Literature DB >> 29882512

SOXF factors regulate murine satellite cell self-renewal and function through inhibition of β-catenin activity.

Frédéric Auradé1, Despoina Mademtzoglou2,3,4, Sonia Alonso-Martin2,3,4, Anne Rochat1, Peter S Zammit5, Frédéric Relaix2,3,4,6,7.   

Abstract

Muscle satellite cells are the primary source of stem cells for postnatal skeletal muscle growth and regeneration. Understanding genetic control of satellite cell formation, maintenance, and acquisition of their stem cell properties is on-going, and we have identified SOXF (SOX7, SOX17, SOX18) transcriptional factors as being induced during satellite cell specification. We demonstrate that SOXF factors regulate satellite cell quiescence, self-renewal and differentiation. Moreover, ablation of Sox17 in the muscle lineage impairs postnatal muscle growth and regeneration. We further determine that activities of SOX7, SOX17 and SOX18 overlap during muscle regeneration, with SOXF transcriptional activity requisite. Finally, we show that SOXF factors also control satellite cell expansion and renewal by directly inhibiting the output of β-catenin activity, including inhibition of Ccnd1 and Axin2. Together, our findings identify a key regulatory function of SoxF genes in muscle stem cells via direct transcriptional control and interaction with canonical Wnt/β-catenin signaling.
© 2018, Alonso-Martin et al.

Entities:  

Keywords:  SoxF; adult stem cells; developmental biology; mouse; regenerative medicine; satellite cells; self-renewal; skeletal muscle regeneration; stem cells; ß-catenin

Mesh:

Substances:

Year:  2018        PMID: 29882512      PMCID: PMC6021169          DOI: 10.7554/eLife.26039

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Maintenance, repair, and regeneration of adult tissues rely on a small population of stem cells, which are maintained by self-renewal and generate tissue-specific differentiated cell types (Weissman, 2000). Most adult stem cells are quiescent within their niche, dividing infrequently to generate both a copy of the stem cell and a rapidly cycling cell (Barker et al., 2010). These features make adult stem cells essential for either normal tissue homeostasis or repair/regeneration following damage (Slack, 2000). Hence, identification and manipulation of stem cells, including understanding mechanisms of cell fate decision and self-renewal, are essential to develop stem cell-based therapeutic strategies (Relaix, 2006). Skeletal muscle contains a population of resident stem cells - termed satellite cells (Katz, 1961; Mauro, 1961). Around birth, fetal muscle progenitor cells adopt a satellite cell position, becoming embedded within the basal lamina in close contact to the muscle fibers (Ontell and Kozeka, 1984; Relaix et al., 2005). Importantly, during postnatal growth, the emerging satellite cells progressively enter quiescence, a molecular state poorly characterized in vivo. However, in response to injury or disruption of the basal lamina, satellite cells are activated and proliferate to form myoblasts that either fuse to existing myofibers to repair, or fuse together to form multinucleated de novo myotubes for regeneration. Alternatively, a subset of satellite cells self-renews to maintain a residual pool of quiescent stem cells that has the capability of supporting additional rounds of growth and regeneration (Zammit et al., 2006). Satellite cells are indispensable for muscle recovery after injury, confirming their pivotal and non-redundant role as skeletal muscle stem cells (reviewed in Relaix and Zammit, 2012). Many studies have demonstrated a balance between extrinsic cues and intracellular signaling pathways to preserve stem cell function, with Notch and Wnt signaling being of particular importance (Brack and Rando, 2012; Dumont et al., 2015). Wnt signaling has been extensively studied in satellite cells (Brack et al., 2008; Kuang et al., 2008). Whereas canonical Wnt signaling, implying β-catenin/TCF activation, is upregulated upon muscle regeneration and regulates satellite cell differentiation (Otto et al., 2008; von Maltzahn et al., 2012), non-canonical Wnt signaling (independent of β-catenin), mediates satellite cell self-renewal and muscle fiber growth (Le Grand et al., 2009; von Maltzahn et al., 2012). However, how Wnt signaling pathways interact with intrinsic transcriptional regulators remains unclear. Therefore, identifying the transcriptomic changes in muscle progenitors and satellite cells through development, growth and maturity is fundamental in order to build a comprehensive model of satellite cell formation and function (Alonso-Martin et al., 2016). Focusing on the important transition from developmental to postnatal myogenesis, we identified the SOXF family (SOX7, SOX17, SOX18) as potentially having a pivotal role in muscle stem cell function (Alonso-Martin et al., 2016). SOX factors belong to the high mobility group (HMG) superfamily of transcription factors (Bernard and Harley, 2010), and act in the specification of stem cells in a number of tissues during development (Irie et al., 2015; Lizama et al., 2015). SOX17 plays important roles in development, particularly in embryonic stem cells (Sarkar and Hochedlinger, 2013; Séguin et al., 2008) and endoderm formation (Hudson et al., 1997; Kanai et al., 1996), and is critical for spermatogenesis (Kanai et al., 1996) and specification of human primordial germ cell fate (Irie et al., 2015). SOX17 is also implicated in stem cell homeostasis in adult hematopoietic tissues and in cancer (Corada et al., 2013; He et al., 2011; Lange et al., 2009; Ye et al., 2011). SOX7 shares a role in endoderm formation with SOX17, and interestingly, genetic interaction of Sox7 with Sox17 has been recently reported in developmental angiogenesis (Kim et al., 2016; Shiozawa et al., 1996; Takash et al., 2001). Finally, loss of SOX18 leads to cardiovascular and hair follicle defects (Pennisi et al., 2000). Moreover, SOX18 together with SOX7 and SOX17 regulates vascular development in the mouse retina (Zhou et al., 2015). While SoxF genes play key functions in different stem cell systems, little is known of their role in myogenesis. Here, using a set of ex vivo and in vivo experiments including genetic ablation and regeneration studies, we demonstrate that these factors regulate skeletal muscle stem cell self-renewal as well as satellite cell-driven postnatal growth and muscle regeneration. Moreover, we show that SOXF factors operate via interaction with β-catenin in myogenic cells to modulate the output of Wnt canonical signaling during postnatal myogenesis.

Results

SoxF gene expression parallels satellite cell emergence and promotes satellite cell self-renewal

To characterize the formation, establishment and maintenance of satellite cells, we performed a chronological global transcriptomic profiling in embryonic, fetal, and postnatal muscle progenitors and satellite cells (Alonso-Martin et al., 2016). These cells were prospectively isolated from a Pax3 population, with minimal contamination of endothelial cells, as previously reported (Alonso-Martin et al., 2016) (Figure 1—figure supplement 1). Focusing on establishment of satellite cells, we identified the SOXF family (SOX7, SOX17, SOX18) of transcriptional regulators as likely key regulators of satellite cell function.
Figure 1—figure supplement 1.

Minimal CD31+ cell contamination in FACS-isolated skeletal muscle stem cells.

Pax3 trunk muscles from adult mice were digested in a solution of collagenase/dispase, filtered, and immunolabeled for the endothelial cell marker CD31-PE (Phycoerythrin fluorochrome) before FACS. (A) Gating for CD31-PE/GFP. (B) Gating for single cell (SSC-side scatter)/GFP. (C) Histograms and gating for cell number/CD31+ cells in GFP- and GFP+ cell fractions. (D) Graphic illustrating the proportion of CD31+ cells. n = 3. Data expressed as mean ± s.e.m.

Strikingly, SoxF genes are barely detectable during embryonic and fetal stages (Figure 1A–B) but are induced at onset of the emergence of satellite cells and robustly expressed in postnatal satellite cells at the transcript and protein level (Figure 1A–C).
Figure 1.

SoxF genes are induced at onset of satellite cell emergence and regulate adult myogenesis.

(A,B) Expression levels of SoxF genes (Sox7, Sox17, Sox18) in FACS-isolated Pax3 cells from Affymetrix expression analysis (A) and RT-qPCR (B). E, Embryonic day; P, Postnatal day; MO, age in months. (C) Representative immunolabeling of a satellite cell (PAX7+) co-expressing SOX17 on a freshly isolated adult myofiber (T0). Scale bar, 10 μm. Nuclei are counterstained with DAPI. (D) Expression profile of fresh FACS-sorted and cultured satellite cells for quiescence (Pax7), activation/commitment (Myod, Myog), proliferation (Ki67), terminal differentiation (Myh1), and for SoxF (Sox7, Sox17, Sox18) transcripts. Quiesc., quiescence; Prolif., proliferation; Diff., differentiation conditions. n = 3 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m.

Pax3 trunk muscles from adult mice were digested in a solution of collagenase/dispase, filtered, and immunolabeled for the endothelial cell marker CD31-PE (Phycoerythrin fluorochrome) before FACS. (A) Gating for CD31-PE/GFP. (B) Gating for single cell (SSC-side scatter)/GFP. (C) Histograms and gating for cell number/CD31+ cells in GFP- and GFP+ cell fractions. (D) Graphic illustrating the proportion of CD31+ cells. n = 3. Data expressed as mean ± s.e.m.

SoxF genes are induced at onset of satellite cell emergence and regulate adult myogenesis.

(A,B) Expression levels of SoxF genes (Sox7, Sox17, Sox18) in FACS-isolated Pax3 cells from Affymetrix expression analysis (A) and RT-qPCR (B). E, Embryonic day; P, Postnatal day; MO, age in months. (C) Representative immunolabeling of a satellite cell (PAX7+) co-expressing SOX17 on a freshly isolated adult myofiber (T0). Scale bar, 10 μm. Nuclei are counterstained with DAPI. (D) Expression profile of fresh FACS-sorted and cultured satellite cells for quiescence (Pax7), activation/commitment (Myod, Myog), proliferation (Ki67), terminal differentiation (Myh1), and for SoxF (Sox7, Sox17, Sox18) transcripts. Quiesc., quiescence; Prolif., proliferation; Diff., differentiation conditions. n = 3 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m.

Minimal CD31+ cell contamination in FACS-isolated skeletal muscle stem cells.

Pax3 trunk muscles from adult mice were digested in a solution of collagenase/dispase, filtered, and immunolabeled for the endothelial cell marker CD31-PE (Phycoerythrin fluorochrome) before FACS. (A) Gating for CD31-PE/GFP. (B) Gating for single cell (SSC-side scatter)/GFP. (C) Histograms and gating for cell number/CD31+ cells in GFP- and GFP+ cell fractions. (D) Graphic illustrating the proportion of CD31+ cells. n = 3. Data expressed as mean ± s.e.m. To examine whether SOXF factors were present specifically in quiescent satellite cells, we performed primary culture experiments in proliferation and differentiation conditions. We isolated freshly FACS-sorted quiescent satellite cells and compared their expression profile to those undergoing culture (Figure 1D). Whereas activation (Myod), proliferation (Ki67), and differentiation (Myog, Myh1) transcripts were all induced in culture conditions, SoxF were predominately detectable in quiescent (Pax7) satellite cells (Figure 1D). To characterize the role of SOXF factors in satellite cell function, we used the myofiber culture model, which maintains a functional niche for skeletal muscle stem cells while allowing their observation (Zammit et al., 2004). We generated retroviruses encoding a bi-cistronic expression for full-length SOX7FL, SOX17FL or SOX18FL, or transactivation defective SOX7ΔCt, SOX17ΔCt or SOX18ΔCt proteins (Figure 2—figure supplement 1A), together with GFP to identify transduced cells. As SOXF proteins share the same consensus DNA binding sequence, any SOXFΔCt is expected to behave as a dominant negative for all three transcription factors (Hou et al., 2017). Retrovirus encoding IRES-GFP only was used as a control (CTRL). Overexpression of any of the SoxF genes (SOXF-FL) induced a similar phenotype in satellite cells, increasing the pool of self-renewing satellite cells (PAX7+/GFP+) (Figure 2A–D), concomitant with less activation (MYOD+/GFP+) (Figure 2E–H), proliferation (KI67+/GFP+) (Figure 2I–L), and differentiation (MYOG+/GFP+) (Figure 2—figure supplement 1C–F). All PAX7+/GFP+ cells underwent at least one division after exiting their quiescent state, as shown by EdU incorporation in transduced GFP+ cells (Figure 2—figure supplement 1B). This SOXF overexpression in satellite cells parallels the effects observed in other stem cell types, such as adult hematopoietic progenitors (He et al., 2011). Conversely, expression of transactivation defective SOXFΔCt caused a decrease in self-renewal (PAX7+/GFP+) (Figure 2A–D) and promoted proliferation (MYOD+/GFP+, KI67+/GFP+) of satellite cells (Figure 2E–H and I–L), but had no measurable effect on differentiation (MYOG+/GFP+) (Figure 2—figure supplement 1C–F). Taken together, these results show that SoxF genes promote self-renewal of adult muscle stem cells and their return to a mitotically quiescent state.
Figure 2—figure supplement 1.

SoxF gene function in satellite cell homeostasis.

(A) Protein structure of SOXF constructs. SOXF-FL refers to full-length protein; SOXFΔCt to C-terminal deletion of the protein retaining only the DNA binding site (HMG domain); and SOXFΔBCAT to deletion of the β-catenin binding site, conserving the HMG and transactivation (TA) domains of the protein. aa, amino acids. (B) Quantification of transduced satellite cells on myofibers with SOXF-FL and SOXFΔCt-encoding retroviruses, after 48 hr in culture, treated with EdU for 72 hr. (C) Representative images of satellite cells on myofibers overexpressing SOX17 (SOX17FL) or the mutant SOX17ΔCt, after 72 hr in culture (T72). Scale bar, 20 μm. CTRL, retrovirus econding just eGFP. GFP indicates transduced cells. Nuclei are counterstained with DAPI (blue). (D–F) Quantification of the transduced satellite cells illustrated in (C) showing the effects on differentiation (MYOG; myogenin). n ≥ 50 fibers/EDL per condition; ≥1000 satellite cells/EDL. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: ***, p<0.001, compared to CTRL.

Figure 2.

SOXF factors modulate satellite cell behavior.

(A–E–I) Immunofluorescence of satellite cells transduced with SOXF-encoding retroviruses after 72 hr in culture on isolated adult wild type EDL myofibers. SOXF-FL, construct overexpressing SOXF; SOXFΔCt, altered construct lacking the C-terminus (preserving the HMG DNA binding domain); CTRL, encoding just eGFP. GFP marks transduced cells. Nuclei are counterstained with DAPI (blue). Scale bars, 20 μm. (B–D, F–H, J–L) Quantification of the transduced satellite cells illustrated in (A–E–I) for quiescence (PAX7), activation (MYOD), and proliferation (KI67), compared to CTRL. n ≥ 50 fibers/EDL per condition; ≥1000 satellite cells/EDL. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL.

(A) Protein structure of SOXF constructs. SOXF-FL refers to full-length protein; SOXFΔCt to C-terminal deletion of the protein retaining only the DNA binding site (HMG domain); and SOXFΔBCAT to deletion of the β-catenin binding site, conserving the HMG and transactivation (TA) domains of the protein. aa, amino acids. (B) Quantification of transduced satellite cells on myofibers with SOXF-FL and SOXFΔCt-encoding retroviruses, after 48 hr in culture, treated with EdU for 72 hr. (C) Representative images of satellite cells on myofibers overexpressing SOX17 (SOX17FL) or the mutant SOX17ΔCt, after 72 hr in culture (T72). Scale bar, 20 μm. CTRL, retrovirus econding just eGFP. GFP indicates transduced cells. Nuclei are counterstained with DAPI (blue). (D–F) Quantification of the transduced satellite cells illustrated in (C) showing the effects on differentiation (MYOG; myogenin). n ≥ 50 fibers/EDL per condition; ≥1000 satellite cells/EDL. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: ***, p<0.001, compared to CTRL.

SOXF factors modulate satellite cell behavior.

(A–E–I) Immunofluorescence of satellite cells transduced with SOXF-encoding retroviruses after 72 hr in culture on isolated adult wild type EDL myofibers. SOXF-FL, construct overexpressing SOXF; SOXFΔCt, altered construct lacking the C-terminus (preserving the HMG DNA binding domain); CTRL, encoding just eGFP. GFP marks transduced cells. Nuclei are counterstained with DAPI (blue). Scale bars, 20 μm. (B–D, F–H, J–L) Quantification of the transduced satellite cells illustrated in (A–E–I) for quiescence (PAX7), activation (MYOD), and proliferation (KI67), compared to CTRL. n ≥ 50 fibers/EDL per condition; ≥1000 satellite cells/EDL. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL.

SoxF gene function in satellite cell homeostasis.

(A) Protein structure of SOXF constructs. SOXF-FL refers to full-length protein; SOXFΔCt to C-terminal deletion of the protein retaining only the DNA binding site (HMG domain); and SOXFΔBCAT to deletion of the β-catenin binding site, conserving the HMG and transactivation (TA) domains of the protein. aa, amino acids. (B) Quantification of transduced satellite cells on myofibers with SOXF-FL and SOXFΔCt-encoding retroviruses, after 48 hr in culture, treated with EdU for 72 hr. (C) Representative images of satellite cells on myofibers overexpressing SOX17 (SOX17FL) or the mutant SOX17ΔCt, after 72 hr in culture (T72). Scale bar, 20 μm. CTRL, retrovirus econding just eGFP. GFP indicates transduced cells. Nuclei are counterstained with DAPI (blue). (D–F) Quantification of the transduced satellite cells illustrated in (C) showing the effects on differentiation (MYOG; myogenin). n ≥ 50 fibers/EDL per condition; ≥1000 satellite cells/EDL. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: ***, p<0.001, compared to CTRL.

SOX17 is required for satellite cell quiescence and myofiber maturation

Considering the important role of SOX17 in cell stemness and cell fate decisions (Chhabra and Mikkola, 2011; Irie et al., 2015; McDonald et al., 2014), we chose to investigate its function in postnatal skeletal muscle satellite cells in vivo. Since Sox17 mutant mice die during development (Kim et al., 2007), we combined a null Sox17 reporter allele (Sox17) with a conditional Sox17 allele to perform tissue-specific genetic ablation of Sox17: intercrossing with Pax3 mice to achieve lineage-specific Sox17 deletion during development and consequently postnatally, or Pax7 mice for an inducible adult satellite-cell-specific deletion. Pax3 mutant mice had no obvious differences in body or muscle weight during postnatal growth or in adulthood (Figure 3—figure supplement 1A–C). Yet, Sox17-knockout Soleus muscle in adult Pax3 mice contained more myofibers, but with reduced cross-sectional area (Figure 3A–D). Myofibers from Pax3 also had a lower myonuclei density (Figure 3E), suggesting that Sox17-deficient muscles have less satellite cells contributing to postnatal muscle growth (White et al., 2010; Yin et al., 2013; Zammit, 2008). Indeed, direct quantification using PAX7 or MCAD immunolabeling, including reduction of Pax7 transcripts, revealed that there were fewer satellite cells in Pax3 muscles (Figure 4A,B,D and Figure 4—figure supplement 1). Interestingly, this reduction was already evident by two weeks of postnatal growth (Figure 4B), a time when a significant proportion of satellite cells are becoming quiescent, forming the pool of adult muscle stem cells. Finally, consistent with our myofiber culture experiments (Figure 2), we found that the decrease in muscle stem cells in Sox17-knockout mice was associated with a striking decrease of quiescent cells (Figure 4C). Instead, an increased proportion of satellite cells expressed PAX7 and MYOD (18.3% vs. 3.4% in controls) in Sox17-knockout mutants, and thus were activated, and 16.8% even expressed just MYOD (compared to 2.4% in controls), indicating that they were potentially entering the differentiation program (Figure 4C).
Figure 3—figure supplement 1.

Muscle characterization in control and Sox17-knockout mice.

(A–C) Relative weight of different muscles (muscle weight/total body weight) in two-week-old (P14) (A) and two-month-old adult (B) male mice, and total body weight in grams (C). TA, Tibialis anterior, EDL; Extensor digitorum longus. CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL.

Figure 3.

Sox17-knockout during prenatal establishment of satellite cells modifies adult myofiber content and morphology.

(A) Representative Soleus muscle cryosection images of adult control and Sox17 mutant mice. Immunofluorescence was performed with LAMININ to identify the myofibers. Higher magnification is shown in the boxed area. Scale bar, 200 µm. (B–C) Quantification of myofiber number (B) and cross-sectional area in µm2 (C). (D) Distribution of the cross-sectional myofiber area in µm2. ‘Poly.’, polynomial curve fitting the distribution of myofiber size. (E) Quantification of myonuclei number per 100 fibers in adult Soleus cross-sections from control and Sox17-knockout mice. CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: ***, p<0.001, compared to CTRL.

(A–C) Relative weight of different muscles (muscle weight/total body weight) in two-week-old (P14) (A) and two-month-old adult (B) male mice, and total body weight in grams (C). TA, Tibialis anterior, EDL; Extensor digitorum longus. CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL.

(A) Schematic outline of the experimental procedure for tamoxifen (TMX) injection (i.p., intraperitoneal). d, days. (B) Representative images of the histological characterization from adult resting Soleus muscles at d21 after TMX treatment: Hematoxylin and eosin (left panel), Oil red O (middle panel), and Sirius red (left panel) staining. Scale bars, 100 μm. CTRL, Sox17; cKO, Pax7. n ≥ 3 mice.

Figure 4.

SOX17 is necessary to maintain satellite cell quiescence in adult muscles.

(A,F) Representative Soleus cryosection images showing immunofluorescence for satellite cells (PAX7+, arrows) in Pax3 and Pax7 mice, with appropriate controls. Scale bars, 25 μm. Fibers are identified by LAMININ and nuclei are counterstained with DAPI. (B,G) Quantification of satellite cell number during postnatal growth (P14) and in adult. (C) Quantification of the ratio PAX7/MYOD+ satellite cells in P14 Soleus cryosections. (D) RT-qPCR analysis on adult TA muscles for Pax7 and SoxF genes in fresh FACS-isolated satellite cells from control and Sox17-knockout mice. (A–D) CTRL, Sox17; KO, Pax3. (E) Schematic outline of the experimental procedure for tamoxifen (TMX) injection (i.p., intraperitoneal) in Sox17 (CTRL) and Pax7 (cKO) mice. d, days. (E–G) CTRL, Sox17; cKO, Pax7. Quantification was performed in whole cross-sections. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05; **, p<0.01, compared to CTRL.

(A) Immunofluorescence of satellite cells (MCAD; M-cadherin) in adult Soleus cryosections from control and Sox17 mutant mice. Scale bar, 25 μm. (B) Quantification of satellite cell number illustrated in (A). CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05, compared to CTRL.

Figure 4—figure supplement 1.

Satellite cells characterization of control and Sox17-knockout mice.

(A) Immunofluorescence of satellite cells (MCAD; M-cadherin) in adult Soleus cryosections from control and Sox17 mutant mice. Scale bar, 25 μm. (B) Quantification of satellite cell number illustrated in (A). CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05, compared to CTRL.

Sox17-knockout during prenatal establishment of satellite cells modifies adult myofiber content and morphology.

(A) Representative Soleus muscle cryosection images of adult control and Sox17 mutant mice. Immunofluorescence was performed with LAMININ to identify the myofibers. Higher magnification is shown in the boxed area. Scale bar, 200 µm. (B–C) Quantification of myofiber number (B) and cross-sectional area in µm2 (C). (D) Distribution of the cross-sectional myofiber area in µm2. ‘Poly.’, polynomial curve fitting the distribution of myofiber size. (E) Quantification of myonuclei number per 100 fibers in adult Soleus cross-sections from control and Sox17-knockout mice. CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: ***, p<0.001, compared to CTRL.

Muscle characterization in control and Sox17-knockout mice.

(A–C) Relative weight of different muscles (muscle weight/total body weight) in two-week-old (P14) (A) and two-month-old adult (B) male mice, and total body weight in grams (C). TA, Tibialis anterior, EDL; Extensor digitorum longus. CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL.

Muscle characterization in control and Sox17-conditional knockout mice.

(A) Schematic outline of the experimental procedure for tamoxifen (TMX) injection (i.p., intraperitoneal). d, days. (B) Representative images of the histological characterization from adult resting Soleus muscles at d21 after TMX treatment: Hematoxylin and eosin (left panel), Oil red O (middle panel), and Sirius red (left panel) staining. Scale bars, 100 μm. CTRL, Sox17; cKO, Pax7. n ≥ 3 mice.

SOX17 is necessary to maintain satellite cell quiescence in adult muscles.

(A,F) Representative Soleus cryosection images showing immunofluorescence for satellite cells (PAX7+, arrows) in Pax3 and Pax7 mice, with appropriate controls. Scale bars, 25 μm. Fibers are identified by LAMININ and nuclei are counterstained with DAPI. (B,G) Quantification of satellite cell number during postnatal growth (P14) and in adult. (C) Quantification of the ratio PAX7/MYOD+ satellite cells in P14 Soleus cryosections. (D) RT-qPCR analysis on adult TA muscles for Pax7 and SoxF genes in fresh FACS-isolated satellite cells from control and Sox17-knockout mice. (A–D) CTRL, Sox17; KO, Pax3. (E) Schematic outline of the experimental procedure for tamoxifen (TMX) injection (i.p., intraperitoneal) in Sox17 (CTRL) and Pax7 (cKO) mice. d, days. (E–G) CTRL, Sox17; cKO, Pax7. Quantification was performed in whole cross-sections. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05; **, p<0.01, compared to CTRL.

Satellite cells characterization of control and Sox17-knockout mice.

(A) Immunofluorescence of satellite cells (MCAD; M-cadherin) in adult Soleus cryosections from control and Sox17 mutant mice. Scale bar, 25 μm. (B) Quantification of satellite cell number illustrated in (A). CTRL, Sox17; KO, Pax3. n ≥ 4 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05, compared to CTRL. Conditional knockout of Sox17 specifically in adult satellite cells caused a similar loss of satellite cells as soon as three weeks after tamoxifen injection in Pax7 mutant mice (Figure 4E–G). Myofiber content and morphology was not affected in satellite-cell-specific Sox17-conditional knockout (Pax7) adult mutant mice though (Figure 3—figure supplement 2), suggesting that the phenotype in Pax3 mice was linked to impaired early postnatal growth and satellite cell-derived myonuclear accretion (White et al., 2010). These results demonstrate that SOX17 plays an important role in induction and maintenance of satellite cell quiescence.
Figure 3—figure supplement 2.

Muscle characterization in control and Sox17-conditional knockout mice.

(A) Schematic outline of the experimental procedure for tamoxifen (TMX) injection (i.p., intraperitoneal). d, days. (B) Representative images of the histological characterization from adult resting Soleus muscles at d21 after TMX treatment: Hematoxylin and eosin (left panel), Oil red O (middle panel), and Sirius red (left panel) staining. Scale bars, 100 μm. CTRL, Sox17; cKO, Pax7. n ≥ 3 mice.

Myogenic stem cell function is impaired during muscle regeneration in Sox17-deficient mice

To evaluate the role of SOX17 during satellite cell activation, renewal and differentiation in vivo, we carried out skeletal muscle regeneration assays. Following cardiotoxin (CTX)-induced regeneration in Tibialis anterior (TA) muscle of wild type mice, we first assessed the dynamics of SoxF gene expression by RT-qPCR in total injured muscle. We observed progressive up-regulation of SoxF genes, with distinct peaks at days (d) 4, 6, and 15 following injury (Figure 5—figure supplement 1A). Noticeably, d4 and d6 expression peaks coincided with increased levels of satellite cell markers such as Pax7 and Myf5 (Figure 5—figure supplement 1B), and at d4 with the myogenic regulatory factors Myod and Myog (Figure 5—figure supplement 1C), which mark activated satellite cells in the process of proliferation and differentiation to form new myofibers. Specific isolation of satellite cells using Tg:Pax7-nGFP (Rocheteau et al., 2012) through muscle regeneration depicts an identical behavior of all SoxF transcripts, being downregulated upon injury, and induced as regeneration proceeds (Figure 5A). SoxF genes and Pax7 display a similar profile, contrary to commitment and differentiation markers (Myod and Myog, Figure 5—figure supplement 1D), inferring that SOXF have stem cell specific activity during regenerative myogenesis (Figure 5A).
Figure 5—figure supplement 1.

Gene expression profile during CTX-induced regeneration in adult wild type TA muscles and satellite cells.

(A) SoxF transcripts, (B) specific transcripts of satellite cells, and (C) transcripts marking activation and early differentiation profiling of this stem cell population. Total RNA was extracted on days (d) 0–7, 10, 15, 21, and 28 covering initial, intermediate, and final steps of muscle regeneration from whole muscle (A–C) or FACS-isolated satellite cells (d0–d2–d5–d7) (D). n ≥ 3 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m.

Figure 5.

SOX17 regulates adult muscle regeneration after injury in Pax3 mutant mice.

(A) RT-qPCR analysis of Pax7 and SoxF genes in satellite cells isolated during CTX-induced regeneration in adult wild type TA muscles. d; days post-injury. (B) Representative images of TA muscles 10 days after CTX injection. Scale bar, 5 mm. (C) RT-qPCR of muscle markers 10 days after CTX injection. (D) Representative images of cryosections from regenerating adult TA muscles seven days after injury showing immunofluorescence for PAX7+ cells (quiescent; arrows) and PH3+PAX7+ cells (proliferating, arrowheads). Scale bar, 25 μm. (E) Quantification of satellite cells as illustrated in (D). (F) Quantification of satellite cells (PAX7+) by the end of the regeneration process (d28-CTX). (G) Representative images of the histological characterization of adult TA muscles seven days after injury with Hematoxylin and eosin (cell infiltration; upper panel), Oil red O (fat infiltration; middle panel), and Sirius red (fibrosis; bottom panel) staining. Insets: enlargement of the indicated regions. Scale bars, 100 μm. CTRL, Sox17; KO, Pax3. n ≥ 3 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05, compared to CTRL.

(A) SoxF transcripts, (B) specific transcripts of satellite cells, and (C) transcripts marking activation and early differentiation profiling of this stem cell population. Total RNA was extracted on days (d) 0–7, 10, 15, 21, and 28 covering initial, intermediate, and final steps of muscle regeneration from whole muscle (A–C) or FACS-isolated satellite cells (d0–d2–d5–d7) (D). n ≥ 3 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m.

(A) Quantification of cells per colony in a clonal assay of FACS-isolated satellite cells, from adult control and Sox17-knockout hindlimb muscles, after four days in proliferation conditions. (B) Distribution of the number of colonies of FACS-isolated satellite cells, from adult control and Sox17 hindlimb muscles, as in (A). Poly., polynomial curve fitting the distribution of cell colonies. (C) Schematic outline of the experimental procedure. (D–E) Representative images of the Hematoxylin and eosin (cell infiltration) staining of adult TA muscles 28 days after injury (D), and seven days after second injury (E). Scale bars, 100 μm. CTRL, Sox17; KO, Pax3. n ≥ 3 mice (each in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s t-test: **, p<0.01, compared to CTRL.

SOX17 regulates adult muscle regeneration after injury in Pax3 mutant mice.

(A) RT-qPCR analysis of Pax7 and SoxF genes in satellite cells isolated during CTX-induced regeneration in adult wild type TA muscles. d; days post-injury. (B) Representative images of TA muscles 10 days after CTX injection. Scale bar, 5 mm. (C) RT-qPCR of muscle markers 10 days after CTX injection. (D) Representative images of cryosections from regenerating adult TA muscles seven days after injury showing immunofluorescence for PAX7+ cells (quiescent; arrows) and PH3+PAX7+ cells (proliferating, arrowheads). Scale bar, 25 μm. (E) Quantification of satellite cells as illustrated in (D). (F) Quantification of satellite cells (PAX7+) by the end of the regeneration process (d28-CTX). (G) Representative images of the histological characterization of adult TA muscles seven days after injury with Hematoxylin and eosin (cell infiltration; upper panel), Oil red O (fat infiltration; middle panel), and Sirius red (fibrosis; bottom panel) staining. Insets: enlargement of the indicated regions. Scale bars, 100 μm. CTRL, Sox17; KO, Pax3. n ≥ 3 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: *, p<0.05, compared to CTRL.

Gene expression profile during CTX-induced regeneration in adult wild type TA muscles and satellite cells.

(A) SoxF transcripts, (B) specific transcripts of satellite cells, and (C) transcripts marking activation and early differentiation profiling of this stem cell population. Total RNA was extracted on days (d) 0–7, 10, 15, 21, and 28 covering initial, intermediate, and final steps of muscle regeneration from whole muscle (A–C) or FACS-isolated satellite cells (d0–d2–d5–d7) (D). n ≥ 3 mice (each quantified in triplicate) for all experiments. Data expressed as mean ± s.e.m.

Impaired clonogenic and regenerative potential of Sox17-knockout muscle stem cells.

(A) Quantification of cells per colony in a clonal assay of FACS-isolated satellite cells, from adult control and Sox17-knockout hindlimb muscles, after four days in proliferation conditions. (B) Distribution of the number of colonies of FACS-isolated satellite cells, from adult control and Sox17 hindlimb muscles, as in (A). Poly., polynomial curve fitting the distribution of cell colonies. (C) Schematic outline of the experimental procedure. (D–E) Representative images of the Hematoxylin and eosin (cell infiltration) staining of adult TA muscles 28 days after injury (D), and seven days after second injury (E). Scale bars, 100 μm. CTRL, Sox17; KO, Pax3. n ≥ 3 mice (each in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s t-test: **, p<0.01, compared to CTRL. Regenerating TA muscles in Pax3 mice were strikingly smaller than controls and expressed lower levels of myogenic genes (Figure 5B–C). Furthermore, we observed a loss of quiescence in Sox17-knockout satellite cells after muscle regeneration, likely preventing cells from re-establishing the pool of quiescent satellite cells (Figure 5D–E) so that when regeneration was over, the satellite cell pool was smaller in Sox17-knockout mutants (Figure 5F). Interestingly, when plating fresh FACS-sorted isolated satellite cells in vitro, Sox17-knockout cells proliferated more than control cells, yielding bigger colonies (Figure 5—figure supplement 2A–B). This result mimicked the effect obtained in satellite cells transduced with SOXFΔCt, with increased satellite cell proliferation at the expense of self-renewal (Figure 2). Histological analysis of TA muscles in Pax3 mice at d7 after CTX-induced regeneration revealed cell infiltration, fat accumulation and fibrosis, that were absent in regenerating muscles of control Sox17 mice (Figure 5G), suggesting abnormal regeneration and impaired satellite cell function (Mann et al., 2011; Sambasivan et al., 2011). Moreover, this delay in regeneration was still observed at d28, with signs of cell infiltration still evident (Figure 5—figure supplement 2C–D). However, a second injury at d28 did not exacerbate the phenotype seven days later (Figure 5—figure supplement 2C,E).
Figure 5—figure supplement 2.

Impaired clonogenic and regenerative potential of Sox17-knockout muscle stem cells.

(A) Quantification of cells per colony in a clonal assay of FACS-isolated satellite cells, from adult control and Sox17-knockout hindlimb muscles, after four days in proliferation conditions. (B) Distribution of the number of colonies of FACS-isolated satellite cells, from adult control and Sox17 hindlimb muscles, as in (A). Poly., polynomial curve fitting the distribution of cell colonies. (C) Schematic outline of the experimental procedure. (D–E) Representative images of the Hematoxylin and eosin (cell infiltration) staining of adult TA muscles 28 days after injury (D), and seven days after second injury (E). Scale bars, 100 μm. CTRL, Sox17; KO, Pax3. n ≥ 3 mice (each in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s t-test: **, p<0.01, compared to CTRL.

To confirm that muscle regeneration defect in Pax3 mice was due to satellite cell function compromised by loss of SOX17, we also examined regeneration in TA muscles of Pax7 mice (Figure 6A). Analysis of regeneration at d7 in Sox17-conditional knockout mutants revealed that satellite cell numbers were reduced, with fewer in quiescence (Figure 6B–D). At d28, diminution of the satellite cell pool was confirmed in regenerating muscle of adult conditional Pax7 mutant mice (Figure 6E–G) as observed with Pax3 mice. Again, consistent with the phenotype in Pax3 mice, histological analysis of regenerated Sox17-conditional knockout TA muscles revealed cell infiltration, fat and fibrosis deposition, that were absent in regenerating muscles of control Sox17 mice (Figure 6H–L), confirming abnormal regeneration and impaired satellite cell function in the absence of SOX17.
Figure 6.

SOX17 regulates adult muscle regeneration after injury in Pax7 mutant mice.

(A) Schematic outline of the experimental procedure for tamoxifen (TMX) injection (i.p., intraperitoneal). CTX, cardiotoxin injection; d, days. (B) Representative images of cryosections from regenerating adult TA muscles d7 after injury, showing immunofluorescence for PAX7+ (quiescent, arrows) and PH3+PAX7+ (proliferating, arrowheads) cells. Scale bar, 25 μm. (C–D) Quantification of satellite cells as illustrated in (B). (E) Schematic outline of the experimental procedure for TMX diet. CTX, cardiotoxin injection; d, days. (F) Representative images of cryosections from regenerating adult TA muscles d28 after injury, showing immunofluorescence for PAX7+ (quiescent, arrows) cells. Scale bar, 25 µm. (G) Quantification of satellite cells as illustrated in (F). (H–I) Quantification of the cross-sectional area in µm2 (H) and myofiber number per mm2 (I). (J–K) Quantification of fat infiltration (Oil red O) (J) and fibrosis (Sirius red) (K) indicated as proportion of the stained section (average of five sections per muscle). (L) Representative images of the histological characterization of adult TA muscles 28 days after injury with Hematoxylin and eosin (cell infiltration; upper panel), Oil red O (fat infiltration; middle panel), and Sirius red (fibrosis; bottom panel) staining. Scale bars, 100 µm. CTRL, Sox17; cKO, Pax7. n ≥ 3 mice (each quantified at least in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test (C,D,G) and Mann-Whitney ranking test (H–K): n.s., not significant; *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL.

SOX17 regulates adult muscle regeneration after injury in Pax7 mutant mice.

(A) Schematic outline of the experimental procedure for tamoxifen (TMX) injection (i.p., intraperitoneal). CTX, cardiotoxin injection; d, days. (B) Representative images of cryosections from regenerating adult TA muscles d7 after injury, showing immunofluorescence for PAX7+ (quiescent, arrows) and PH3+PAX7+ (proliferating, arrowheads) cells. Scale bar, 25 μm. (C–D) Quantification of satellite cells as illustrated in (B). (E) Schematic outline of the experimental procedure for TMX diet. CTX, cardiotoxin injection; d, days. (F) Representative images of cryosections from regenerating adult TA muscles d28 after injury, showing immunofluorescence for PAX7+ (quiescent, arrows) cells. Scale bar, 25 µm. (G) Quantification of satellite cells as illustrated in (F). (H–I) Quantification of the cross-sectional area in µm2 (H) and myofiber number per mm2 (I). (J–K) Quantification of fat infiltration (Oil red O) (J) and fibrosis (Sirius red) (K) indicated as proportion of the stained section (average of five sections per muscle). (L) Representative images of the histological characterization of adult TA muscles 28 days after injury with Hematoxylin and eosin (cell infiltration; upper panel), Oil red O (fat infiltration; middle panel), and Sirius red (fibrosis; bottom panel) staining. Scale bars, 100 µm. CTRL, Sox17; cKO, Pax7. n ≥ 3 mice (each quantified at least in triplicate) for all experiments. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test (C,D,G) and Mann-Whitney ranking test (H–K): n.s., not significant; *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL.

Impaired SOXF function leads to severe muscle regeneration defects

Both myofiber culture and in vivo experiments suggested that SOXF factors are involved in satellite cell self-renewal. Alterations of SoxF gene function in myofiber culture experiments yielded stronger phenotypes than in vivo genetic ablation of just Sox17, suggesting a compensatory mechanism between SOX17 and other SOXF proteins. To study such a possible compensatory effect between SOXF members, we performed myofiber culture experiments in control Sox17 and Pax3 mutant mice, and analyzed the effect of expressing each of the SOXF factors (Figure 7A–C). Consistent with the data shown in Figure 4, Sox17 mutant satellite cells displayed reduced self-renewal (PAX7+/GFP+) (Figure 7A, CTRL vs. KO), associated with increased activation (MYOD+/GFP+) (Figure 7B, CTRL vs. KO), and little effect on differentiation (MYOG+/GFP+) (Figure 7C, CTRL vs. KO). Interestingly, transduction with retrovirus encoding either SOX7 or SOX17 rescued this defect in self-renewal, whereas expression of SOX18 was unable to revert this effect (Figure 7A). Moreover, overexpression of SOX7 or SOX17 strongly decreased the number of activated satellite cells, to even lower levels compared to control animals (Figure 7B). Expression of SOX18, however, did not modify the activation status of the cells. Finally, overexpression of each SOXF proteins induced a strong decrease in differentiation (Figure 7C), as previously observed in wild type cells (Figure 2—figure supplement 1C–F). These results demonstrate that overexpression of SOX7 or SOX17, but not SOX18, rescues the quiescence and activation phenotype of Sox17-knockout satellite cells.
Figure 7.

Compensatory effect of SOXF factors in satellite cells on ex vivo culture and in vivo injury-induced regeneration.

(A–C) Quantification of transduced satellite cells with SOXF-encoding retroviruses after 72 hr in culture on EDL isolated myofibers. Adult control satellite cells were transduced with the eGFP-encoding retrovirus (CTRL-RV) and Sox17-knockout cells with CTRL-RV or SOXF-FL. Quiescence (A; PAX7), activation (B; MYOD), and differentiation (C; MYOG) were measured. In red, CTRL vs. KO comparison; in black, KO transduced with CTRL-RV vs. KO transduced with SOXF-FL. n ≥ 30 fibers/EDL per condition; ≥1000 satellite cells/EDL. CTRL, Sox17; KO, Pax3. (D) Schematic outline of the experimental procedure for electroporation into regenerating TA muscle of wild type mice. CTX, cardiotoxin; d, days. (E) Histology characterization by Hematoxylin and eosin (cell infiltration, top panel), Oil red O (fat infiltration, middle panel), and Sirius red (fibrosis, bottom panel) staining of cryosections from electroporated wild type adult TA muscles five days after injury. TA muscles were electroporated with control (CTRL, left) or dominant negative SOX17 construct (SOX17ΔCt, right). Insets show enlarged images of the indicated regions. Quantification of fat infiltration (Oil red O) and fibrosis (Sirius red) are indicated as proportion of stained area. Scale bars, 100 μm. (F) RT-qPCR analysis seven days after CTX injection. n ≥ 3 mice (≥ 5 different areas). Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL-RV in CTRL (red asterisks in A-C), CTRL-RV in KO (black asterisks in A-C) or CTRL (E).

(A) Schematic outline of the experimental procedure. (B–C) Representative images of electroporated wild type adult TA muscles five (B) and ten (C) days (d) after cardiotoxin (CTX) injection. TA muscles were injected with either pCIG (CTRL; green) or pCIG-expressing a dominant negative SOXF construct (SOX17ΔCt; green) (Figure 7), together with TdTomato (red) to identify the electroporated area. Scale bars, 5 mm. (D) Representative images of electroporated muscle cryosections five (left) and ten (right) days after CTX injection. BF, brightfield. n = 3 mice.

Compensatory effect of SOXF factors in satellite cells on ex vivo culture and in vivo injury-induced regeneration.

(A–C) Quantification of transduced satellite cells with SOXF-encoding retroviruses after 72 hr in culture on EDL isolated myofibers. Adult control satellite cells were transduced with the eGFP-encoding retrovirus (CTRL-RV) and Sox17-knockout cells with CTRL-RV or SOXF-FL. Quiescence (A; PAX7), activation (B; MYOD), and differentiation (C; MYOG) were measured. In red, CTRL vs. KO comparison; in black, KO transduced with CTRL-RV vs. KO transduced with SOXF-FL. n ≥ 30 fibers/EDL per condition; ≥1000 satellite cells/EDL. CTRL, Sox17; KO, Pax3. (D) Schematic outline of the experimental procedure for electroporation into regenerating TA muscle of wild type mice. CTX, cardiotoxin; d, days. (E) Histology characterization by Hematoxylin and eosin (cell infiltration, top panel), Oil red O (fat infiltration, middle panel), and Sirius red (fibrosis, bottom panel) staining of cryosections from electroporated wild type adult TA muscles five days after injury. TA muscles were electroporated with control (CTRL, left) or dominant negative SOX17 construct (SOX17ΔCt, right). Insets show enlarged images of the indicated regions. Quantification of fat infiltration (Oil red O) and fibrosis (Sirius red) are indicated as proportion of stained area. Scale bars, 100 μm. (F) RT-qPCR analysis seven days after CTX injection. n ≥ 3 mice (≥ 5 different areas). Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test: ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001, compared to CTRL-RV in CTRL (red asterisks in A-C), CTRL-RV in KO (black asterisks in A-C) or CTRL (E).

Muscle electroporation during injury-induced muscle regeneration.

(A) Schematic outline of the experimental procedure. (B–C) Representative images of electroporated wild type adult TA muscles five (B) and ten (C) days (d) after cardiotoxin (CTX) injection. TA muscles were injected with either pCIG (CTRL; green) or pCIG-expressing a dominant negative SOXF construct (SOX17ΔCt; green) (Figure 7), together with TdTomato (red) to identify the electroporated area. Scale bars, 5 mm. (D) Representative images of electroporated muscle cryosections five (left) and ten (right) days after CTX injection. BF, brightfield. n = 3 mice. To further characterize the redundant activity of SoxF genes in vivo, we took advantage of the dominant negative effect of SOX17∆Ct (Figure 2) to carry out electroporation into regenerating muscle (Figure 7D–F). Two days after CTX injection of wild type TA muscles, we electroporated a bi-cistronic construct co-expressing SOX17ΔCt and GFP (Figure 7D and Figure 7—figure supplement 1), together with a TdTomato reporter that revealed efficient electroporation along the regenerating muscle (Figure 7—figure supplement 1). Post-electroporation, we observed many areas of regenerating muscle devoid of fibers, with accumulation of fat and fibrosis, compared to control, indicating a general failure of muscles to regenerate (Figure 7E). A dramatic reduction in Pax7 expression was associated with the exacerbated phenotype of SOX17ΔCt electroporated into muscle, compared to regeneration in Sox17-knockouts (Figures 5C,G and and 7E–F). These results are consistent with SOXF activity being required for skeletal muscle regeneration and confirm the overlapping role of SOXF members, as previously reported in other tissues (Matsui et al., 2006; Sakamoto et al., 2007; Sarkar and Hochedlinger, 2013).
Figure 7—figure supplement 1.

Muscle electroporation during injury-induced muscle regeneration.

(A) Schematic outline of the experimental procedure. (B–C) Representative images of electroporated wild type adult TA muscles five (B) and ten (C) days (d) after cardiotoxin (CTX) injection. TA muscles were injected with either pCIG (CTRL; green) or pCIG-expressing a dominant negative SOXF construct (SOX17ΔCt; green) (Figure 7), together with TdTomato (red) to identify the electroporated area. Scale bars, 5 mm. (D) Representative images of electroporated muscle cryosections five (left) and ten (right) days after CTX injection. BF, brightfield. n = 3 mice.

Inhibition of β-catenin activity by SOXF factors in muscle stem cells

SOXF and β-catenin (CTNNB1) interact through a site located in the C-terminus of SOXF proteins (Figure 2—figure supplement 1A) and that deletion of this region is sufficient to ablate SOXF - β-catenin interaction (Guo et al., 2008; Sinner et al., 2007; Sinner et al., 2004; Zhang et al., 2005). Moreover, expression of constitutively active β-catenin in satellite cells in vivo leads to reduced myofiber size (Hutcheson et al., 2009; Kuroda et al., 2013), a phenotype similar to that we observe with the ablation of SOX17 in these cells (Figure 3). This suggests that SOXF inhibition of β-catenin activity could be required for muscle homeostasis. Upon activation of Wnt signaling, non-phosphorylated β-catenin is stabilized and translocates to the nucleus where it associates with TCF/LEF transcription factors to regulate target gene expression (MacDonald et al., 2009). We designed two transcriptional reporter assays in C2C12 myoblasts to further characterize the SOXF - β-catenin interaction following β-catenin canonical signaling activation by LiCl (Figure 8A–B). All SOXF proteins individually, strongly activated our novel SoxF reporter, SoxF-B-TKnLacZ (containing five multimerized SOXF consensus binding motifs), demonstrating binding to the same consensus sequence (Figure 8A). Upon β-catenin co-expression with SOXF proteins, SoxF-B-TKnLacZ transactivation was further increased (Figure 8A). Conversely, we explored the role of SOXF proteins on LEF/TCF-β-catenin transcriptional activity (Figure 8B). In this system, β-catenin expression led to a four-fold increase in β-catenin reporter pTOP-TKnLacZ activity, while co-expression of SOXF impaired β-catenin-mediated induction of this reporter (Figure 8B). These functional assays indicate that while β-catenin enhances the transactivation activity of SOXF members, SOXF proteins hinder β-catenin-mediated activation of a TCF/LEF reporter in myogenic cells. Hence, our results imply that SoxF genes modulate β-catenin signaling during myogenesis. Strikingly, expression levels of known target genes of the canonical β-catenin pathway appear modified in Sox17-knockout muscles (Figure 8C). Indeed, Jun, Ccnd1, and Axin2 expression were all increased two- to ten-fold in Sox17 mutant muscles (Figure 8C).
Figure 8.

SoxF genes inhibit β-catenin transcriptional activity to regulate satellite cell behavior.

(A–B) Transactivation of SoxF-B-TKnLacZ (A) and pTOP-TKnLacZ (B) reporters by SOXF and β-catenin in LiCl-treated C2C12 myoblasts. Quantification is expressed as mean of the amount (nmoles) of hydrolyzed ONPG normalized to control (first bar). Comparison of activity with or without β-catenin (A) or with and without SOXF co-expression (B). Relative amounts of transfected DNA are listed below the chart (ng). n ≥ 4 (A); n ≥ 6 (B). (C) Expression profile of β-catenin target genes in adult control and Sox17 mutant TA muscles. Ccnd1, Cyclin-D1. n ≥ 4 mice (each in triplicate). (D) Immunolabeling for β-catenin (β-cat, red) in quiescent (T0, PAX7+, green) and activated (T24, MYOD+, green) satellite cells from adult wild type EDL isolated myofibers. Nuclei are counterstained with DAPI (blue). Scale bar, 50 μm. (E–G) Immunofluorescence of satellite cells transduced with SOXFΔBCAT constructs after 72 hr in culture (T72) in adult wild type EDL isolated myofibers. SOXFΔBCAT, SOXF-encoding retroviruses lacking the binding site for β-catenin; CTRL, encoding just eGFP. GFP indicates transduced cells. Nuclei are counterstained with DAPI (blue). Scale bars, 20 μm. (H–J) Quantification of the transduced satellite cells illustrated in (E–G) for quiescence (PAX7), activation (MYOD), and differentiation (MYOG; myogenin). n ≥ 50 fibers/EDL; ≥1000 satellite cells/EDL. Data expressed as mean ± s.e.m., statistically analyzed with Mann-Whitney ranking test (A–B) or Student’s unpaired t-test (H-J): *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001, compared to absence of β-catenin (A), presence of β-catenin (B) or CTRL retrovirus (H-J).

(A–B) Transactivation of SoxF-B-TKnLacZ reporter by SOXFΔBCAT constructs (A; n ≥ 5) and pTOP-TKnLacZ reporter by SOXF constructs (B; n ≥ 4) in LiCl-treated C2C12 myoblasts. Quantification is expressed as mean of the amount (nmoles) of hydrolyzed ONPG normalized to control (first bar). Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test to the respective FL form: ns, not significant; *, p<0.05; **, p<0.01.

SoxF genes inhibit β-catenin transcriptional activity to regulate satellite cell behavior.

(A–B) Transactivation of SoxF-B-TKnLacZ (A) and pTOP-TKnLacZ (B) reporters by SOXF and β-catenin in LiCl-treated C2C12 myoblasts. Quantification is expressed as mean of the amount (nmoles) of hydrolyzed ONPG normalized to control (first bar). Comparison of activity with or without β-catenin (A) or with and without SOXF co-expression (B). Relative amounts of transfected DNA are listed below the chart (ng). n ≥ 4 (A); n ≥ 6 (B). (C) Expression profile of β-catenin target genes in adult control and Sox17 mutant TA muscles. Ccnd1, Cyclin-D1. n ≥ 4 mice (each in triplicate). (D) Immunolabeling for β-catenin (β-cat, red) in quiescent (T0, PAX7+, green) and activated (T24, MYOD+, green) satellite cells from adult wild type EDL isolated myofibers. Nuclei are counterstained with DAPI (blue). Scale bar, 50 μm. (E–G) Immunofluorescence of satellite cells transduced with SOXFΔBCAT constructs after 72 hr in culture (T72) in adult wild type EDL isolated myofibers. SOXFΔBCAT, SOXF-encoding retroviruses lacking the binding site for β-catenin; CTRL, encoding just eGFP. GFP indicates transduced cells. Nuclei are counterstained with DAPI (blue). Scale bars, 20 μm. (H–J) Quantification of the transduced satellite cells illustrated in (E–G) for quiescence (PAX7), activation (MYOD), and differentiation (MYOG; myogenin). n ≥ 50 fibers/EDL; ≥1000 satellite cells/EDL. Data expressed as mean ± s.e.m., statistically analyzed with Mann-Whitney ranking test (A–B) or Student’s unpaired t-test (H-J): *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001, compared to absence of β-catenin (A), presence of β-catenin (B) or CTRL retrovirus (H-J).

Validation of SOXF constructs.

(A–B) Transactivation of SoxF-B-TKnLacZ reporter by SOXFΔBCAT constructs (A; n ≥ 5) and pTOP-TKnLacZ reporter by SOXF constructs (B; n ≥ 4) in LiCl-treated C2C12 myoblasts. Quantification is expressed as mean of the amount (nmoles) of hydrolyzed ONPG normalized to control (first bar). Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test to the respective FL form: ns, not significant; *, p<0.05; **, p<0.01. In agreement with previous reports (Otto et al., 2008; Rudolf et al., 2016), we observed nuclear β-catenin expression in activated, but not quiescent, satellite cells indicating that induction of canonical signaling is synchronous with the activation of satellite cells (Figure 8D). To assess the functional significance of β-catenin binding to SOXF proteins, retroviral constructs of SOXF lacking β-catenin binding domain (SOXFΔBCAT) were generated (Figure 2—figure supplement 1A). Expression of SOXFΔBCAT in wild type satellite cells ex vivo caused a significant decrease in self-renewal capacity and increased activation (Figure 8E–J). These results mirrored those obtained with SOXFΔCt (Figure 2 and Figure 2—figure supplement 1C–F), demonstrating that this motif is required for normal muscle stem cell function. Importantly, transactivation ability of SOXF∆BCAT mutant constructs on SOXF target genes was retained, as shown using the SoxF-B-TKnLacZ reporter (Figure 8—figure supplement 1A), whereas β-catenin transactivation of pTOP-TKnLacZ was partially restored when compared to SOXF-FL constructs (Figure 8—figure supplement 1B). Thus, interaction between SOXF proteins and β-catenin regulates muscle stem cell behavior following activation.
Figure 8—figure supplement 1.

Validation of SOXF constructs.

(A–B) Transactivation of SoxF-B-TKnLacZ reporter by SOXFΔBCAT constructs (A; n ≥ 5) and pTOP-TKnLacZ reporter by SOXF constructs (B; n ≥ 4) in LiCl-treated C2C12 myoblasts. Quantification is expressed as mean of the amount (nmoles) of hydrolyzed ONPG normalized to control (first bar). Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test to the respective FL form: ns, not significant; *, p<0.05; **, p<0.01.

SOXF factors modulate β-catenin transcriptional activity in satellite cells

To further demonstrate the functional interplay between SOX17 and β-catenin transcriptional activity in myogenic stem cells, single myofiber-associated satellite cells were treated with LiCl. This induction of β-catenin signaling yielded an expansion of the activated satellite cell pool (CTRL, Figure 9A). Overexpression of Sox17 (SOX17FL) abolished the expansion of satellite cells (Figure 9A), while SOX17ΔCt did not affect the enhanced LiCl-driven expansion. Similar results were obtained when using CHIR9902, a specific inhibitor of the Glycogen synthase kinase-3 (GSK3B), which targets β-catenin for degradation (data not shown) (Ying et al., 2008). Our findings point to modulation of cell cycle by SOXF activity: satellite cells fail to acquire quiescence when SOXF function is impaired in vivo and ex vivo. In accord with these observations, the cell cycle regulator Ccnd1 (Cyclin-D1) was up-regulated in Sox17-knockout satellite cells but absent in wild type cells (Figure 8C and Figure 9B). We next investigated how SOXF proteins affect the β-catenin transcriptional regulation of two target genes found increased in Sox17-knockouts, Ccnd1 [also a SOX17 target (Lange et al., 2009)] and Axin2. We designed a cell-based transcriptional reporter assay using either 1 kb of the 5’UTR of Ccnd1 (Ccnd1-nLacZ), encompassing binding motifs for TCF/LEF and SOXF proteins, or 5.6 kb of the proximal Axin2 promoter (Axin2-nLacZ) (Figure 9C–D). β-catenin expression increased activity of both Ccnd1-nLacZ and Axin2-nLacZ reporters following LiCl treatment, while co-expression of SOX17 impaired β-catenin-mediated induction of these two reporters in a dose-dependent manner (Figure 9C–D). SOX7ΔBCAT, lacking the β-catenin binding site, however, was unable to influence activation of either the Ccnd1-nLacZ or Axin2-nLacZ reporters. Accordingly, Axin2 expression levels appeared to be progressively down-regulated at the onset of satellite cells emergence, thus displaying general inverse dynamics to SoxF genes (Figure 9E) (Alonso-Martin et al., 2016).
Figure 9.

SOXF factors inhibit β-catenin target genes.

(A) Effect of β-catenin stabilizer LiCl in adult wild type EDL myofiber cultures, to analyze satellite cell proliferation rate upon transduction with the indicated retroviral constructs. SOXF-FL, construct overexpressing SOXF; SOXFΔCt, SOXF proteins C-terminal deletions preserving the HMG DNA binding domain. n ≥ 50 fibers/EDL; ≥1000 satellite cells/EDL. (B) RT-qPCR of adult quiescent satellite cells. Pax7 is the marker of this stem cell population. SoxF transcripts were detected but not Ccnd1 (Cyclin-D1). n = 3. (C–D) Fold transactivation of Ccnd1 (Ccnd1-nLacZ) (C; n = 3) or Axin2 (Axin2-nLacZ) (D; n = 4) proximal promoters by β-catenin in C2C12 myoblasts co-transfected with SOX7 constructs in presence versus absence of LiCl. Quantification is expressed as mean of the amount (nmoles) of hydrolyzed ONPG normalized to control (first bar). Comparison is related to β-catenin only transfection. Relative amounts of transfected DNA are listed below the chart (ng). (E) Expression levels of Axin2 in FACS-isolated Pax3 cells from Affymetrix expression analysis. E, Embryonic day; P, Postnatal day; MO, age in months. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test (A) or Mann-Whitney ranking test (C–D): ns, not significant; *, p<0.05; ***, p<0.001, compared to absence of LiCl (A, CTRL), SOX17FL (A, LiCL treated CTRL and SOXFΔCt) or β-catenin only transfection (C-D).

SOXF factors inhibit β-catenin target genes.

(A) Effect of β-catenin stabilizer LiCl in adult wild type EDL myofiber cultures, to analyze satellite cell proliferation rate upon transduction with the indicated retroviral constructs. SOXF-FL, construct overexpressing SOXF; SOXFΔCt, SOXF proteins C-terminal deletions preserving the HMG DNA binding domain. n ≥ 50 fibers/EDL; ≥1000 satellite cells/EDL. (B) RT-qPCR of adult quiescent satellite cells. Pax7 is the marker of this stem cell population. SoxF transcripts were detected but not Ccnd1 (Cyclin-D1). n = 3. (C–D) Fold transactivation of Ccnd1 (Ccnd1-nLacZ) (C; n = 3) or Axin2 (Axin2-nLacZ) (D; n = 4) proximal promoters by β-catenin in C2C12 myoblasts co-transfected with SOX7 constructs in presence versus absence of LiCl. Quantification is expressed as mean of the amount (nmoles) of hydrolyzed ONPG normalized to control (first bar). Comparison is related to β-catenin only transfection. Relative amounts of transfected DNA are listed below the chart (ng). (E) Expression levels of Axin2 in FACS-isolated Pax3 cells from Affymetrix expression analysis. E, Embryonic day; P, Postnatal day; MO, age in months. Data expressed as mean ± s.e.m., statistically analyzed with Student’s unpaired t-test (A) or Mann-Whitney ranking test (C–D): ns, not significant; *, p<0.05; ***, p<0.001, compared to absence of LiCl (A, CTRL), SOX17FL (A, LiCL treated CTRL and SOXFΔCt) or β-catenin only transfection (C-D). Together, our data demonstrate that SOXF factors control expansion and self-renewal of adult muscle stem cells, associated with an inhibition of TCF/LEF-β-catenin target genes.

Discussion

We previously performed a global transcriptomic analysis of the changes in gene expression in murine muscle stem cells throughout life (Alonso-Martin et al., 2016). Focusing on the signature associated with establishment and maintenance of satellite cells from their developmental progenitors, we identified SoxF genes, Sox7, Sox17, and Sox18 as of interest. SoxF transcripts become expressed at the time of satellite cell emergence, with a maximum expression in the quiescent adult state, highlighting their role in establishment, maintenance and function of muscle stem cells. Of relevance, SOX17 is involved in cell fate decisions in human primordial germ cells and embryo-derived stem cells (Irie et al., 2015; McDonald et al., 2014). Absence of SOX17 leads to impaired postnatal muscle development, with an increase of smaller fibers. Postnatal muscle fiber hypertrophy depends on the total number of muscle fibers within a muscle; thus, the postnatal growth rate of the individual muscle fiber would be lower when there are more myofibers (Rehfeldt et al., 2000). In addition, the reduction of myonuclei per myofiber suggests that myofiber growth impairment may be due to a reduced contribution of satellite cell fusion (White et al., 2010). Consistent with these findings, we observed fewer satellite cells in Sox17-knockout mice, associated with a loss of quiescence and a reduced stem cell pool in postnatal muscles. Moreover, when SOXF function is impaired in satellite cells, self-renewal capacity is reduced and both activation and proliferation are increased. Satellite cell self-renewal is critical to maintain the pool of the satellite cells, so impairment of this process translates into reduced cell numbers, resulting in defective muscle regeneration in both Pax3 and Pax7 mutant mice, highlighting the specific relevance of SoxF genes postnatally and specifically in adult satellite cells. Moreover, we show that SOXF overexpression in satellite cells inhibits proliferation and differentiation and promotes self-renewal, with SOX17 promoting self-renewal in other stem cell types, such as adult hematopoietic progenitors (Chhabra and Mikkola, 2011; He et al., 2011). Specific genetic ablation of Sox17 leads to milder phenotypes than when dominant negative constructs are used, which suppress transcriptional activation through all SOXF proteins, in myofiber cultures (ex vivo) or injured muscle electroporation (in vivo). Yet, despite apparently normal expression of Sox7 and Sox18 in Sox17 mutant mice (Figure 4D), there is a general loss of quiescence in satellite cells. SoxF genes have been reported to act with redundant functions, as versatile regulators of embryonic development and determination of different stem and progenitor cell fate (Matsui et al., 2006; Sakamoto et al., 2007; Sarkar and Hochedlinger, 2013). However, our data suggest that in muscle stem cells, redundancy between SoxF genes is more complex. For instance, overexpression of SOX7 or SOX17 but not SOX18 is sufficient to rescue the phenotype in Sox17 mutant mice. Recently, a Sox7 mutant mouse has been reported, revealing the genetic interaction of SOX7 with SOX17 in developmental angiogenesis (Kim et al., 2016). Furthermore, during revisions for this study, a muscle-specific ablation of Sox7 (Pax3) was reported, showing upregulation of Sox17 and Sox18 in the absence of Sox7 (Rajgara et al., 2017). Nevertheless, Sox7-deficient muscles demonstrated severe phenotypes in homeostatic and regeneration conditions (Rajgara et al., 2017), similar to Sox17 ablation in myogenic cells (Figures 3–6). Future studies analyzing the impact of ablating both SOX7 and SOX17 for muscle stem cell function will be of interest. Finally, our data link SOXF regulation of satellite cell self-renewal with control of β-catenin activity in satellite cells. Interaction between SOXF and β-catenin has been reported in other cell types, i.e. repression of β-catenin-stimulated expression of dorsal genes (Zorn et al., 1999), regulation of endodermal genes (Sinner et al., 2004), or acting as tumor suppressors antagonizing Wnt/β-catenin signaling (Liu et al., 2016; Sinner et al., 2007; Takash et al., 2001), as well as regulators of this pathway in oligodendrocyte progenitor cells (Chew et al., 2011; Ming et al., 2013). More importantly, our data provide a molecular mechanism for previous reports which demonstrate that a tight regulation of the Wnt/β-catenin canonical signaling output is required to ensure skeletal muscle regeneration (Brack et al., 2008; Brack et al., 2007; Figeac and Zammit, 2015; Murphy et al., 2014; Otto et al., 2008; Parisi et al., 2015; Rudolf et al., 2016; Seale et al., 2003; von Maltzahn et al., 2012). Hence, SOXF factors display a dual activity as both intrinsic regulators of muscle stem cell quiescence and interacting with extrinsic signaling pathways to regulate the expansion of activated muscle stem cells. Moreover, recent findings demonstrate that old satellite cells are incapable of maintaining their normal quiescent state in muscle homeostatic conditions, by switching to an irreversible pre-senescence state (Sousa-Victor et al., 2014). Satellite cells fail to regulate their quiescence with aging, leading to depletion of the pool of stem cells (Blau et al., 2015). Interestingly, satellite cell functional impairment is associated with up-regulation of canonical Wnt/β-catenin (Brack et al., 2008; Brack et al., 2007). Our data therefore points to a potential role of SOXF-β-catenin interaction in this context. In conclusion, we demonstrate that SOXF transcription factors play a key role in stem cell quiescence and myogenesis through both direct transcriptional control and by modulation of the output of β-catenin activity to affect canonical Wnt signaling.

Materials and methods

Mice and animal care

Pax3 mouse strain was previously generated (Relaix et al., 2005). Pax3, Pax7 (Pax7), Tg:Pax7-nGFP, and Sox17 (Sox17 and Sox17) mutant mice were kindly provided by Jonathan A. Epstein, Chen-Ming Fan, Shahragim Tajbakhsh and Sean J. Morrison, respectively (Engleka et al., 2005; Kim et al., 2007; Lepper et al., 2009; Rocheteau et al., 2012). All mice were maintained in a C56BL/6J background.

Animal breeding

Sox17 was inter-crossed to generate Sox17 mice were bred with Pax3 in order to produce Pax3 mutants, and the latter with Sox17 mice to obtain the ablation of Sox17 in the muscle lineage (Pax3). For specific deletion of Sox17 in satellite cells (Pax7) Sox17 and Pax7 mice were crossbred. For recombination induction with the Pax7CreERT2 allele, mice were fed in tamoxifen diet (TD.55125.I, Envigo) or intraperitoneally injected for four consecutive days in the adulthood (Roche-Sigma-Aldrich, St. Quentin Fallavier, France). Littermate Sox17 or Sox17 were used as control animals (CTRL).

Cell sorting and culture

For FACS, muscle samples were isolated from adult mice (forelimb, hindlimb, and trunk muscles). Following dissection, all muscles were minced and incubated in digestion buffer [HBSS (Life Technologies, Saint-Aubin, France), 0.2% BSA (Sigma-Aldrich, St. Quentin Fallavier, France), 2 μg/ml Collagenase A (Roche-Sigma-Aldrich, St. Quentin Fallavier, France), 2.4 U/ml Dispase II (Roche-Sigma-Aldrich, St. Quentin Fallavier, France), 10 ng/mL DNaseI (Roche-Sigma-Aldrich, St. Quentin Fallavier, France), 0.4 mM CaCl2, and 5 mM MgCl2], and purified by filtration using 100 µm and 40 µm cell strainers (BD Falcon, Le Pont de Claix, France). For labeling extracellular antigens, 10 ng/ml of the following antibodies were used: rat anti-mouse CD45-PE-Cy7 (BD, Le Pont de Claix, France), rat anti-mouse Ter119-PE-Cy7 (BD, Le Pont de Claix, France), rat anti-mouse CD34-BV421 (BD, Le Pont de Claix, France), rat anti-mouse integrin-α7-A700 (R and D Systems, Abingdon, UK), rat anti-mouse Sca1-FITC (BD, Le Pont de Claix, France), rat anti-mouse CD31-PE (BD, Le Pont de Claix, France). Muscle cells were stained using LIVE/DEAD® Fixable Blue Dead Cell Stain Kit (Life Technologies, Saint-Aubin, France) to exclude dead cells and purified via FACS Aria II based on TER119 (LY76)-, CD45 (PTPRC, LY5)-, CD34+, SCA1- and gating on the cell fraction integrin-α7+. Satellite cells isolated from either Pax3 or Tg:Pax7-nGFP were obtained using the FITC channel to recover the GFP+ population. Purified satellite cells were plated on 0.1% gelatin-coated dishes at low density for clonal analysis (500 cells/well in four-well plates). The remaining sorted cells were either frozen (quiescent) or plated for RNA extraction (proliferation or differentiation conditions). Cells were allowed to grow in proliferation medium: DMEM Glutamax containing 20% fetal bovine serum, 10% horse serum, 1% penicillinstreptomycin, 1% HEPES, 1% sodium pyruvate (Life Technologies, Saint-Aubin, France), 1/4000 bFGF (20 ng/ml Peprotech, Neuilly-sur-Seine, France) for one week at a density of 1000 cells/cm2, and then switched into differentiation medium (5% HS) for four extra days.

RNA preparation and quantitative PCR

Total RNA from FACS-sorted satellite cells was extracted from independent experiments according to the RNasy Micro Kit (QIAGEN, Courtaboeuf, France) RNA extraction protocol. For whole muscle total RNA, RNeasy Fibrous Tissue Midi Kit (QIAGEN, Courtaboeuf, France) was used. cDNA synthesis was performed using Transcriptor First Strand cDNA Synthesis Kit (Roche-Sigma-Aldrich, St. Quentin Fallavier, France). RNA quality was assessed by spectrophotometry (Nanodrop ND-1000). qPCR reactions were carried out in triplicate using LightCycler 480 SYBR Green I Master (Roche-Sigma-Aldrich, St. Quentin Fallavier, France). Expression of each gene was normalized to that of Hypoxanthine Phosphoribosyltransferase 1 (Hprt1) for total muscle, or TATA Box Protein (TBP) for cultured cells. Results are given as mean ± standard error. The single (*), double (**), triple (***), and quadruple (****) asterisks represent p-values p<0.05, p<0.01 and p<0.001, respectively, for Student’s unpaired t-test. The oligonucleotides used in this study are listed in table 1.
Table 1.

List of primary antibodies used in this study for immunolabeling.

GFP, Green Fluorescent Protein; Ki67, Marker Of Proliferation Ki-67; MyoD1, Myogenic Differentiation 1; Pax7, Paired Box 7; Phospho-Histone H3 (Ser10), for detection of Histone H3 phosphorylated at serine 10; and Sox17, SRY-Box 17.

GenesSequences
Pax75’ – AGGCCTTCGAGAGGACCCAC – 3’ 5’ – CTGAACCAGACCTGGACGCG – 3’
Myf55’ – TGAGGGAACAGGTGGAGAAC – 3’ 5’ – AGCTGGACACGGAGCTTTTA – 3’
Myod5’ – GGCTACGACACCGCCTACTA – 3’ 5’ – GAGATGCGCTCCACTATGCT – 3’
Myog5’ – AGTGAATGCAACTCCCACAG – 3’ 5’ – ACGATGGACGTAAGGGAGTG – 3’
Myh15’ – CCAGGAGGCCCCACCCC – 3’ 5’ – CACAGTCCTCCCGGCCCC – 3’
Ki675’ – CCTGTGAGGCTGAGACATGG – 3’ 5’ – TCTTGAGGCTCGCCTTGATG – 3’
Sox75’ – CTTCAGGGGACAAGAGTTCG – 3’ 5’ – GGGTCTCTTCTGGGACAGTG – 3’
Sox175’ – GCCAAAGACGAACGCAAGCGGT – 3’ 5’ – TCATGCGCTTCACCTGCTTG – 3’
Sox185’ – AACAAAATCCGGATCTGCAC – 3’ 5’ – CGGTACTTGTAGTTGGGATGG – 3’
Ccnd15’ – TTCCTCTCCTGCTACCGCAC – 3’ 5’ – GACCAGCCTCTTCCTCCACTTC – 3’
Jun5’ – TCCCCTATCGACATGGAGTC – 3’ 5’ – TTTTGCGCTTTCAAGGTTTT – 3’
c-myc5’ – GATTCCACGGCCTTCTCTCC – 3’ 5’ – GCCTCTTCTCCACAGACACC – 3’
Axin25’ – AAGAGAAGCGACCCAGTCAA – 3’ 5’ – CTGCGATGCATCTCTCTCTG – 3’
Ppard5’ – ATTCCTCCCCTTCCTCCCTG – 3’ 5’ – ACAATCCGCATGAAGCTCGA – 3’
Hprt15’ – AGGGCATATCCAACAACAAACTT – 3’ 5’ – GTTAAGCAGTACAGCCCCAAA – 3’
TBP5’ – ATCCCAAGCGATTTGCTG – 3’ 5’ – CCTGTGCACACCATTTTTCC – 3’

List of primary antibodies used in this study for immunolabeling.

GFP, Green Fluorescent Protein; Ki67, Marker Of Proliferation Ki-67; MyoD1, Myogenic Differentiation 1; Pax7, Paired Box 7; Phospho-Histone H3 (Ser10), for detection of Histone H3 phosphorylated at serine 10; and Sox17, SRY-Box 17.

Immunolabeling, microscopy and image treatment

Muscles were dissected and snap-frozen in liquid nitrogen-cooled isopentane. Eight µm cryosections were fixed in 4% paraformaldehyde (PFA) and immunofluorescence was carried out as previously described (Mitchell et al., 2010). Primary antibodies and used dilutions are summarized in table 2.
Table 2.

List of qPCR oligonucleotides used in this study

Pax7, Paired Box 7; Myf5, Myogenic Factor 5; Myod1, Myogenic Differentiation 1; Myog, Myogenin; Myh1, Myosin Heavy Chain 1; Ki67, Marker Of Proliferation Ki-67; Sox7, SRY-Box 7; Sox17, SRY-Box 17; Sox18, SRY-Box 18; Ccnd1, Cyclin D1; Jun, Jun Proto-Oncogene, AP-1 Transcription Factor Subunit; c-myc, MYC Proto-Oncogene, BHLH Transcription Factor; Axin2, Axin2; Ppard, Peroxisome Proliferator Activated Receptor Delta; Hprt1, Hypoxanthine Phosphoribosyltransferase 1; and TBP, TATA Box Protein.

AntigenReferenceCompanyIg typeDilution
GFPA11122Life TechnologiesRabbit IgG1:500
GFPab13970AbcamChicken IgY1:500
Ki67556003BD PharmingenMouse IgG11:100
Ki67ab15580AbcamRabbit IgG1:100
LamininL9393Sigma-AldrichRabbit IgG1:100
Laminin (AlexaFluor647)NB300-144AF647Novus BiologicalRabbit IgG1:200
M-CadherinMCAD-12G4nanoToolsMouse IgG11:50
MyoD1, 5.8AM3512DAKOMouse IgG11:50
MyoD, M-318sc-760Santa CruzRabbit IgG1:20
MyogeninF5DDSHBMouse IgG11:100
Pax7PAX7-cDSHBMouse IgG11:20
Pax7sc-81648Santa CruzMouse IgG11:20
Phospho-Histone H3 (Ser10)06–570Merck MilliporeRabbit IgG1:500
Sox17AF1924R and D SystemsGoat IgG1:50

List of qPCR oligonucleotides used in this study

Pax7, Paired Box 7; Myf5, Myogenic Factor 5; Myod1, Myogenic Differentiation 1; Myog, Myogenin; Myh1, Myosin Heavy Chain 1; Ki67, Marker Of Proliferation Ki-67; Sox7, SRY-Box 7; Sox17, SRY-Box 17; Sox18, SRY-Box 18; Ccnd1, Cyclin D1; Jun, Jun Proto-Oncogene, AP-1 Transcription Factor Subunit; c-myc, MYC Proto-Oncogene, BHLH Transcription Factor; Axin2, Axin2; Ppard, Peroxisome Proliferator Activated Receptor Delta; Hprt1, Hypoxanthine Phosphoribosyltransferase 1; and TBP, TATA Box Protein. Secondary antibodies were Alexa 488 goat anti-mouse IgG (H + L), Alexa 546 goat anti-mouse IgG (H + L), Alexa 555 goat anti-mouse IgG (H + L), Alexa 594 goat anti-mouse IgG (H + L), Alexa 488 goat anti-rabbit IgG (H + L), Alexa 594 goat anti-rabbit IgG (H + L), Alexa 594 donkey anti-goat IgG (H + L), Alexa 488 goat anti-Chicken IgY (H + L) (Life Technologies, Saint-Aubin, France), and Cy5-goat anti-rabbit IgG (H + L) (Jackson ImmunoResearch, Suffolk, UK). Nuclei were counterstained with DAPI (Life Technologies, Saint-Aubin, France). Analysis was carried out using either a Leica TCS SPE confocal microscope or a Zeiss AxioImager.Z1 ApoTome (for scanning of whole Soleus cryosections). Images were processed with either Adobe Photoshop CS5 software (Adobe Systems) or MetaMorph 7.5 Software (Molecular Devices). Counting was performed using ImageJ (version 1.47 v; National Institutes of Health, USA, https://imagej.nih.gov/ij/). Transduced satellite cells in myofiber cultures were directly counted under a Leica fluorescent microscope at 40x magnification. Mean ± standard error (s.e.m.) was given. The single (*), double (**), and triple (***) asterisks represent p-values p<0.05, p<0.01, and p<0.001 respectively by Student’s unpaired t-test. All experiments have been performed on at least three independent experiments for each condition. For the characterization of Sox17 mutant mice, 2–5 whole scanned cryosections in at least three different animals (controls and mutants) were analyzed.

Single myofiber isolation, culture and transduction

Single myofiber procedure was performed as previously described (Moyle and Zammit, 2014). Briefly, both Extensor digitorum longus (EDL) muscles were dissected and digested in Collagenase type I (Sigma-Aldrich, St. Quentin Fallavier, France) solution for 1.5 hr. Flushing medium against the digested muscle, myofibers detached from whole muscle and were placed into another culture dish. Fibers were taken at different time points, freshly isolated (T0), and 24 (T24), 48 (T48), and 72 (T72) hours after culture in activation medium [DMEM High Glucose (Life Technologies, Saint-Aubin, France), 10% horse serum (Life Technologies, Saint-Aubin, France) and 0.5% chicken embryo extract (MP-Biomedical, Illkirch-Graffenstaden, France)] at 37°C in 5% CO2. Retroviral expression vectors and transduction were carried out as previously reported (Zammit et al., 2006). To transduce myofiber-associated satellite cells, 1:10 dilution of the retroviral supernatant was used 24 hr after fiber isolation. Satellite cells were transduced for 48 hr and then recovered for fixation and immunostaining. EdU (2 μM; C10340, Thermo Fisher Scientific, Montigny-le-Bretonneux, France) chase was performed for 72 hr (last 48 hr together with retroviral transduction). EdU-incorporating cells were detected according to the manufacturer’s protocol.

Retroviral cloning

Sox7 and Sox18 cDNAs were amplified by PCR from IMAGE clones 40131228 and 3967084 respectively; Sox17 cDNA was cloned by PCR from mouse kidney cDNA (gift of Dr. J. Hadchouel). All were subcloned in pCig mammalian bi-cistronic expression vector and pMSCV-IRES-eGFP (MIG) retroviral packaging vector using XhoI and EcoRI added to cloning primers (Megason and McMahon, 2002; Pear et al., 1998).

Muscle injury, electroporation, and histology

Control and mutant mice were injected with 40 µL of cardiotoxin (CTX; 10 µM, Latoxan, Portes-lès-Valence, France) in Tibialis anterior (TA) muscles following general anesthesia. Muscles were recovered 7, 10, and 28 days later, to compare control vs. mutant mice; for regeneration expression profile, all days from day 0 up to day 7, and then days 10, 15, 21, and 28. Second injury was performed as above, 28 days after first injury. Muscle electroporation was performed using an Electro Square-Porator ECM 830 (BTX®, Genetronics Inc., Holliston, MA). According to (Sousa-Victor et al., 2014), 40 µg of DNA solutions were injected and TA muscles were electroporated using external plate electrodes two days after CTX injection. TAs were examined five, seven, or ten days later. Seven and 28 days after injury, TA muscles were processed for histology analysis by Hematoxylin and eosin , Oil red O, and Sirius red staining as previously described (Sambasivan et al., 2011).

C2C12 culture and transfection for β-galactosidase reporter assays

C2C12 cells were grown in DMEM High Glucose (Life Technologies, Saint-Aubin, France) supplemented with 10% FBS (Bio West). A total of 1.2 µg DNA was transfected in 105 cells using lipofectamine LTX PLUS reagent (Life Technologies, Saint-Aubin, France). Generated reporters were as follows: SoxF-B-TKnLacZ, five multimerized SOXF consensus binding motifs (annealed oligonucleotides 5'-CAACAATCATCATTGTTGGGGCCAACAATCTACATTGTTCAGA-3' and 5'-TCTGAACAATGTAGATTGTTGGCCCCAACAATGATGATTGTTG-3') (Kanai et al., 1996); β-catenin TOP pTOP-TKnLacZ, six tandem repeats of the TCF/LEF Transcriptional Response Element (Molenaar et al., 1996); Ccnd1-nLacZ, 1 kb of the 5’UTR region, encompassing binding motifs for TCF/LEF and SOXF proteins, was amplified from C57BL/6J genomic DNA (Lange et al., 2009); and Axin2-nLacZ, 5.6 kb of the proximal promoter fragment was excised from Ax2-Luc (gift of Dr. J. Briscoe) and subcloned (Jho et al., 2002). Fixed concentrations of all reporters (0.6 µg) were used. 48 hr after transfection, cells were lysed in 100 µl RIPA buffer supplemented with protease inhibitors (Complete Mini, Roche-Sigma-Aldrich, St. Quentin Fallavier, France). β-galactosidase assays were performed with 10 µl lysates based on 2-Nitrophenyl β-D-galactopyranoside (ONPG) substrate hydrolysis. When indicated, 1 mM LiCl treatment was performed 24 hr post-transfection and carried for 24 hr. Individual transfections were repeated at least three times; measurements are expressed as mean of the amount of ONPG hydrolyzed normalized to control. Error bars correspond to the standard error of the mean (s.e.m.). The single (*), double (**), triple (***), and quadruple (****) asterisks represent p-values p<0.05, p<0.01, p<0.001 and p<0.0001, respectively, for Mann-Whitney statistical test. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "SOXF factors regulate satellite cell self-renewal and function through inhibition of β-catenin activity" for consideration by eLife. Your article has been evaluated by Fiona Watt (Senior Editor) and three reviewers, one of whom, Amy J Wagers (Reviewer #1), is a member of our Board of Reviewing Editors. The following individual involved in review of your submission has also agreed to reveal their identity: Pier Lorenzo Puri (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted the following summary and review. Summary: This manuscript identifies SOXF (SOX7, SOX17, and SOX18) members as highly expressed transcription factors in adult Pax3+ cells and evaluates the role of SOX17 in regulating satellite cell fate through overexpression and loss of function studies using Pax3null mice and electroporation of Sox17 dominant negative constructs. The authors also demonstrate potential interactions between SOXF family members and an effector of canonical Wnt signaling, b-catenin. This paper investigates the role of Sox7, Sox17 and Sox18 (cumulatively, SoxF) in adult muscle satellite cell biology. The authors report developmentally regulated expression of SoxF in muscle and, and further assess the impact of SoxF gain- and loss-of-function on muscle satellite cells in vivo and in vitro using transfection studies and gene-modified mice. They conclude from these studies that SoxF regulate satellite cell "quiescence, self-renewal and differentiation". They further demonstrate significant impairment of muscle regenerative function in animals lacking SoxF (Sox17) function in muscle. Finally, they perform a series of reporter assays that suggest an interaction of SoxF with Wnt signaling (β-catenin). Overall, the work is intriguing for its potential identification of a new class of muscle satellite cell regulators, and particularly the suggestion that SoxF's regulate satellite cell quiescence, a state whose regulation is poorly understood. Still, there are a number of places where the reviewers raised concerns that authors' conclusions may overreach the available data. These are outlined below, and would need to be addressed via new experimentation and revision of the manuscript text. Essential revisions: 1) The data in Figure 1 were obtained from sorted Pax3 cells, where GFP is a reporter for Pax3 expression, not a lineage tracer (Relaix et al., 2006). For adult satellite cell collection this is a problem since, based on the authors' previously published work, Pax3 expression is rare, except in the diaphragm, in adult satellite cells. Furthermore, Pax3 expression is observed in major adult blood vessels in the limbs (Goupille et al., 2011). Based on the Materials and methods (subsection “Cell sorting and culture”, first paragraph), CD31 is not used for negative selection. Since hindlimb, forelimb and trunk muscles were used one cannot be sure what fraction of the cells in Figure 1 are CD31+/Pax3+ blood vessel derived cells. Due to the questions with regards to Pax3 expression and lack of CD31 use, sort profiles with all gates and populations need to be shown to demonstrate how Pax3+ cells were prospectively isolated. Also, they need to report what proportion of the isolated Pax3+ cells used for their studies express Pax7 and what proportion express Sca1 (by immunostaining of isolated cells and FACS), clarify if they used CD31 counterselection in their sorts, and assess the anatomical localization of the cells (sublaminar vs. interstitial) by staining in tissue sections. 2) Throughout the manuscript, the authors often inappropriately conflate self-renewal and quiescence with Pax7 positivity. For example, in reporting the results of retroviral transductions in Figure 2, they claim that overexpression of SoxF promotes "self-renewal", but their data show changes in the frequency of Pax7+ and MyoD+ cells and does not assay self-renewal itself (which would require tracking of either individual cell divisions or minimally of input cell number versus output cell number). Similarly, in Figure 3, the authors have not directly evaluated quiescence, and in Figures 5 and 6, they have not evaluated self-renewal (just Pax7 expression). Finally, the authors' conclusion that "Our findings point to modulation of cell cycle by SOXF activity: satellite cells fail to acquire quiescence when SOXF function is impaired in vivo and ex vivo" is problematic, as in several studies the authors have not directly assessed proliferation or quiescence states, and have only inferred these from pax7/myod expression. For renewal, the authors need to evaluate absolute numbers of Pax7+, MyoD+, and Myog+ cells per fiber. EdU pulse experiments would be helpful as well. An alternative explanation for the Sox7FL effects could be decreased activation as opposed to supporting renewal. Based on the Sox7DN data, are the authors suggesting that loss of Pax7 is coupled to premature differentiation or apoptosis? At 72 hours Myog+ cells are observed yet their proportion does not increase. Depending on the absolute number count per fiber the authors will probably also need to assess apoptosis. 3) A major limitation of the authors' conclusions, which center entirely around the notion that SoxF's exert their influence on muscle repair capacity by regulating transcriptional events in satellite cells themselves is that neither of the models they use to evaluate the in vivo regenerative phenotypes caused by loss of SoxF's are satellite cell specific. For example, the data in Figure 3 are generated from Pax3(Sox17 KO) mice. Although Sox17 is not abundantly expressed in embryonic Pax3+ cells (Figure 1A and 1B), the Cre is and therefore all cells derived from the Pax3 lineage will be disrupted for Sox17. Such Sox17 disrupted cells in addition to satellite cells and derived myogenic progenitors include myonuclei and blood vessel cells(Goupille et al., 2011; Relaix et al., 2006). Therefore, the muscle fiber disruptions such as fiber type transitions and atrophy could reflect Sox17 roles in muscle fibers and blood vessels. Thus, the authors cannot exclude potential influences of SoxF loss in other cell types, and should address this issue using an inducible satellite cell specific model (e.g., Pax7). 4) The manner of myonuclei count (Figure 3F) is not adequate, the authors should obtain dissociated single fibers and count myonuclei along their length (Brack et al., 2005). The assumption is that myonuclear loss reflects loss of satellite cells and derived fusion competent myogenic progenitors. Also, no assessment of myogenic progenitor number or activity (BrdU/EdU) is done at any stage up to adult skeletal muscle ages. The reduction in Pax7 numbers in Figure 3H and loss of quiescence in Figure 3I could reflect disruptions in the muscle fiber niche (loss of Sox17 in myonuclei or blood vessel cells). 5) It is unclear whether the fiber count and sizing of soleus sections in this figure are valid given the number of fibers cut longitudinally in the representative images. It seems that the results could be skewed if interpreting sections with these artifacts. Also, TA and EDL muscle data should also be included or mentioned since they use these muscles for regeneration experiments and culture. 6) Figure 4 should include analysis by immunofluorescence with appropriate fate markers and/or FACs of satellite cell and derived myogenic progenitor numbers at stages of regeneration where fate decisions are readily apparent (~3-7 days after injury). To assess renewal and proliferation, BrdU or EdU pulse experiments with appropriate fate markers should be conducted. Considering Sox17 would be lost in Pax3 derived cells (myonculei and blood vessels), it is difficult to comprehend the conclusion that the phenotypes strictly reflect satellite cell autonomous fate decisions. 7) For the in vivo electroporation studies (Figure 5D-F), it is important to evaluate GFP expression at early and late time points to assess the transfection efficiency and document the cell types in which the dominant negative SoxF is expressed. Also, pockets of ORO+ and Sirius red+ reactivity seem regional in these tissues. How were regions chosen for the quantification shown in this figure? 8) A physical interaction needs to be demonstrated between b-catenin and SOXF family members to support the authors' conclusions. Also, whether these interactions are lost upon removal of the b-catenin interaction site in the SOXF family needs to be tested. Considering the timing of canonical Wnt activity and SOXF family member expression during regeneration, it is not immediately clear as to the relevance of SoxF factors with b-catenin in the context of this manuscript (Brack et al., 2008; Murphy et al., 2014; Rudolf et al., 2016). Although controversial, b-catenin activity is highest during stages of active fate decisions in satellite cells and myogenic progenitors during regeneration (days 3-7 after injury). Yet in Figure 4, SoxF expression peaks at later stages of regeneration. Also, these transcripts are measured in whole TA muscle, whereas they should be measured in sorted satellite cells and myogenic progenitors. Alternatively, SoxF family members along with myogenic fate markers Pax7, MyoD, and Myog could be tested with immunofluorescence at days 3-7 during injury. Since based on the literature and the data in this study, b-catenin activity is associated with myogenic progression, and SoxF family members are proposed to interfere with b-catenin activity; the authors should test localization of SoxF members (Sox17) with myogenic fate regulators at days 3-7 of muscle regeneration. Another possibility is b-catenin activity should be higher in Sox17 null mice, which could explain some of the phenotypes observed in this manuscript (Murphy et al., 2014). 9) Figure 6C – β-catenin target gene analyses lack statistical assessment. Also, it appears that the b-cat target genes show variable differences in the Sox17 deficient muscles. The analysis is also complicated by the different cellular and fiber type composition of the muscles in the Sox17 deficient animals. These issues should be accounted for in the authors' presentation and interpretation of these results. 10) Figure 7EAxin2 expression is assayed in sorted Pax3+ cells without CD31 negative selection this is problematic based on the authors publications as described above (Goupille et al., 2011; Relaix et al., 2006). Due to the questions with regards to Pax3 expression and lack of CD31 use, sort profiles with all gates and populations need to be shown to demonstrate how Pax3+ cells were prospectively isolated. 11) LiCl is a GSK3b inhibitor, and so, as GSK3b has additional activities that are not related to its role in Wnt signaling, LiCl should not be presented as a specific Wnt activator. 12) The authors need to add an important control to the studies comparing SoxF overexpression and ability to rescue – they must assess the level of overexpression of the various Sox7, Sox17 and Sox18 constructs and ensure that they are similarly overexpressed. Similarly, they provide no evidence that endogenous SOXF protein levels parallel the transcript levels of SoxF genes. These points need to be addressed by the authors. 13) The authors described an increase of slow fibers in soleus muscle of Sox17 mice. First, a more complete analysis of fast and slow myosins should be performed in various muscles should be performed. Second, the authors should at least discuss the potential connection between SOXF expression and muscle metabolism. [Editors' note: further revisions were requested prior to acceptance, as described below.] Thank you for resubmitting your work entitled "SOXF factors regulate satellite cell self-renewal and function through inhibition of β-catenin activity" for further consideration at eLife. Your revised article has been favorably evaluated by Fiona Watt (Senior Editor), a Reviewing Editor, and two reviewers. The manuscript has been improved but one of the reviewers has raised a few remaining issues that need to be addressed before acceptance, as outlined below: In response to the first review the authors submitted a figure demonstrating lack of Pax3 in CD31+ cells. Inclusion of this as a supplement would be helpful. It is impressive that the authors observe a similar magnitude of Pax7+ SC loss regardless of whether Pax3 or Pax7 is used. However, there are discrepancies in the regeneration experiments. The Pax3 KO mice demonstrate obvious impairments in regeneration (Figure 5) after 28 days of recovery. Figure 6 demonstrates Pax7+ cell loss in Pax7 KO mice after only 7 days of recovery. There are no data from 28 day regenerated Pax7 KO muscle. Therefore it is not known whether regeneration or satellite cell renewal are impaired after 28 days in the Pax7 KO. These data should be provided and compared/discussed with the Pax3 data/published studies to determine if differences in regenerative phenotype occur depending on timing of recombination. Also, some regenerative measures should be quantified for example size of regenerated muscle fibers,% Oil red O area, and% Sirius red area. 1) The data in Figure 1 were obtained from sorted Pax3GFP cells, where GFP is a reporter for Pax3 expression, not a lineage tracer (Relaix et al., 2006). For adult satellite cell collection this is a problem since, based on the authors' previously published work, Pax3 expression is rare, except in the diaphragm, in adult satellite cells. Pax3 expression in adult has been previously reported in Relaix et al. (2006) and Calhabeu et al. (2012). Pax3 expression is, as noted by the reviewer, restricted in many muscles such as hindlimb muscles but expressed in a large number of body muscles, with a variable proportion of satellite cells in a muscle-specific pattern. Most of the trunk muscles express PAX3 for instance. Accordingly, data presented in Figure 1A and 1B were obtained from sorted trunk (not diaphragm) Pax3+ cells. FACS sorting and dissections were optimized at all stages to avoid contamination from other Pax3-expressing cells, such as melanocytes in the fetal stages. Pax3-GFP+ FACS sorting strategy has previously been optimized during early myogenic development (Lagha et al., 2010) and adult satellite cells (Pallafacchina et al., 2010). This screen merely identifies interesting target genes, which were then examined in more detail to confirm and extend expression dynamic studies in satellite cells in general. Data shown in Figure 1D (including culture of satellite cells) were obtained from sorted TER119 (LY76)-, CD45 (PTPRC, LY5)-, SCA1-, CD34+, and integrin-α7+ from forelimb, hindlimb, and trunk (not diaphragm) adult muscles. Calhabeu, F., Hayahi, S., Morgan, J.E., Relaix, F. and Zammit, P. 2012 Alveolar Rhabdomyosarcoma-associated proteins PAX3/FOXO1A and PAX7/FOXO1A 2 suppress the transcriptional activity of MyoD-target genes in muscle stem cells. Oncogene. 32(5):651-62. Lagha M, Sato T, Regnault B, Cumano A, Zuniga A, Licht J, Relaix F, Buckingham M. 2010. Transcriptome analyses based on genetic screens for Pax3 myogenic targets in the mouse embryo. BMC Genomics 11: 696. Pallafacchina G, François S, Regnault B, Czarny B, Dive V, Cumano A, Montarras D, Buckingham M. 2010. An adult tissue-specific stem cell in its niche: a gene profiling analysis of in vivo quiescent and activated muscle satellite cells. Stem Cell Res 4: 77. Relaix, F., Montarras, D., Zaffran, S., Gayraud-Morel, B., Rocancourt, D., Tajbakhsh, S., Mansouri, A., Cumano, A., and Buckingham, M. (2006). Pax3 and Pax7 have distinct and overlapping functions in adult muscle progenitor cells. J. Cell Biol., 172, 91-102.Calhabeu 2012 Oncongene Furthermore, Pax3GFP expression is observed in major adult blood vessels in the limbs (Goupille et al., 2011). Based on the Materials and methods (subsection “Cell sorting and culture”, first paragraph), CD31 is not used for negative selection. Since hindlimb, forelimb and trunk muscles were used one cannot be sure what fraction of the cells in Figure 1 are CD31+/Pax3GFP+ blood vessel derived cells. In adult muscle, Pax3 expression is restricted to muscle satellite cells; no expression is seen in either blood vessels or neural crest-derived lineages. Goupille et al. (2011) demonstrate the presence of PAX3 in smooth muscle cells (mural cells) from peripheral arteries, which we avoid during dissection. Furthermore, that paper shows that the blood-vessel-derived cells only rarely and non-cell autonomously contribute to muscle fiber formation; their myogenic potential requires co-culture with skeletal muscle cells and cell fusion. More importantly, in Figure 3C of Goupille et al. (2011), the authors demonstrate that CD31 expression is restricted to the GFP- population and it is not in the GFP+ population. When performing Pax3/CD31 FACS analysis, we found hardly any overlap between the Pax3 and CD31 immunolabeling (i.e. 1% or less). These data are presented in Figure 1—figure supplement 1 of the published manuscript. Goupille O, Pallafacchina G, Relaix F, Conway SJ, Cumano A, Robert B, Montarras D, Buckingham M. 2011. Characterization of Pax3-expressing cells from adult blood vessels. J Cell Sci 124: 3980. Due to the questions with regards to Pax3GFP expression and lack of CD31 use, sort profiles with all gates and populations need to be shown to demonstrate how Pax3GFP+ cells were prospectively isolated. Also, they need to report what proportion of the isolated Pax3GFP+ cells used for their studies express Pax7 and what proportion express Sca1 (by immunostaining of isolated cells and FACS), clarify if they used CD31 counterselection in their sorts, and assess the anatomical localization of the cells (sublaminar vs. interstitial) by staining in tissue sections. This Pax3 expression point was addressed in our latest publication (Alonso-Martin et al., 2016), where we performed a genome-wide chronological expression profile from similar PAX3+ sorted cells. All FACS profiles are indeed illustrated in Alonso-Martin et al., 2016 – Figure S2A. Moreover, to exclude a possible contamination of satellite cells with endothelial cells, we performed PAX3-lineage tracing using Pax3 mice (Alonso-Martin et al., 2016 – Figure S2B). While adult myogenic cells were mGFP+ (Pax3-Cre recombined), all endothelial cells remained mTOMATO+ (not recombined) (Alonso-Martin et al., 2016 – Figure S2B and Movie S1). More importantly, all CD31(PECAM-1)+ endothelial cells were included within the mTOMATO+ population (Alonso-Martin et al., 2016 – Figure S2B and Movie S2). These results demonstrate that the PAX3 lineage does not contribute to skeletal muscle endothelial population, and that skeletal muscle expression of PAX3 is specific to muscle stem cells. Finally, since PAX3 is expressed in a subset of the PAX7-expressing satellite cells, we compared our gene expression data with previously published datasets of adult muscle stem cells where markers different from PAX3 were used to isolate satellite cells (Alonso-Martin et al., 2016 – Figure S3A). Liu et al., 2013: VCAM+CD31-CD45-SCA1- or the YFP fraction from Pax7; Sinha et al., 2014: CD45-TER119-SCA1-CD29+CXCR4. PAX3-expressing satellite cells were not significantly divergent from previously reported datasets. Moreover, we compared available data from adult (3-8 month-old) and old satellite cells (18-24 month-old) with our data, identifying a similar variation in all datasets. Finally, this was also addressed in reviewer Figure 1 above (and see previous response). Liu L, Cheung TH, Charville GW, Hurgo BM, Leavitt T, Shih J, Brunet A, Rando TA. 2013. Chromatin modifications as determinants of muscle stem cell quiescence and chronological aging. Cell Rep 4: 189. Sinha M, Jang YC, Oh J, Khong D, Wu EY, Manohar R, Miller C, Regalado SG, Loffredo FS, Pancoast JR, Hirshman MF, Lebowitz J, Shadrach JL, Cerletti M, Kim MJ, Serwold T, Goodyear LJ, Rosner B, Lee RT, Wagers AJ. 2014. Restoring systemic GDF11 levels reverses age-related dysfunction in mouse skeletal muscle. Science 344: 649. 2) Throughout the manuscript, the authors often inappropriately conflate self-renewal and quiescence with Pax7 positivity. For example, in reporting the results of retroviral transductions in Figure 2, they claim that overexpression of SoxF promotes "self-renewal", but their data show changes in the frequency of Pax7+ and MyoD+ cells and does not assay self-renewal itself (which would require tracking of either individual cell divisions or minimally of input cell number versus output cell number). Similarly, in Figure 3, the authors have not directly evaluated quiescence, and in Figures 5 and 6, they have not evaluated self-renewal (just Pax7 expression). In single myofiber cultures (Figure 2, 5, 6 of initial manuscript), PAX7 positivity was used as a proxy for self-renewal, as it was previously shown that self-renewing cells in this system are PAX7+ (Zammit et al., 2004). In addition, we show that SOXF not only increase PAX7, but concomitantly reduces the proportion of cells with KI67 (so in the cell cycle), and importantly, also the proportion expressing myogenin (Figure 2 and Figure 2—figure supplement 1). Thus a higher proportion of PAX7 cells are exiting the cell cycle but not differentiating, and so self-renewal is the most obvious interpretation of this data. This interpretation is strengthened by the in vivo quantification showing less satellite cells and more with MYOD expression in both Pax3and the new Pax7 model(Figures 3 and 4). Regarding cycling status in Figure 3 (now Figure 4), adult satellite cells are known to have exited the cell cycle (White et al., 2010), while for P14 additional staining of PAX7/PH3 was performed, showing a tendency for increased proliferation in mutant satellite cells (Author response image 1).
Author response image 1.

Evaluation of cycling and self-renewal status.

Quantification of the cycling (PH3+) satellite cells (PAX7+) at P14. Data expressed as mean ± s.e.m.

Evaluation of cycling and self-renewal status.

Quantification of the cycling (PH3+) satellite cells (PAX7+) at P14. Data expressed as mean ± s.e.m. Finally, the authors' conclusion that "Our findings point to modulation of cell cycle by SOXF activity: satellite cells fail to acquire quiescence when SOXF function is impaired in vivo and ex vivo" is problematic, as in several studies the authors have not directly assessed proliferation or quiescence states, and have only inferred these from pax7/myod expression. When quiescent satellite cells are stimulated for growth, MYOD expression is one of the hallmarks of their activation. MYOD protein presence has been reported in myoblasts of single myofibers as early as 2 hours following culture (Zhang et al., 2010), before even re-entry to cell cycle and first division, which occurs at 24-48 hours based on live imaging experiments (Siegel et al., 2011). Thus, evaluating PAX7/MYOD provides an indirect way to assess proliferation and quiescence. Siegel AL, Kuhlmann PK, Cornelison DD. Muscle satellite cell proliferation and association: new insights from myofiber time-lapse imaging. 2011. Skelet Muscle 1: 7. Zhang K, Sha J, Harter ML. 2010. Activation of Cdc6 by MyoD is associated with the expansion of quiescent myogenic satellite cells. J Cell Biol 188: 39. For renewal, the authors need to evaluate absolute numbers of Pax7+, MyoD+, and Myog+ cells per fiber. EdU pulse experiments would be helpful as well. An alternative explanation for the Sox7FL effects could be decreased activation as opposed to supporting renewal. Based on the Sox7DN data, are the authors suggesting that loss of Pax7 is coupled to premature differentiation or apoptosis? At 72 hours Myog+ cells are observed yet their proportion does not increase. Depending on the absolute number count per fiber the authors will probably also need to assess apoptosis. As suggested by the reviewers, EdU pulse experiments have been performed and the results are reported in Figure 2—figure supplement 1B. For these experiments, we produced new viruses in which the fluorescent tracker is restricted to the endoplasmic reticulum and was visualized by a secondary antibody in the blue channel. Myofibers were cultured in the presence of EdU (from T0 to T72) and transduced (CFP+) satellite cells were screened for EdU presence at T72. >98% of CFP+ cells were EdU+, demonstrating that the transduced cells that we quantify at T72 represent progeny of activated satellite cells and not quiescent satellite cells that failed to activate (Zammit et al., 2004). Apoptosis is difficult to estimate in the floating myofiber system, because apoptotic cells detach from the fibers. Instead, TUNEL assay was performed in cryosections of d7 regenerating muscles of mutant and control mice, not revealing significant differences. 3) A major limitation of the authors' conclusions, which center entirely around the notion that SoxF's exert their influence on muscle repair capacity by regulating transcriptional events in satellite cells themselves is that neither of the models they use to evaluate the in vivo regenerative phenotypes caused by loss of SoxF's are satellite cell specific. For example, the data in Figure 3 are generated from Pax3Cre/Sox17fl (Sox17 KO) mice. Although Sox17 is not abundantly expressed in embryonic Pax3GFP+ cells (Figure 1A and 1B), the Cre is and therefore all cells derived from the Pax3 lineage will be disrupted for Sox17. Such Sox17 disrupted cells in addition to satellite cells and derived myogenic progenitors include myonuclei and blood vessel cells(Goupille et al., 2011; Relaix et al., 2006). Therefore, the muscle fiber disruptions such as fiber type transitions and atrophy could reflect Sox17 roles in muscle fibers and blood vessels. Thus, the authors cannot exclude potential influences of SoxF loss in other cell types, and should address this issue using an inducible satellite cell specific model (e.g., Pax7CreER). As suggested by the reviewers, we generated satellite-cell specific inducible animals by combining Pax7-CreERT2 and Sox17flox alleles. Data presented in Figure 4E-G and Figure 3—figure supplement 2 show that in the resting Soleus muscle, ablation of Sox17 in satellite cells leads to loss of PAX7+ cells while having minimal impact on muscle structure 21 days after TMX injection. Moreover, we performed regeneration 15 days after the last TMX injection. TA muscles were injured with CTX and analyzed 7 days post-injury (Figure 6). Pax7 mice display similar phenotype to that observed in Pax3, namely increased cell infiltration and fibrosis, and more importantly, loss of PAX7+ cells. Together, our data confirm the role of SOXF specifically in satellite cells. 4) The manner of myonuclei count (Figure 3F) is not adequate, the authors should obtain dissociated single fibers and count myonuclei along their length (Brack et al., 2005). Both methodologies provide valid data on the number of myonuclei, but only one method needs to be performed to determine the number in our opinion. In accordance with previous reports (reference list below), we chose to quantify myonuclei in cross-sections so that a) results would not be affected by possible differences in individual fibers' length, b) the thousands of fibers of the entire muscle would not be under-represented by counting only 30-40 isolated myofibers. We thank the reviewers for their comment and indeed acknowledge that the quantification of cross-sections is more representative of myonuclei density. We therefore clarified the text accordingly. Reference List Adams GR, Caiozzo VJ, Haddad F, Baldwin KM. 2002. Cellular and molecular responses to increased skeletal muscle loading after irradiation. Am J Physiol Cell Physiol 283: C1182. Bruusgaard JC, Johansen IB, Egner IM, Rana ZA, Gundersen K. 2010. Myonuclei acquired by overload exercise precede hypertrophy and are not lost on detraining. Proc Natl Acad Sci 107: 15111. Egner IM, Bruusgaard JC, Eftestøl E, Gundersen K. 2013. A cellular memory mechanism aids overload hypertrophy in muscle long after an episodic exposure to anabolic steroids. J Physiol 591: 6221. Kadi F, Schjerling P, Andersen LL, Charifi N, Madsen JL, Christensen LR, Andersen JL. 2004. The effects of heavy resistance training and detraining on satellite cells in human skeletal muscles. J Physiol 558: 1005. Karlsen A, Couppé C, Andersen JL, Mikkelsen UR, Nielsen RH, Magnusson SP, Kjaer M, Mackey AL. 2015. Matters of fiber size and myonuclear domain: Does size matter more than age? Muscle Nerve 52: 1040. Kirby TJ, McCarthy JJ, Peterson CA, Fry CS. 2016. Synergist ablation as a rodent model to study satellite cell dynamics in adult skeletal muscle. Methods Mol Biol 1460:43. Kirby TJ, Patel RM, McClintock TS, Dupont-Versteegden EE, Peterson CA, McCarthy JJ. 2016. Myonuclear transcription is responsive to mechanical load and DNA content but uncoupled from cell size during hypertrophy. Mol Biol Cell 27: 788. Liu F, Fry CS, Mula J, Jackson JR, Lee JD, Peterson CA, Yang L. 1985. Automated fiber-type-specific cross-sectional area assessment and myonuclei counting in skeletal muscle. J Appl Physiol 115: 1714. McLoon LK, Rowe J, Wirtschafter J, McCormick KM. 2004. Continuous myofiber remodeling in uninjured extraocular myofibers: myonuclear turnover and evidence for apoptosis. Muscle Nerve 29: 707. Merrick D, Stadler LK, Larner D, Smith J. 2009. Muscular dystrophy begins early in embryonic development deriving from stem cell loss and disrupted skeletal muscle formation. Dis Model Mech 2: 374. Schwartz LM, Brown C, McLaughlin K, Smith W, Bigelow C. 2016. The myonuclear domain is not maintained in skeletal muscle during either atrophy or programmed cell death. Am J Physiol Cell Physiol 311: C607. The assumption is that myonuclear loss reflects loss of satellite cells and derived fusion competent myogenic progenitors. Also, no assessment of myogenic progenitor number or activity (BrdU/EdU) is done at any stage up to adult skeletal muscle ages. The reduction in Pax7 numbers in Figure 3H and loss of quiescence in Figure 3I could reflect disruptions in the muscle fiber niche (loss of Sox17 in myonuclei or blood vessel cells). PAX7+ satellite cells at post-natal day 14 (P14) were assessed for PH3 expression. The mutants showed a tendency for increased proliferation, although in a non-statistically significant manner. Results are reported in Author response image 1. Moreover, Sox17 is not expressed in the myonuclei of the myofibers in single fiber cultures (Figure 1C) and Pax3-Cre is not expressed in the vascular cells (Figure 1—figure supplement 1 of the published manuscript). We are therefore confident that the reduction in PAX7 number is due to loss of SOX17 in the satellite cells of Pax3-Cre:Sox17flox mice, especially considering the similar observations using the new Pax7model. 5) It is unclear whether the fiber count and sizing of soleus sections in this figure are valid given the number of fibers cut longitudinally in the representative images. It seems that the results could be skewed if interpreting sections with these artifacts. We wished to illustrate a whole soleus muscle in cross section to provide an overview to show that the reduction in muscle fiber size was not restricted to certain areas/regions. This was one of N≥4 mice analyzed in triplicate where total number of fibers per whole muscle cross section was counted and approximately the CSA of 1500-2000 myofibers measured. No longitudinally cut fibers were found in the images used for fiber sizing. Also, TA and EDL muscle data should also be included or mentioned since they use these muscles for regeneration experiments and culture. We thank the reviewers for this suggestion. We performed as requested an analysis on other muscles. Analyzing further muscles showed that the situation is more complex than anticipated, with fast and slow muscles being affected differentially (Author response image 2). We will further investigate this phenotype in future studies and so we have currently removed the relevant data from Figure 3.
Author response image 2.

Effect of Sox17 deletion on myofiber type distribution.

Quantification of the slow-type MyHCI+ myofibers expressed as percentage of all fibers in whole adult Soleus (A), TA (B), and EDL (C) cross-sections from control and Sox17 mutant mice. CTRL, Sox17; KO, Pax3. n≥4 mice (each in triplicate) for all experiments. Data expressed as mean ± s.e.m, statistically analyzed with Student’s unpaired t-test: ***, p<0.001.

Effect of Sox17 deletion on myofiber type distribution.

Quantification of the slow-type MyHCI+ myofibers expressed as percentage of all fibers in whole adult Soleus (A), TA (B), and EDL (C) cross-sections from control and Sox17 mutant mice. CTRL, Sox17; KO, Pax3. n≥4 mice (each in triplicate) for all experiments. Data expressed as mean ± s.e.m, statistically analyzed with Student’s unpaired t-test: ***, p<0.001. 6) Figure 4 should include analysis by immunofluorescence with appropriate fate markers and/or FACs of satellite cell and derived myogenic progenitor numbers at stages of regeneration where fate decisions are readily apparent (~3-7 days after injury). To assess renewal and proliferation, BrdU or EdU pulse experiments with appropriate fate markers should be conducted. Considering Sox17 would be lost in Pax3 derived cells (myonculei and blood vessels), it is difficult to comprehend the conclusion that the phenotypes strictly reflect satellite cell autonomous fate decisions. We FACS-isolated satellite cells before (d0) and during regeneration (d2-d5-d7) and performed qRT-PCR analysis on SoxF genes and fate markers using the reporter Tg:Pax7-nGFP mice (Rocheteau et al., 2012). These data have been added in revised Figure 5 and revised Figure 5—figure supplement 1. New data from the new Pax7model also confirms that satellite cells are clearly perturbed when Sox17 is deleted in just that cell population with reduced Pax7 cell numbers, but a higher proportion still in cell cycle (Figure 6). 7) For the in vivo electroporation studies (Figure 5D-F), it is important to evaluate GFP expression at early and late time points to assess the transfection efficiency and document the cell types in which the dominant negative SoxF is expressed. Also, pockets of ORO+ and Sirius red+ reactivity seem regional in these tissues. How were regions chosen for the quantification shown in this figure? New electroporation experiments were performed for early (d5) and late (d10) time points. Extensive GFP expression in toto muscles and in cryo-sections demonstrates that the entire muscle was electroporated. These data have been added in revised Figure 7—figure supplement 1. 8) A physical interaction needs to be demonstrated between b-catenin and SOXF family members to support the authors' conclusions. Also, whether these interactions are lost upon removal of the b-catenin interaction site in the SOXF family needs to be tested. Physical interaction between SOXF factors and β-catenin has been previously published. Similarly, localization on the β-catenin binding domain on the SOXF proteins sequences, and the loss of interaction with β-catenin following its deletion or point mutation, has been previously reported. We clarified the text and included the appropriate citations: Chew et al., 2011. SRY-Box Containing Gene 17 Regulates the Wnt/ -Catenin Signaling Pathway in Oligodendrocyte Progenitor Cells." Journal of Neuroscience 31(39): 13921-13935. Guo et al., L., D. Zhong, S. Lau, X. Liu, X.Y. Dong, X. Sun, V.W. Yang, P.M. Vertino, C.S. Moreno, V. Varma, J.T. Dong, and W. Zhou. 2008. Kormish JD, Sinner D, Zorn AM. 2010. Interactions between SOX factors and Wnt/β-catenin signaling in development and disease. Dev Dyn. Jan;239(1):56-68. doi: 10.1002/dvdy.22046. Review. Liu X, Luo M, Xie W, Wells JM, Goodheart MJ, Engelhardt JF. 2010. Sox17 modulates Wnt3A/β-catenin-mediated transcriptional activation of the Lef-1 promoter. Am J Physiol Lung Cell Mol Physiol. Nov;299(5):L694-710. doi: 10.1152/ajplung.00140.2010. Epub 2010 Aug 27. Sinner et al.,, D., J.J. Kordich, J.R. Spence, R. Opoka, S. Rankin, S.C.J. Lin, D. Jonatan, A.M. Zorn, and J.M. Wells. 2007. Sox17 and Sox4 Differentially Regulate Catenin/T-Cell Factor Activity and Proliferation of Colon Carcinoma Cells. Molecular and Cellular Biology 27:7802-7815. Sinner et al., D., S. Rankin, M. Lee, and A. Zorn. 2004. Sox17 and catenin cooperate to regulate the transcription of endodermal genes. Development 131:3069-3080. Zhang, Basta and Klymkowsky, 2005. SOX7 and SOX18 are essential for cardiogenesis in Xenopus. Dev Dyn 234:878-891. Considering the timing of canonical Wnt activity and SOXF family member expression during regeneration, it is not immediately clear as to the relevance of SoxF factors with b-catenin in the context of this manuscript (Brack et al., 2008; Murphy et al., 2014; Rudolf et al., 2016). Although controversial, b-catenin activity is highest during stages of active fate decisions in satellite cells and myogenic progenitors during regeneration (days 3-7 after injury). Yet in Figure 4, SoxF expression peaks at later stages of regeneration. Also, these transcripts are measured in whole TA muscle, whereas they should be measured in sorted satellite cells and myogenic progenitors. As requested, satellite cells at 2, 5, and 7 days post-injury were collected with FACS and the expression of different myogenic factors and SoxF genes was evaluated by qRT-PCR. This shows an increase in SoxF expression at d5 and d7, clearly overlapping with days 3-7 after injury. These data have been added in revised Figure 5 and revised Figure 5—figure supplement 1. Alternatively, SoxF family members along with myogenic fate markers Pax7, MyoD, and Myog could be tested with immunofluorescence at days 3-7 during injury. Since based on the literature and the data in this study, b-catenin activity is associated with myogenic progression, and SoxF family members are proposed to interfere with b-catenin activity; the authors should test localization of SoxF members (Sox17) with myogenic fate regulators at days 3-7 of muscle regeneration. Another possibility is b-catenin activity should be higher in Sox17 null mice, which could explain some of the phenotypes observed in this manuscript (Murphy et al., 2014). We have tested several SoxF antibodies and have spent a lot of time trying to optimize immunofluorescence with these antibodies on muscle sections. Unfortunately, despite evaluating several protocols, we have not been able to get consistent and reliable results. 9) Figure 6C – β-catenin target gene analyses lack statistical assessment. Also, it appears that the b-cat target genes show variable differences in the Sox17 deficient muscles. The analysis is also complicated by the different cellular and fiber type composition of the muscles in the Sox17 deficient animals. These issues should be accounted for in the authors' presentation and interpretation of these results. Statistics were added. The manuscript was updated accordingly. 10) Figure 7E Axin2 expression is assayed in sorted Pax3GFP+ cells without CD31 negative selection this is problematic based on the authors publications as described above (Goupille et al., 2011; Relaix et al., 2006). Due to the questions with regards to Pax3GFP expression and lack of CD31 use, sort profiles with all gates and populations need to be shown to demonstrate how Pax3GFP+ cells were prospectively isolated. Please see above (answer to comment 1). 11) LiCl is a GSK3b inhibitor, and so, as GSK3b has additional activities that are not related to its role in Wnt signaling, LiCl should not be presented as a specific Wnt activator. We thank the reviewers for this remark. The text was modified accordingly. 12) The authors need to add an important control to the studies comparing SoxF overexpression and ability to rescue – they must assess the level of overexpression of the various Sox7, Sox17 and Sox18 constructs and ensure that they are similarly overexpressed. Similarly, they provide no evidence that endogenous SOXF protein levels parallel the transcript levels of SoxF genes. These points need to be addressed by the authors. In the myofiber model used to the rescue experiment (now Figure 7A), it is impossible to directly assess the level of overexpression in the transduced cells due to limiting amount of material. Tagged full-length cDNA constructs were thus generated to avoid variable antibody detection, and transfected in two cell lines. The analysis shows that under the control of the same promoter in the same backbone, expressed protein levels slightly vary between SOXF members at 48h post-transfection and also in a cell to cell fashion (Author response image 3). This observation points not only to intrinsic mRNA and/or protein stability, but also to the cellular system used. Considering the relative levels of the three SOXF factors, we consider that the output of the rescue experiment is unlikely to be significantly affected.
Author response image 3.

Overexpression levels of SOX-FL proteins.

C2C12 and HEK293 cells were transfected with GFP-tagged SOXF constructs for 48h. After lysis, 10 µg of proteins were loaded on a 4-12% gradient acrylamide gel. Overexpressed proteins were probed with anti-GFP antibody (Abcam). Loading is controlled using an anti-TBP antibody (Cell Signaling).

Overexpression levels of SOX-FL proteins.

C2C12 and HEK293 cells were transfected with GFP-tagged SOXF constructs for 48h. After lysis, 10 µg of proteins were loaded on a 4-12% gradient acrylamide gel. Overexpressed proteins were probed with anti-GFP antibody (Abcam). Loading is controlled using an anti-TBP antibody (Cell Signaling). 13) The authors described an increase of slow fibers in soleus muscle of Sox17fl/Pax3Cre mice. First, a more complete analysis of fast and slow myosins should be performed in various muscles should be performed. Second, the authors should at least discuss the potential connection between SOXF expression and muscle metabolism. Please see above (answer to comment 5). [Editors' note: further revisions were requested prior to acceptance, as described below.] The manuscript has been improved but one of the reviewers has raised a few remaining issues that need to be addressed before acceptance, as outlined below: In response to the first review the authors submitted a figure demonstrating lack of Pax3Cre-GFP in CD31+ cells. Inclusion of this as a supplement would be helpful. As suggested by the reviewer, we have added this figure as new Figure 1—figure supplement 1. It is impressive that the authors observe a similar magnitude of Pax7+ SC loss regardless of whether Pax3Cre or Pax7CreER is used. However, there are discrepancies in the regeneration experiments. The Pax3Cre-Sox17 KO mice demonstrate obvious impairments in regeneration (Figure 5) after 28 days of recovery. Figure 6 demonstrates Pax7+ cell loss in Pax7CreER-Sox17 KO mice after only 7 days of recovery. There are no data from 28 day regenerated Pax7CreER-Sox17 KO muscle. Therefore it is not known whether regeneration or satellite cell renewal are impaired after 28 days in the Pax7CreER-Sox17 KO. These data should be provided and compared/discussed with the Pax3Cre data/published studies to determine if differences in regenerative phenotype occur depending on timing of recombination. Also, some regenerative measures should be quantified for example size of regenerated muscle fibers,% Oil red O area, and% Sirius red area. As suggested by the reviewers, regeneration after 28 days has been analyzed in the Sox17-conditional knockout (Pax7) and discussed in the text. These data are included in Figure 6E-L.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Mus musculus)Sox7I.M.A.G.E. clone40131228N/A
Gene (Mus musculus)Sox18I.M.A.G.E. clone3967084N/A
Strain, strain background (Mus musculus)Pax3GFP/+PMID: 15843801 DOI: 10.1038/nature03594N/AMouse line maintained in F. Relaix lab
Strain, strain background (Mus musculus)Pax3Cre/+The Jackson Laboratory PMID: 15882581 DOI: 10.1016/j.ydbio.2005.02.002B6;129-Pax3tm1(cre)Joe/J MGI: J:96431 RRID:IMSR_JAX:005549Mouse line obtained from J. A. Epstein
Strain, strain background (Mus musculus)Pax7CreERT2/+ (Pax7+/CE)The Jackson Laboratory PMID: 19554048 PMCID: PMC2767162 DOI: 10.1038/nature08209B6;129-Pax7tm2.1(cre/ERT2)Fan/J MGI: J:150962 RRID:IMSR_JAX:012476Mouse line obtained from C.M. Fan
Strain, strain background (Mus musculus)Tg:Pax7-nGFPPMID: 22265406 DOI: 10.1016/j.cell.2011.11.049Tg(Pax7-EGFP)#Tajb MGI:5308730 RRID:MGI:5308742Mouse line obtained from S. Tajbakhsh
Strain, strain background (Mus musculus)Sox17GFP/+The Jackson Laboratory PMID: 17655922 PMCID: PMC2577201 DOI: 10.1016/j.cell.2007.06.011BKa.Cg-Sox17tm1Sjm Ptprcb Thy1a/J MGI: J:123050 RRID:IMSR_JAX:007687Mouse line obtained from S. J. Morrison
Strain, strain background (Mus musculus)Sox17fl/+The Jackson Laboratory PMID: 17655922 PMCID: PMC2577201 DOI: 10.1016/j.cell.2007.06.011BKa.Cg-Sox17tm2Sjm Ptprcb Thy1a/J MGI: J:123050 RRID:IMSR_JAX:007686Mouse line obtained from S. J. Morrison
Cell line (Mus musculus)C2C12American Type Culture Collection (ATCC) PMID: 28966089 PMCID: PMC5640514 DOI: 10.1016/j.cub.2017.08.031CRL-1772 RRID: CVCL_0188Cell line maintained in E. Gomes lab
Antibodyanti-GFP (rabbit polyclonal)Life TechnologiesA11122 RRID:AB_2215691:500
Antibodyanti-GFP (chicken polyclonal)Abcamab13970 RRID:AB_3007981:500
Antibodyanti-Ki67 (mouse monoclonal)BD Pharmingen556003 RRID:AB_3962871:100
Antibodyanti-Ki67 (rabbit polyclonal)Abcamab15580 RRID:AB_4432091:100
Antibodyanti-Laminin (rabbit polyclonal)Sigma-AldrichL9393 RRID:AB_4771631:100
Antibodyanti-Laminin (AlexaFluor647)Novus BiologicalNB300-144AF6471:200
Antibodyanti-M-Cadherin (mouse monoclonal)nanoToolsMCAD-12G41:50
Antibodyanti-MyoD1 (5.8A) (mouse monoclonal)DAKOM3512 RRID:AB_21488741:50
Antibodyanti-MyoD (M-318) (rabbit polyclonal)Santa Cruzsc-760 RRID:AB_21488701:20
Antibodyanti-Myogenin (mouse monoclonal)DSHBF5D1:100
Antibodyanti-Pax7 (mouse monoclonal)DSHBPAX7-c1:20
Antibodyanti-Pax7 (mouse monoclonal)Santa Cruzsc-81648 RRID:AB_21598361:20
Antibodyanti-Phospho-Histone H3 (Ser10) (rabbit polyclonal)Merck Millipore06–570 RRID:AB_3101771:500
Antibodyanti-Sox17 (goat polyclonal)R and D SystemsAF1924 RRID:AB_3550601:50
AntibodyAlexa 488 goat anti-mouse IgG (H + L)Life TechnologiesA-11017; RRID:AB_143160 A-21121; RRID:AB_1415141:400
AntibodyAlexa 546 goat anti-mouse IgG (H + L)Life TechnologiesA-11018 RRID:AB_25340851:400
AntibodyAlexa 555 goat anti-mouse IgG (H + L)Life TechnologiesA-21425 RRID:AB_25358461:400
AntibodyAlexa 594 goat anti-mouse IgG (H + L)Life TechnologiesA-11020. RRID:AB_141974 A-21125; RRID:AB_1415931:400
AntibodyAlexa 488 goat anti-rabbit IgG (H + L)Life TechnologiesA-11070 RRID:AB_1421341:400
AntibodyAlexa 594 goat anti-rabbit IgG (H + L)Life TechnologiesA-11072 RRID:AB_1420571:400
AntibodyAlexa 594 donkey anti-goat IgG (H + L)Life TechnologiesA-11058 RRID:AB_1425401:400
AntibodyAlexa 488 goat anti-Chicken IgY (H + L)Life TechnologiesA-11039 RRID:AB_1429241:400
AntibodyCy5-goat anti-rabbit IgG (H + L)Jackson ImmunoResearch111-175-144 RRID:AB_23380131:200
AntibodyRat anti-mouse CD45-PE-Cy7BD Pharmingen561868 RRID:AB_1089359910 ng/ml
AntibodyRat anti-mouse Ter119-PE-Cy7BD Pharmingen557853 RRID:AB_39689810 ng/ml
AntibodyRat anti-mouse CD34-BV421BD Pharmingen562608 RRID:AB_1115457610 ng/ml
AntibodyRat anti-mouse integrin-α7-A700R and D SystemsFAB3518N RRID:AB_1097348310 ng/ml
AntibodyRat anti-mouse Sca1-FITCBD Pharmingen553335 RRID:AB_39479110 ng/ml
AntibodyRat anti-mouse CD31-PEBD Pharmingen553373 RRID:AB_39481910 ng/ml
Sequence-based reagent (Pax7_foward primer)5’ – AGGCCTTCGAGAGG ACCCAC – 3’EurogentecN/AN/A
Sequence-based reagent (Pax7_reverse primer)5’ – CTGAACCAGACCTG GACGCG – 3’EurogentecN/AN/A
Sequence-based reagent (Sox7_foward primer)5’ – CTTCAGGGGACAA GAGTTCG – 3’EurogentecN/AN/A
Sequence-based reagent (Sox7_reverse primer)5’ – GGGTCTCTTCTGG GACAGTG – 3’EurogentecN/AN/A
Sequence-based reagent (Sox17_foward primer)5’ – GCCAAAGACGAACGC AAGCGGT – 3’EurogentecN/AN/A
Sequence-based reagent (Sox17_reverse primer)5’ – TCATGCGCTTCACCT GCTTG – 3’EurogentecN/AN/A
Sequence-based reagent (Sox18_foward primer)5’ – AACAAAATCCGGATC TGCAC – 3’EurogentecN/AN/A
Sequence-based reagent (Sox18_reverse primer)5’ – CGGTACTTGTAGTTGGG ATGG – 3’EurogentecN/AN/A
Sequence-based reagent (Ccnd1_foward primer)5’ – TTCCTCTCCTGCTA CCGCAC – 3’EurogentecN/AN/A
Sequence-based reagent (Ccnd1_reverse primer)5’ – GACCAGCCTCTTCCTC CACTTC – 3’EurogentecN/AN/A
Sequence-based reagent (Axin2_fowardprimer)5’ – AAGAGAAGCGACCCAGT CAA – 3’EurogentecN/AN/A
Sequence-based reagent (Axin2_reverse primer)5’ – CTGCGATGCATCTCTC TCTG – 3’EurogentecN/AN/A
Sequence-based reagent (SoxF binding site)5' – CAACAATCATCATTGTTGG GGCCAACAATCTACATTGTT CAGA – 3'EurogentecN/AN/A
Sequence-based reagent (SoxF binding site)5' – TCTGAACAATGTAGATTGT TGGCCCCAACAATGATGATT GTTG – 3'EurogentecN/AN/A
Commercial assay or kitLIVE/DEAD Fixable Blue Dead Cell Stain KitLife TechnologiesL23105N/A
Commercial assay or kitRNasy Micro KitQIAGEN74004N/A
Commercial assay or kitRNeasy Fibrous Tissue Midi KitQIAGEN75742N/A
Commercial assay or kitTranscriptor First Strand cDNA Synthesis KitRoche-Sigma-Aldrich04897030001N/A
Commercial assay or kitLightCycler 480 SYBR Green I MasterRoche-Sigma-Aldrich04887352001N/A
Commercial assay or kitLipofectamine LTX PLUS reagentLife Technologies15338–100N/A
Chemical compound, drugCardiotoxinLatoxanL810210 µM
Chemical compound, drugbFGFPeprotech450–3320 ng/ml
Chemical compound, drugChicken embryo extractMP-Biomedical28501450.5–1%
Chemical compound, drugCollagenase ARoche-Sigma-Aldrich101035860012 μg/ml
Chemical compound, drugCollagenase type ISigma-AldrichC01300.2%
Chemical compound, drug4’,6-diamidino-2-phenylindole dihydrochloride (DAPI)Life TechnologiesD1306N/A
Chemical compound, drugDispase IIRoche-Sigma-Aldrich101035860012.4 U/ml
Chemical compound, drugDNaseIRoche-Sigma-Aldrich128493210 ng/mL
Chemical compound, drugDulbecco’s modified Eagle’s medium (DMEM)Life Technologies41966N/A
Chemical compound, drugDMEM with GlutaMAXLife Technologies61965–026N/A
Chemical compound, drugEdUThermo Fisher ScientificC103402 μM
Chemical compound, drugFetal bovine serum (FBS)Life Technologies1027020%
Chemical compound, drugFluoromount-GSouthern Biotech0100–01N/A
Chemical compound, drugGelatinSigma-AldrichG18900.1%
Chemical compound, drugHorse serumLife Technologies260500885–10%
Chemical compound, drugPenicillin/streptomycinLife Technologies15140–1221X
Chemical compound, drugTamoxifenSigma-AldrichT56485–10 µg/day
Software, algorithmMetamorph SoftwareMolecular DevicesRRID: SCR_002368N/A
Software, algorithmImageJhttps://imagej.nih.gov/ij/RRID:SCR_003070N/A
  75 in total

1.  Pax7 and myogenic progression in skeletal muscle satellite cells.

Authors:  Peter S Zammit; Frederic Relaix; Yosuke Nagata; Ana Pérez Ruiz; Charlotte A Collins; Terence A Partridge; Jonathan R Beauchamp
Journal:  J Cell Sci       Date:  2006-04-11       Impact factor: 5.285

2.  Sox17 dependence distinguishes the transcriptional regulation of fetal from adult hematopoietic stem cells.

Authors:  Injune Kim; Thomas L Saunders; Sean J Morrison
Journal:  Cell       Date:  2007-07-26       Impact factor: 41.582

3.  Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway.

Authors:  Eek-hoon Jho; Tong Zhang; Claire Domon; Choun-Ki Joo; Jean-Noel Freund; Frank Costantini
Journal:  Mol Cell Biol       Date:  2002-02       Impact factor: 4.272

Review 4.  Niche regulation of muscle satellite cell self-renewal and differentiation.

Authors:  Shihuan Kuang; Mark A Gillespie; Michael A Rudnicki
Journal:  Cell Stem Cell       Date:  2008-01-10       Impact factor: 24.633

5.  A temporal switch from notch to Wnt signaling in muscle stem cells is necessary for normal adult myogenesis.

Authors:  Andrew S Brack; Irina M Conboy; Michael J Conboy; Jeanne Shen; Thomas A Rando
Journal:  Cell Stem Cell       Date:  2008-01-10       Impact factor: 24.633

6.  Geriatric muscle stem cells switch reversible quiescence into senescence.

Authors:  Pedro Sousa-Victor; Susana Gutarra; Laura García-Prat; Javier Rodriguez-Ubreva; Laura Ortet; Vanessa Ruiz-Bonilla; Mercè Jardí; Esteban Ballestar; Susana González; Antonio L Serrano; Eusebio Perdiguero; Pura Muñoz-Cánoves
Journal:  Nature       Date:  2014-02-12       Impact factor: 49.962

7.  SoxF Transcription Factors Are Positive Feedback Regulators of VEGF Signaling.

Authors:  Kangsan Kim; Il-Kug Kim; Jee Myung Yang; Eunhyeong Lee; Bong Ihn Koh; Sukhyun Song; Junseong Park; Sungsu Lee; Chulhee Choi; Jin Woo Kim; Yoshiaki Kubota; Gou Young Koh; Injune Kim
Journal:  Circ Res       Date:  2016-08-15       Impact factor: 17.367

Review 8.  Tissue-specific stem cells: lessons from the skeletal muscle satellite cell.

Authors:  Andrew S Brack; Thomas A Rando
Journal:  Cell Stem Cell       Date:  2012-05-04       Impact factor: 24.633

9.  The organogenesis of murine striated muscle: a cytoarchitectural study.

Authors:  M Ontell; K Kozeka
Journal:  Am J Anat       Date:  1984-10

10.  SOX7 Is Required for Muscle Satellite Cell Development and Maintenance.

Authors:  Rashida F Rajgara; Neena Lala-Tabbert; François Marchildon; Émilie Lamarche; Jennifer K MacDonald; Daryl A Scott; Alexandre Blais; Ilona S Skerjanc; Nadine Wiper-Bergeron
Journal:  Stem Cell Reports       Date:  2017-09-21       Impact factor: 7.765

View more
  4 in total

1.  PAX3 Confers Functional Heterogeneity in Skeletal Muscle Stem Cell Responses to Environmental Stress.

Authors:  Audrey Der Vartanian; Marie Quétin; Stéphanie Michineau; Frédéric Auradé; Shinichiro Hayashi; Christelle Dubois; Didier Rocancourt; Bernadette Drayton-Libotte; Anikó Szegedi; Margaret Buckingham; Simon J Conway; Marianne Gervais; Frédéric Relaix
Journal:  Cell Stem Cell       Date:  2019-04-18       Impact factor: 24.633

2.  Comprehensive multi-cohort transcriptional meta-analysis of muscle diseases identifies a signature of disease severity.

Authors:  C J Walsh; J Batt; M S Herridge; S Mathur; G D Bader; P Hu; P Khatri; C C Dos Santos
Journal:  Sci Rep       Date:  2022-07-04       Impact factor: 4.996

3.  Sox Genes Show Spatiotemporal Expression during Murine Tongue and Eyelid Development.

Authors:  Ryuichi Ishikawa; Maiko Kawasaki; Katsushige Kawasaki; Akane Yamada; Supaluk Trakanant; Fumiya Meguro; Atsushi Kitamura; Takehisa Kudo; Takeyasu Maeda; Atsushi Ohazama
Journal:  Int J Dent       Date:  2018-10-09

4.  The long noncoding RNA HCG18 participates in PM2.5-mediated vascular endothelial barrier dysfunction.

Authors:  Shiwen Wang; Yuyin Lin; Yue Zhong; Maozhou Zhao; Wei Yao; Xiaohui Ren; Qin Wang; Xiaolan Guo; Qian-Qian Zhang; Jianwei Dai
Journal:  Aging (Albany NY)       Date:  2020-11-16       Impact factor: 5.682

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.