Literature DB >> 29883070

Altered T-cell subsets and transcription factors in latent autoimmune diabetes in adults taking sitagliptin, a dipeptidyl peptidase-4 inhibitor: A 1-year open-label randomized controlled trial.

Xia Wang1, Lin Yang1, Ying Cheng1, Peilin Zheng1, Jingping Hu1, Gan Huang1, Zhiguang Zhou1.   

Abstract

AIMS/
INTRODUCTION: Dipeptidyl peptidase-4 inhibitor has been proven to improve glycemic control and β-cell function in latent autoimmune diabetes in adults (LADA). The potential immune modulation mechanism is still unknown. Thus, we tested T-lymphocyte subsets and expression of relevant transcription factors in LADA patients with sitagliptin intervention for up to 1-year.
MATERIALS AND METHODS: A total of 40 LADA patients were randomly assigned to sitagliptin and/or insulin treatment (SITA group; n = 20) or insulin alone treatment (CONT group; n = 20). Peripheral blood mononuclear cells were isolated at baseline, 6 months and 12 months. The percentage of T-lymphocyte subsets (T helper 1, T helper 2, T helper 17 and regulatory T cells) tested by flow cytometry, and the messenger ribonucleic acid expression (T box expressed in T cells [T-BET], GATA binding protein 3 [GATA3], forkhead box protein 3 [FOXP3] and related orphan receptor C [RORC]) tested by real-time polymerase chain reaction were determined at baseline, 6 months and 12 months.
RESULTS: The percentage of regulatory T cells in the SITA group was significantly lower than that of the CONT group at baseline. The percentage of T helper 2 cells was higher than that of the CONT group at 6 months and 12 months. At 12 months, the percentage of T helper 17 cells was lower in the SITA group than that of the CONT group. After a 1-year visit, the messenger ribonucleic acid expression levels of T-BET expressed in T cells and RORC in the SITA group were significantly lower than at baseline. Whereas that of RORC in the CONT group were significantly lower than that at baseline.
CONCLUSIONS: The data confirmed that sitagliptin altered the phenotype of T cells and downregulated the expression of T-BET and RORC in LADA patients, and ameliorated glycemic control in LADA patients.
© 2018 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

Entities:  

Keywords:  Dipeptidyl peptidase-4 inhibitor; Latent autoimmune diabetes in adults; T-lymphocyte subsets

Mesh:

Substances:

Year:  2018        PMID: 29883070      PMCID: PMC6400151          DOI: 10.1111/jdi.12873

Source DB:  PubMed          Journal:  J Diabetes Investig        ISSN: 2040-1116            Impact factor:   4.232


Introduction

Latent autoimmune diabetes in adults (LADA) is a subset of autoimmune diabetes, with clinical manifestation overlapping both type 1 diabetes and type 2 diabetes1, 2. A variety of oral agents are applicable to LADA, such as sulfonylureas, insulin sensitizers (metformin and thiazolidinediones), incretins and sodium–glucose cotransporter inhibitors3, 4, 5. Dipeptidyl peptidase‐4 (DPP‐4) inhibitors, a novel hypoglycemic medication, have been widely applied in type 2 diabetes patients because of their cardiovascular safety, excellent glycemic controlling ability and rare relevant hypoglycemic events in large‐scale multiple‐centered randomized controlled trials, as reported6, 7, 8. Autoimmune diabetes is considered to be dominantly modulated by T cells. A potential pathogenic mechanism is the imbalance between pathogenic and regulatory T lymphocytes, which results in the actual destruction of the insulin‐producing β‐cells in the pancreatic islets. DPP‐4, known as lymphocyte cell surface protein CD26, has multiple functions in diabetes9, the cardiovascular system, solid tumor and so on because of the diversity of substrates cleaved by DPP‐4. DPP‐4 inhibitors could increase the incretin levels by blocking their degradation. It has also been proven to play a crucial role in immune regulation by several signaling pathways. In a non‐obese diabetic mouse model10, 11, 12, 13, 14, DPP‐4 inhibitors were reported to delay the onset of diabetes, preserve β‐cell mass and attenuate autoimmunity. Several clinical trials15, 16, 17, 18, 19 of DPP‐4 inhibitors in autoimmune diabetes also confirmed that DPP‐4 inhibitors might improve glycemic control and preserve β‐cell function. However, DPP‐4‐mediated cell signaling and possible immune modulation is still not clearly identified in autoimmune diabetes. In the present prospective randomized control trial, we investigated whether there are any differences in the profiles of the T‐cell subpopulation and its associated transcription factors in LADA patients with sitagliptin intervention for up to 1 year of follow up.

Methods

Patient selection

The criteria of LADA were: (i) diabetes diagnosed according to the report of the World Health Organization in 1999; (ii) age range 30–70 years; (iii) glutamic acid decarboxylase antibody (GADA)‐positive; (iv) insulin independent within the first 6 months after the diagnosis of diabetes; (v) fasting C‐peptide level >200 pmol/L or a 2‐h postprandial C‐peptide >400 pmol/L; and (vi) duration of diabetes of ≤3 years. The exclusion criteria were: (i) total insulin doses >0.8 U/kg/day; (ii) evidence of any other autoimmune diseases; (iii) evidence of chronic or acute infection; (iv) a history of any malignancy, congestive heart failure or secondary diabetes; (v) renal diseases or renal dysfunction with serum creatinine of ≥1.5 mg/dL for men and ≥1.4 mg/dL for women; (vi) women who were pregnant, had several miscarriages or were breast‐feeding; and (vii) patients unable to abide by the treatment protocol. A total of 40 LADA patients were recruited from December 2014 to December 2016. All of them were given written information and consent was obtained. The protocols were approved by the ethics committee of the Second Xiangya Hospital, Central South University. This study has been registered online (www.clinicaltrials.gov/identifier NCT01159847).

Treatment protocol

After a 3‐month washing‐in period, the 40 patients enrolled in this study were randomized at a 1:1 ratio to insulin with sitagliptin 100 mg/day (SITA group; n = 20) or insulin without sitagliptin (CONT group; n = 20). Patients included in this study had similar diet and lifestyle modifications, self‐monitoring of blood glucose, and insulin dose adjustment. The regimen of insulin is administration of premixed insulin (30% insulin aspart and 70% insulin aspart protamine) twice or three times daily according to the patient's glycemic profile. Sulfonylureas, insulin sensitizers, other types of DPP‐4 inhibitors and sodium–glucose cotransporter inhibitors were not applied to the patients in the present study. The intervention lasted for 12 months, and the follow‐up visits took place at baseline, 6 months and 12 months. All 40 participants completed the treatment protocol and attended the visits at all three time‐points. Fasting blood samples were tested for hemoglobin A1c (HbA1c), GADA, fasting blood glucose and C‐peptide; 2‐h postprandial blood samples were tested for postprandial blood glucose and C‐peptide.

GADA assay

GADA was tested by radioligand assay confirmed by the Diabetes Antibody Standardization Program (2012) and sponsored by the Immunology of Diabetes Society. The cut‐off indices of positivity for GADA was ≥18 U/mL (World Health Organization units), and the sensitivity was 78.0% and specificity was 96.7% (Diabetes Autoantibody Standardization Program 2010)20.

Assessment of HbA1c and β‐cell function

A standard 543.6‐kcal, mixed‐meal tolerance test (44.4% of calories as carbohydrate, 47.7% calories as fat and 7.9% calories as protein) was given. The HbA1c levels were measured by automated liquid chromatography (HLC‐723G8; Tosoh, Yamaguchi, Japan). Plasma glucose and C‐peptide levels were measured at 0 and 2 h after the standard meal. C‐peptide was detected by a chemiluminescence method (Advia Centaur System, Munich, Germany).

T helper 1/T helper 2/T helper 17/regulatory T Cell phenotype testing

Fresh blood samples, collected at baseline, 6 and 12 months, were gathered in sodium heparin tubes from fasting participants and processed in 2 h. Peripheral blood mononuclear cells were separated by Ficoll‐Paque density‐gradient. Cells were stimulated with 1 μg/mL ionomycin and 50 ng/mL phorbol‐12‐myristate‐13‐acetate for 6 h in the presence of Brefeldin A and GolgiStop. Cells were harvested and stained with viability dye (Invitrogen, Carlsbad, CA, USA) and flurophore conjugated anti‐interferon‐γ, anti‐interleukin‐4, anti‐interleukin‐17A and anti‐forkhead box protein 3 (FOXP3) by fluorescence‐activated cell sorting. Data were gathered in a Canto flow cytometer (BD, Franklin Lakes, NJ, USA) and analyzed with Flowjo 7.6 software (Tree Star, Inc., Ashland, OR, USA). The gating strategy is shown in Figure 1.
Figure 1

Representative plots and the gating strategy for the fluorescence‐activated cell sorting analysis of CD4 helper T cell subsets. CD4+ T cells were sequentially gated on lymphocytes, singlets, live T cells and CD4+ T cells, and the expression of interferon (IFN)‐γ, interleukin (IL)‐4 and IL‐17A was further analyzed. FSC‐A, forward scatter‐area; FSC‐H, forward scatter‐height; SSC‐A, side scatter‐area.

Representative plots and the gating strategy for the fluorescence‐activated cell sorting analysis of CD4 helper T cell subsets. CD4+ T cells were sequentially gated on lymphocytes, singlets, live T cells and CD4+ T cells, and the expression of interferon (IFN)‐γ, interleukin (IL)‐4 and IL‐17A was further analyzed. FSC‐A, forward scatter‐area; FSC‐H, forward scatter‐height; SSC‐A, side scatter‐area.

Quantification of T‐cell transcription factors

Total ribonucleic acid (RNA) was obtained by the TRIZOL (Invitrogen) method and frozen at −70°C according to the manufacturer's protocol. The RNA was first isolated with a RNA extraction kit (Zymo Research, Orange County, CA, USA), and was then converted to complementary deoxyribonucleic acid (cDNA) with a cDNA Reverse Transcription Kit (GoScript™; Promega, Madison, WI, USA). The cDNAs collected were amplified with specific oligonucleotides for T box expressed in T cells (T‐BET), GATA binding protein 3 (GATA3), forkhead box protein 3 (FOXP3) and related orphan receptor C (RORC) with SYBR Green I and quantified by real‐time polymerase chain reaction in an ABI PRISM Step One Sequence Detection System (PE Applied Biosystems™ machine; Carlsbad, CA, USA). Primers are listed in Table 1. The relative messenger RNA (mRNA) gene expression of T‐cell transcription factors (T helper 1 [Th1] = T‐BET, T helper 2 [Th2] = GATA3, T helper 17 [Th17] = RORC, regulatory T cells [Treg] = FOXP3) were quantified as a fold change against the actin control sample by using the 2−∆∆CT method. These associated transcription factors were tested at baseline, 6 and 12 months.
Table 1

Forward and reverse primers for T‐cell transcription factors

Target genePrimer forwardPrimer reverse
β‐Actin5′‐CGGGAAATCGTGCGTGAC‐3′5′‐GGAAGGAAGGCTGGAAGAG‐3′
T‐BET5′‐CAACGCTTCCAACACGCAT‐3′5′‐GACTCAAAGTTCTCCCGGAA‐3′
GATA35′‐TCATTAAGCCCAAGCGAAGG‐3′5′‐GTCCCCATTGGCATTCCTC‐3′
RORC5′‐GCAGCGCTCCAACATCTTCT‐3′5′‐ACGTACTGAATGGCCTCGGT‐3′
FOXP35′‐CACCTGGCTGGGAAAATGG‐3′5′‐GGAGCCCTTGTCGGATGA‐3′

FOXP3, forkhead box protein 3; GATA3, GATA binding protein 3; RORC, related orphan receptor C; T‐BET, T box expressed in T cells.

Forward and reverse primers for T‐cell transcription factors FOXP3, forkhead box protein 3; GATA3, GATA binding protein 3; RORC, related orphan receptor C; T‐BET, T box expressed in T cells.

Statistical analysis

Data are presented as mean ± standard error of the mean or median (25th–75th percentile). A paired t‐test was used for a comparison from the baseline within the same group. Categorical variables were compared by one‐way anova. We used SPSS version 17.0 (IBM Corporation, Chicago, IL, USA) and GraphPad Prism 5 software (GraphPad Software, San Diego, CA, USA). A two‐tailed P < 0.05 was considered a significant difference.

Results

Anthropometric and metabolic data

We randomly assigned these 40 LADA patients into the SITA group (n = 20, women/men 7/13) and CONT group (n = 20, women/men 9/11). The mean age in the SITA group and CONT group was 47.8 ± 13.1 vs 51.9 ± 10.2 years, respectively. The GADA titer in the SITA group was 483.6 U/mL (30.9–1,134.7 U/mL), and 285.1 U/mL (18.5–1,190.5 U/mL) in the CONT group. No significant differences were present among duration, sex, age and GADA titer. No patient progressed to an insulin‐dependent state during the 1‐year follow up. Table 2 summarizes the characteristics of the participants in the SITA group and CONT group at baseline, 6 and 12 months. After the 12‐month visit, postprandial blood glucose and fasting blood glucose in the CONT group were significantly higher than baseline. No significant difference could be found in body mass index, insulin dose, HbA1c, fasting blood glucose, fasting C‐peptide, postprandial C‐peptide.
Table 2

Demographic and clinical characteristics at baseline, 6 months and 12 months

Baseline6 months12 months
SITA group (n = 20)CONT group (n = 20)SITA group (n = 20)CONT group (n = 20)SITA group (n = 20)CONT group (n = 20)
BMI (kg/m2)23.19 ± 0.6424.46 ± 0.6323.11 ± 0.6524.41 ± 0.6223.05 ± 0.6724.27 ± 0.58
Insulin dose (U/day)12.0 ± 2.614.0 ± 2.411.5 ± 2.515.2 ± 2.812.3 ± 2.618.9 ± 3.4
HbA1c (%)6.33 ± 0.206.94 ± 0.416.35 ± 0.177.09 ± 0.436.48 ± 0.217.12 ± 0.36
FBG (mmol/L)6.68 ± 0.407.54 ± 0.616.82 ± 0.427.62 ± 0.676.29 ± 0.297.50 ± 0.63
PBG (mmol/L)12.72 ± 1.0714.02 ± 1.3612.45 ± 0.9014.79 ± 1.3011.68 ± 1.1914.90 ± 1.28*
▵BG (mmol/L)6.05 ± 1.125.95 ± 0.925.63 ± 1.016.08 ± 1.135.37 ± 1.267.22 ± 0.92*
FCP (pmol/L)479.5 ± 71.2477.1 ± 55.5420.9 ± 59.7522.2 ± 59.7441.3 ± 51.8458.3 ± 43.4
2hCP (pmol/L)1,458.9 ± 200.71,487.9 ± 175.51,557.7 ± 191.11,658.4 ± 184.81,691.3 ± 220.81,516.7 ± 150.9
▵CP (pmol/L)979.4 ± 166.21,010.8 ± 137.21,136.9 ± 148.51,136.15 ± 157.31,250.0 ± 179.71,058.4 ± 125.8

Data presented as mean ± standard error of the mean. *P < 0.05, compared with the insulin alone treatment (CONT) group at baseline. ▵CP, 2‐h postprandial C‐peptide – fasting C‐peptide; 2hCP, 2‐h postprandial C‐peptide; BG, blood glucose; BMI, body mass index, FBG, fasting blood glucose; FCP, fasting C‐peptide; CP, postprandial C‐peptide; HbA1c, hemoglobin A1c; PBG, postprandial blood glucose; SITA, sitagliptin and insulin treatment.

Demographic and clinical characteristics at baseline, 6 months and 12 months Data presented as mean ± standard error of the mean. *P < 0.05, compared with the insulin alone treatment (CONT) group at baseline. ▵CP, 2‐h postprandial C‐peptide – fasting C‐peptide; 2hCP, 2‐h postprandial C‐peptide; BG, blood glucose; BMI, body mass index, FBG, fasting blood glucose; FCP, fasting C‐peptide; CP, postprandial C‐peptide; HbA1c, hemoglobin A1c; PBG, postprandial blood glucose; SITA, sitagliptin and insulin treatment.

Th1/Th2/Th17/Treg phenotype

We investigated the percentage of T‐lymphocyte subsets (Th1, Th2, Treg and Th17 cells) in the SITA group and CONT group by flow cytometry at baseline, 6 and 12 months. The percentage of Treg to CD4+ T cells in the SITA group was significantly lower than that in the CONT group (2.36 ± 0.35% vs 3.92 ± 0.50%, P = 0.016) at baseline. The percentage of Th2 to CD4+ T cells was higher than that of the CONT group at 6 months (4.08 ± 0.58% vs 2.18 ± 0.42%, P = 0.015) and 12 months(5.17 ± 0.92% vs 2.51 ± 0.33%, P = 0.012). At 12 months, the percentage of Th17 to CD4+ T cells was lower in the SITA group than that of the CONT group(0.74 ± 0.57% vs 1.20 ± 0.52%, P = 0.020; Figure 2).
Figure 2

Percentage of T‐cell subsets between the sitagliptin and insulin treatment (SITA) group and insulin alone treatment (CONT) group at baseline, 6 and 12 months. *P < 0.05, compared with the CONT group. Th1, T helper 1 cells; Th2, T helper 2 cells; Th17, T helper 17 cells; Treg, regulatory T cells.

Percentage of T‐cell subsets between the sitagliptin and insulin treatment (SITA) group and insulin alone treatment (CONT) group at baseline, 6 and 12 months. *P < 0.05, compared with the CONT group. Th1, T helper 1 cells; Th2, T helper 2 cells; Th17, T helper 17 cells; Treg, regulatory T cells.

Expression of T‐cell transcription factors

We next extracted RNA from peripheral blood mononuclear cell samples in all 40 LADA patients at baseline, 6 months and 12 months, reversed them into cDNA, and tested the relative mRNA expression of T‐cell transcription (T‐BET, GATA3, RORC and FOXP3) by real‐time polymerase chain reaction. In Figure 3, no significant difference could be found in the mRNA expression in the SITA group and CONT group at baseline and 6 months, neither difference can be found compared with their baseline, respectively. After the 1‐year visit, no significant difference could be found in these four transcription factors between the SITA group and CONT group. However, the mRNA expression levels of T‐BET (0.29 ± 0.16% vs 0.85 ± 0.24%, P = 0.012) and RORC (0.11 ± 0.07% vs 0.85 ± 0.51%, P = 0.009) in the SITA group were significantly lower when compared with baseline in the SITA group. Whereas the mRNA expression levels of RORC (1.14 ± 0.84% vs 0.19 ± 0.17%, P = 0.004) were also significantly lower than that of its baseline in the CONT group. Although there was a descending tendency in the FOXP3 expression and ascending tendency in the GATA3 expression, the differences were not significant.
Figure 3

Expression of T‐cell transcription factors at baseline, 6 and 12 months between the sitagliptin and insulin treatment (SITA) group and insulin alone treatment (CONT) group. Real‐time polymerase chain reaction was carried out to test the messenger ribonucleic acid (mRNA) expression of transcription factors (T helper 1 cells = T box expressed in T cells [T‐BET], T helper 2 cells = GATA binding protein 3 [GATA3], regulatory T cells = forkhead box protein 3 [FOXP3] and T helper 17 cells = related orphan receptor C [RORC]) in the SITA group and CONT group at baseline, 6 and 12 months. *P < 0.05, compared with baseline in the SITA group; **P < 0.01, compared with baseline in the SITA group; and ## P < 0.01, compared with baseline in the CONT group.

Expression of T‐cell transcription factors at baseline, 6 and 12 months between the sitagliptin and insulin treatment (SITA) group and insulin alone treatment (CONT) group. Real‐time polymerase chain reaction was carried out to test the messenger ribonucleic acid (mRNA) expression of transcription factors (T helper 1 cells = T box expressed in T cells [T‐BET], T helper 2 cells = GATA binding protein 3 [GATA3], regulatory T cells = forkhead box protein 3 [FOXP3] and T helper 17 cells = related orphan receptor C [RORC]) in the SITA group and CONT group at baseline, 6 and 12 months. *P < 0.05, compared with baseline in the SITA group; **P < 0.01, compared with baseline in the SITA group; and ## P < 0.01, compared with baseline in the CONT group.

Discussion

Type 1 diabetes is mainly mediated by T cells, and is associated with loss of immunological tolerance to self‐antigens. LADA is a subclass of autoimmune diabetes. DPP‐4 inhibitors, a novel class of oral hypoglycemic agent, have gained wide acceptance for the treatment of type 2 diabetes. They have also been documented to be protective and effective in autoimmune diabetes, not only in type 1 diabetic animal models10, 11, 12, 13, 14, but also in LADA patients based on small‐scale population studies15, 16, 17, 18, 19. However, it has not been fully understood whether immunological modulation is involved in the disease progression mediated by DPP‐4 inhibition. Therefore, we attempted to elucidate the immunological profile of T‐cell subsets and the main transcription factors with sitagliptin intervention in LADA patients. We investigated the frequency of T‐cell subsets in LADA patients taking sitaliptin and LADA patients not taking sitaliptin. We found that the percentage of Th2 in the SITA group was statistically higher at 6 months and 12 months, whereas Th17 was dramatically lower than the CONT group after 1‐year follow up. These results confirmed that sitagliptin might alter the subsets of T cells by increasing the protective Th2 and decreasing the pathogenic Th17. This finding shares similarities with another in vitro study21 in which peripheral blood mononuclear cells were extracted from healthy volunteers, confirming sitagliptin inhibition had a suppression effect on Th1, Th2 and Th17 lymphocytes differentiation. The complicated local milieu in the pancreatic islets of Langerhans and the interplay between non‐immune cells and immune cells in vivo might explain this discrepancy. Previous studies22, 23, 24, 25 have shown a decline in Th1 and Th2, lower cytokine secretion, and a low expression of T‐cell‐specific transcription factors in the progression of autoimmune diabetes, suggesting an immune dampening and exhaustion at the onset of autoimmunity. Seldom do clinical trial studies focus on the alteration of the T‐cell phenotype with sitagliptin intervention. Interestingly, the present prospective study observed that although the quantities of Th1 did not significantly decrease, its expression of T‐BET was still obviously decreased in the SITA group. In addition, the percentage of protective Th2 was elevated, and that of the pathological Th17 was decreased. Furthermore, blood glucose was improved, especially postprandial blood glucose, inferring that sitagliptin intervention might alter the quantities of T‐cell subsets in LADA patients and further contribute to better glucose control, resulting in a protective effect on pancreatic β‐cells. In type 1 diabetes, there was a decreased frequency of Treg24. Defects in Treg number and/or function are a major factor in the progression of type 1 diabetes25. In our previous published study26, we found a lower expression of FOXP3 in LADA patients; a further study27 confirmed that the FOXP3 promoter region was hypermethylated in CD4+ T cells from LADA patients. In the present study, after the 1‐year visit, there was neither a significant alteration in the percentage of Treg nor its corresponding mRNA expression (FOXP3) compared with those in the control group with sitagliptin intervention, though a significant difference of Treg at baseline between these two groups unexpectedly occurred. Sitagliptin did not alter the frequency of Treg and the level of its associated gene expression at 1‐year follow up, and a further long‐term study is required to further confirm this. Nevertheless, the expression levels of T‐BET and RORC were significantly lower with sitagliptin, suggesting that sitagliptin might downregulate the expression of pathogenic transcription factors. It seems that the percentage of T cells analyzed by fluorescence‐activated cell sorting was unexpectedly not in accordance with the expression of their associated transcription factors. Conflicting results were also found in another type 1 diabetes study28. This unexpected inconsistency might arise from an abnormal translational or post‐translational modulation of protein. Case reports29, 30 and clinical trials14, 15, 16, 17, 18 in autoimmune diabetes treated with DPP‐4 inhibitor alone or in combination with other drugs showed that sitagliptin significantly improved glycemic control and reduced insulin requirements, accompanied by a good tolerance profile. Although a recent meta‐analysis showed that DPP‐4 inhibitor gives a neutral result for HbA1c31 in type 1 diabetes. The present observed results found that sitagliptin, as an add‐on therapy, seemed to be a better choice to improve the postprandial blood glucose in LADA patients. Although, in regard to C‐peptide and HbA1c, the result from our 1‐year study was not in line with previous studies15, 16, 17, possibly because of the small sample size, different population and relatively short follow‐up period. In conclusion, the current data first implied that sitagliptin, a DPP‐4 inhibitor, could alter the frequency of CD4+ T‐cell subsets on both a cellular and mRNA level in LADA patients. The downregulation of the expression of pathological mRNAs, including RORC and T‐BET, as well as the decreased Th17 and elevated Th2 cells, might contribute to immune suppression and glycemic control in LADA. A further larger cohort study is warranted to confirm these outcomes from clinic to bench.

Disclosure

The authors declare no conflict of interest.
  31 in total

1.  The CD4(+) regulatory T-cells is decreased in adults with latent autoimmune diabetes.

Authors:  Zhifang Yang; Zhiguang Zhou; Gan Huang; He Ling; Xiang Yan; Jian Peng; Xia Li
Journal:  Diabetes Res Clin Pract       Date:  2006-09-26       Impact factor: 5.602

2.  Reversal of new-onset diabetes through modulating inflammation and stimulating beta-cell replication in nonobese diabetic mice by a dipeptidyl peptidase IV inhibitor.

Authors:  Lei Tian; Jie Gao; Jianqiang Hao; Yu Zhang; Huimin Yi; Timothy D O'Brien; Robert Sorenson; Jian Luo; Zhiguang Guo
Journal:  Endocrinology       Date:  2010-05-05       Impact factor: 4.736

3.  Abnormal DNA methylation in CD4+ T cells from people with latent autoimmune diabetes in adults.

Authors:  Yijun Li; Ming Zhao; Can Hou; Gongping Liang; Lin Yang; Yuyu Tan; Zhen Wang; Heng Yin; Zhiguang Zhou; Qianjin Lu
Journal:  Diabetes Res Clin Pract       Date:  2011-08-23       Impact factor: 5.602

4.  Sitagliptin in glutamic acid decarboxylase antibody-positive diabetes mellitus.

Authors:  Narayanan Kandasamy; Graham Lennox; Anand K Annamalai; Gerald Maguire; Amanda I Adler
Journal:  Endocr Pract       Date:  2012 Jul-Aug       Impact factor: 3.443

5.  Treatment of autoimmune diabetes in NOD mice by Toll-like receptor 2 tolerance in conjunction with dipeptidyl peptidase 4 inhibition.

Authors:  D-H Kim; J-C Lee; M-K Lee; K-W Kim; M-S Lee
Journal:  Diabetologia       Date:  2012-09-27       Impact factor: 10.122

6.  The DPP4 inhibitor linagliptin delays the onset of diabetes and preserves β-cell mass in non-obese diabetic mice.

Authors:  Jacob Jelsing; Niels Vrang; Søren B van Witteloostuijn; Michael Mark; Thomas Klein
Journal:  J Endocrinol       Date:  2012-07-03       Impact factor: 4.286

7.  Impaired cytokine production by peripheral blood mononuclear cells in type 1 diabetic patients.

Authors:  N T Foss; M C Foss-Freitas; M A N Ferreira; R N Cardili; C M C Barbosa; M C Foss
Journal:  Diabetes Metab       Date:  2007-11-07       Impact factor: 6.041

8.  Sitagliptin (MK0431) inhibition of dipeptidyl peptidase IV decreases nonobese diabetic mouse CD4+ T-cell migration through incretin-dependent and -independent pathways.

Authors:  Su-Jin Kim; Cuilan Nian; Christopher H S McIntosh
Journal:  Diabetes       Date:  2010-04-05       Impact factor: 9.461

9.  Rosiglitazone preserves islet beta-cell function of adult-onset latent autoimmune diabetes in 3 years follow-up study.

Authors:  Zhifang Yang; Zhiguang Zhou; Xia Li; Gan Huang; Jian Lin
Journal:  Diabetes Res Clin Pract       Date:  2008-11-12       Impact factor: 5.602

10.  Frequency, immunogenetics, and clinical characteristics of latent autoimmune diabetes in China (LADA China study): a nationwide, multicenter, clinic-based cross-sectional study.

Authors:  Zhiguang Zhou; Yufei Xiang; Linong Ji; Weiping Jia; Guang Ning; Gan Huang; Lin Yang; Jian Lin; Zhenqi Liu; William A Hagopian; R David Leslie
Journal:  Diabetes       Date:  2012-10-18       Impact factor: 9.461

View more
  9 in total

Review 1.  Adult-onset autoimmune diabetes.

Authors:  Raffaella Buzzetti; Ernesto Maddaloni; Jason Gaglia; R David Leslie; F Susan Wong; Bernhard O Boehm
Journal:  Nat Rev Dis Primers       Date:  2022-09-22       Impact factor: 65.038

2.  Nursing a patient with latent autoimmune diabetes in adults with insulin-related lipodystrophy, allergy, and exogenous insulin autoimmune syndrome: A case report.

Authors:  Fang He; Ling-Ling Xu; Yu-Xiu Li; Ya-Xiu Dong
Journal:  World J Clin Cases       Date:  2022-07-16       Impact factor: 1.534

3.  Relationship Between Pregnancy and Acute Disseminated Encephalomyelitis: A Single-Case Study.

Authors:  Shuwen Deng; Ke Qiu; Ranran Tu; Haiping Zheng; Wei Lu
Journal:  Front Immunol       Date:  2021-02-01       Impact factor: 7.561

4.  Effects of incretin-based therapies on β-cell function in type 1 diabetes mellitus: a systematic review and meta-analysis.

Authors:  Yucheng Wu; Yu Lu; Shufang Yang; Qingqing Zhang
Journal:  J Int Med Res       Date:  2021-12       Impact factor: 1.671

5.  Serum Bile Acid Profiles in Latent Autoimmune Diabetes in Adults and Type 2 Diabetes Patients.

Authors:  Yu Zhou; Deli Ye; Xiaofen Yuan; Yonglie Zhou; Jun Xia
Journal:  J Diabetes Res       Date:  2022-02-22       Impact factor: 4.011

Review 6.  Latent autoimmune diabetes in adults: a focus on β-cell protection and therapy.

Authors:  Wenfeng Yin; Shuoming Luo; Zilin Xiao; Ziwei Zhang; Bingwen Liu; Zhiguang Zhou
Journal:  Front Endocrinol (Lausanne)       Date:  2022-08-05       Impact factor: 6.055

Review 7.  Latent Autoimmune Diabetes in Adults (LADA): From Immunopathogenesis to Immunotherapy.

Authors:  Jingyi Hu; Rong Zhang; Hailan Zou; Lingxiang Xie; Zhiguang Zhou; Yang Xiao
Journal:  Front Endocrinol (Lausanne)       Date:  2022-07-21       Impact factor: 6.055

8.  Efficacy and safety of sitagliptin and insulin for latent autoimmune diabetes in adults: A systematic review and meta-analysis.

Authors:  Tong Lin; Yinhe Cai; Liting Tang; Youwei Lian; Min Liu; Chaonan Liu
Journal:  J Diabetes Investig       Date:  2022-05-06       Impact factor: 3.681

9.  Islet Function and Insulin Sensitivity in Latent Autoimmune Diabetes in Adults Taking Sitagliptin: A Randomized Trial.

Authors:  Lin Yang; Huiying Liang; Xinyuan Liu; Xia Wang; Ying Cheng; Yunjuan Zhao; Lingjiao Liu; Gan Huang; Xiangbing Wang; Zhiguang Zhou
Journal:  J Clin Endocrinol Metab       Date:  2021-03-25       Impact factor: 5.958

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.