| Literature DB >> 29888130 |
Luisa Garofalo1, Alessia Mariacher2, Rita Fanelli1, Rosario Fico2, Rita Lorenzini1.
Abstract
In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.Entities:
Keywords: Control Region; Cytochrome b; DNA testing; EU Regulation 1523/2007; Fur industry; Mitochondrial ND1
Year: 2018 PMID: 29888130 PMCID: PMC5993017 DOI: 10.7717/peerj.4902
Source DB: PubMed Journal: PeerJ ISSN: 2167-8359 Impact factor: 2.984
Figure 1Examples of casework samples that were identified as C. lupus ssp.
(A) Frontside of an uncoloured fur scrap, (B) backside of the same uncoloured fur scrap, (C) frontside of a dyed fur scrap, (D) entire dyed fur. Photo credit: Luisa Garofalo (A, B, C) and Alessia Mariacher (D).
Details on primer pairs for species identification in fur samples.
| Primer set | Target mtDNA | Forward (5′-3′) | Reverse (5′-3′) | Amplicon size (bp) | Primer positions | Needs sequencing | |
|---|---|---|---|---|---|---|---|
| furND1 | ND1 | CTAGCAATTATTCTCCTATCAGTCC | ACTAGTTCGGATTCTCCTTCAGT | 187 | 3,183–3,370 | 53 | YES |
| lupCR | CR | GTGCTATGTCAGTATCTCCAGGT | GAAAGATCAGTGAATTATGAGATTGAG | 149 | 15,494–15,643 | 56 | NO |
| nycCR | CR | ATACCTCACCACCCTCTATTT | TGATTAAGTAGTTTATGTCTATTGTGAC | 155 | 15,468–15,623 | 52 | NO |
| vulCR | CR | ATTAACCAGTGTGTTACGACTATCC | TGCAGTCATGTATGCTCCTGATA | 169 | 15,469–15,638 | 56 | NO |
| proCR | CR | CCATCGCATACTCAATCCTACTG | TCTGCGACGTAGGCCTATTTACTA | 173 | 1,574–1,747 | 53 | NO |
| felCytb | cytb | CCTAGTAGCGGATCTCCTAACC | ACGGTTTTCAATAATGCCTGAG | 145 | 16,019–16,164 | 55 | YES |
Notes:
Amplicon sizes include primer lengths. bp, base pair; Ta, annealing temperature; ND1, NADH ubiquinone oxidoreductase subunit ND1 gene; CR, control region, cytb, cytochrome b. Primer positions according to reference complete mitochondrial sequences.
Kim et al. (1998);
published only in database;
Arnason et al. (2006);
published only in database;
Lopez, Cevario & O’Brien (1996).
Presence (YES) or absence (NO) of amplification products in the reference species using non-specific and specific primer sets.
| Family | Species | Primer set | |||||
|---|---|---|---|---|---|---|---|
| furND1 | lupCR | nycCR | vulCR | proCR | felCytb | ||
| Canidae | YES | YES | NO | NO | NO | NO | |
| Canidae | YES | NO | NO | NO | NO | NO | |
| Canidae | YES | NO | NO | NO | NO | NO | |
| Canidae | YES | NO | YES | NO | NO | NO | |
| Canidae | YES | NO | NO | YES | NO | NO | |
| Felidae | YES | NO | NO | NO | NO | YES | |
| Felidae | YES | NO | NO | NO | NO | YES | |
| Felidae | YES | NO | NO | NO | NO | YES | |
| Procyonidae | NO | NO | NO | NO | YES | NO | |
| Mustelidae | YES | NO | NO | NO | NO | NO | |
| Mustelidae | YES | NO | NO | NO | NO | NO | |
| Leporidae | Aspecific bands | NO | NO | NO | NO | NO | |
| Leporidae | NO | NO | NO | NO | NO | NO | |
| Sciuridae | YES | NO | NO | NO | NO | NO | |
| Hominidae | NO | NO | NO | NO | NO | NO | |
Note:
Values of LOD (limit of detection) DNA in picograms (pg) are in parentheses. LODs were obtained only in canid and felid species using furND1 primer pair and in the target species using the other primer sets.
Results from caseworks.
| ID | Approximative age | Dyed | Declared AS | DNA | Primer set(s) |
|---|---|---|---|---|---|
| FUR-1 | 1980–2016 | No | raccoon dog | furND1 + nycCR | |
| FUR-2 | 1980–2016 | No | raccoon dog | furND1 + nycCR | |
| FUR-3 | 1980–2016 | No | raccoon dog | No amplification | All |
| FUR-4 | 1980–2016 | No | nd | furND1 + nycCR | |
| FUR-5 | 1980–2016 | No | nd | No amplification | All |
| FUR-6 | 1980–2016 | No | nd | furND1 + lupCR | |
| FUR-7 | 1980–2016 | Yes | nd | furND1 + lupCR | |
| FUR-8 | 1980–2016 | No | coyote | furND1 | |
| FUR-9 | 1980–2016 | No | squirrel | furND1 | |
| FUR-10 | 1930–1980 | No | fox | furND1 + vulCR | |
| FUR-11 | 1980–2016 | No | silver fox | furND1 + vulCR | |
| FUR-12 | 1980–2016 | Yes | nd | furND1 | |
| FUR-13 | 1980–2016 | No | nd | furND1 + vulCR | |
| FUR-14 | 1980–2016 | No | nd | furND1 + vulCR | |
| FUR-15 | 1980–2016 | Yes | nd | No amplification | All |
| FUR-16 | 1980–2016 | No | nd | furND1 | |
| FUR-17 | 1930–1980 | No | siberian wolf | furND1 | |
| FUR-18 | 1930–1980 | No | wolf | furND1 | |
| FUR-19 | 1930–1980 | No | wild cat | furND1 + felCytb | |
| FUR-20 | 1980–2016 | No | nd | furND1 + felCytb | |
| FUR-21 | 1980–2016 | No | nd | furND1 + lupCR | |
| FUR-22 | 1980–2016 | Yes | nd | furND1 + lupCR | |
| FUR-23 | 1980–2016 | Yes | nd | furND1 + lupCR | |
| FUR-24 | 1980–2016 | No | nd | furND1 | |
| FUR-25 | 1930–1980 | Yes | nd | No amplification | All |
Note:
nd, not declared. See text for details.