion and division-related genes, mitochondrial fusion protein 2 (Mfn2) and dynamin-related protein 1 (Drp1), in the hippocampus after recurrent convulsion were observed using reverse transcription-polymerase chain reaction (RT-PCR)and western blot analysis. The expression of caspase-3 and cytochrome c (Cyt c) was determined by RT-PCR and western blot analysis. After successful establishment of the recurrent convulsion model in rats during developmental stage using flurothyl, H&E staining results exhibited that in the CA1 region of hippocampus in the NS group, karyopyknosis occurred in nucleus that was stained to be brown and yellow, and the expression peak of apoptotic cells mainly existed at 24 h after the last convulsion. RT-PCR and western analysis revealed that apoptosis-related gene caspase-3 expression in the RS group was elevated at 1.5 h after the last convulsion, and lasted 24 h after convulsion. Detection results of mitochondrial ΔΨm revealed a significant reduction 1.5, 3 and 12 h after convulsion in hippocampal neurons of experimental rats, which reached the trough at 12 h, and rapidly increased after 24 h. The expression of Mfn2 mRNA in the RS group was significantly lower than that in the control group, while the expression of Drp1 mRNA in RS group was distinctly higher than that in the control group. RT-PCR and western blot analysis revealed that, mitochondrial apoptosis-related gene Cyt c expression was increased at 3 h after the last convulsion, and lasted 24 h after convulsion. Correlation analysis showed that the changes in mitochondrial function were closely related to neuronal apoptosis. The results of the study show that apoptosis exists in the hippocampus of rats after recurrent convulsion, which is closely related to the changes in mitochondrial function.Entities:
Keywords: apoptosis; developmental stage; mitochondrial apoptosis; mitochondrial fusion and division; mitochondrial membrane potential; recurrent convulsion
Year: 2018 PMID: 29896232 PMCID: PMC5995061 DOI: 10.3892/etm.2018.6147
Source DB: PubMed Journal: Exp Ther Med ISSN: 1792-0981 Impact factor: 2.447
Quantitative PCR analysis of primer sequences of related genes.
| Gene name | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| ATGTCCCTGCTCTTTTCTCGA | CTATCTGCTGGGCTGCAGGTA | |
| ATGGAGGGGCTGATCCCGGTC | TCACCAAAGATGAGTGTGTCG | |
| GAGGCCGACTTCCTGTATGC | TGACCCGTCCCTTGAATTTC | |
| GGTGATGTTGAAAAAGGCAAGAA | TGCTTGCCTCCTTTTTCCA | |
| GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
Mfn2, mitochondrial fusion protein 2; Drp1, dynamin-related protein 1.
Figure 1.H&E staining displays changes of CA1 apoptosis of hippocampus during developmental stage in control group and 24 h after the last convulsion group (×400 magnification).
Dynamic changes of ΔΨm in rat neurons after sustained convulsion.
| Group | Mitochondrial ΔΨm |
|---|---|
| Control | 8.68±0.97 |
| 0 h | 8.62±1.08 |
| 1.5 h | 7.47±0.89 |
| 3 h | 7.32±1.02 |
| 12 h | 6.82±0.99 |
| 24 h | 7.28±1.03 |
ΔΨm, mitochondrial membrane potential.
Figure 2.RT-PCR results of mitochondrial fusion and division-related genes, Mfn2 and Drpl. Compared with those in the control group, *p<0.05, **p<0.01 (n=6). Mfn2, mitochondrial fusion protein 2; Drp1, dynamin-related protein 1.
Figure 3.Expression of Mfn2 and Drpl proteins in each group. Compared with those in the control group, *p<0.05, **p<0.01 (n=3). Mfn2, mitochondrial fusion protein 2; Drp1, dynamin-related protein 1.
Figure 4.Detection of expression of apoptosis-related factors caspase-3 and Cyt c using RT-PCR. Compared with those in the control group, *p<0.05 (n=3). Cyt c, cytochrome c.
Figure 5.Expressions of caspase-3 and Cyt c proteins in each group. Compared with those in the control group, *p<0.05, **p<0.01 (n=3). Cyt c, cytochrome c.
Correlation between changes in mitochondrial function and neuronal apoptosis.
| Group | Mitochondrial membrane potential | Apoptosis rate (%) |
|---|---|---|
| Control | 8.68±0.97 | 1±2 |
| 0 h | 8.62±1.08 | 2±1 |
| 1.5 h | 7.47±0.89 | 18±5 |
| 3 h | 7.32±1.02 | 22±3 |
| 12 h | 6.82±0.99 | 32±4 |
| 24 h | 7.28±1.03 | 21±5 |