| Literature DB >> 29875672 |
Jamila Soomro1,2, Zhongyan Lu1, Hongbing Gui1, Bei Zhang1, Zanming Shen1.
Abstract
In our previous study, we demonstrated that butyrate induced ruminal epithelial growth through cyclin D1 upregulation. Here, we investigated the influence of butyrate on the expression of genes associated with cell cycle and apoptosis in rumen epithelium. Goats (n = 24) were given an intra ruminal infusion of sodium butyrate at 0.3 (group B, n = 12) or 0 (group A, n = 12) g/kg of body weight (BW) per day before morning feeding for 28 days and were slaughtered (4 goat/group) at 5,7 and 9 h after butyrate infusion. Rumen fluid was analyzed for short chain fatty acids (SCFAs) concentration. Ruminal tissues were analyzed for morpho-histrometry and the expressions of genes associated with cell cycle and apoptosis. The results revealed that the ruminal butyrate concentration increased (P < 0.05) in B compared to group A. Morphometric analysis showed increased (P < 0.05) papillae size associated with higher number of cell layers in epithelial strata in B compared to A. Butyrate-induced papillae enlargement was coupled with enhanced mRNA expression levels (P < 0.05) of cyclin D1, CDK2, CDK4, and CDK6 (G0/G1 phase regulators) at 5 h, cyclin E1 (G1/S phase regulator) at 7 h and cyclin A and CDK1 (S phase regulators) at 9 h post-infusion compared to A group. In addition, the mRNA expression levels of apoptotic genes, i.e., caspase 3, caspase 9 and Bax at 5 h post-infusion were upregulated (P < 0.05) in group B compared to group A. The present study demonstrated that butyrate improved ruminal epithelial growth through concurrent and time-dependent changes in the expressions of genes involved in cell proliferation and apoptosis. It seems that the rate of proliferation was higher than the apoptosis which was reflected in epithelial growth.Entities:
Keywords: butyrate; cell apoptosis; cell cycle; gene expression; rumen epithelium
Year: 2018 PMID: 29875672 PMCID: PMC5974050 DOI: 10.3389/fphys.2018.00496
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.566
Chemical composition of diets fed to goats.
| Chemical composition | Concentrate† | Hay |
|---|---|---|
| DM (%) | 87.7 | 89.8 |
| CP (% of DM) | 20.8 | 7.3 |
| Crude fat (% of DM) | 3.6 | 2.0 |
| Crude fiber (% of DM) | 6.6 | 28.2 |
| Crude ash (% of DM) | 7.7 | 6.4 |
| ME (MJ/kg of DM) | 10.8 | 6.9 |
Primers used in quantitative real-time PCR analysis.
| Gene† | Primer sequence 5′ to 3′‡ | Accession number§ | Size(bp)¶ |
|---|---|---|---|
| CCND1 | GGTCCTGGTGAACAAACTC | EU525165.1 | 114 |
| TTGCGGATGATCTGCTT | |||
| CDK4 | TGAGCATCCCAGTGTTGT | NM-001127269.1 | 122 |
| CCTTGTCCAGATACTTCCT | |||
| CDK6 | AGAGTGATTGCAGCTTTATGTCCA | GAAI01006376.1 | 158 |
| TGCCCAGGTTGCTCACTTC | |||
| CCNE1 | GGGACAAGCACCTTATGCAAC | NM-001192776.1 | 153 |
| GTGTTGCCATATACCGATCAAAGA | |||
| CDK2 | CTGCACCGAGACCTTAAACCTCA | BT020790.1 | 140 |
| GCTCGGTACCACAGAGTCACCA | |||
| CCNA | TGGACCTTCACCAGACCTACCT | X68321.1 | 105 |
| GTGGGTTGAGGAGAGAAACACC | |||
| CCNB1 | AGCGGATCCAAACCTTTGTAGTG | NM-001045872.1 | 137 |
| CAATGAGGATGGCTCTCATGTTTC | |||
| CDK1 | CCAATAATGAAGTGTGGCCAGAAG | NM-174016.2 | 164 |
| AGAAATTCGTTTGGCAGGATCATAG | |||
| p21 | AGGGCACGTCTCAGGAGGA | NM_001098958. 1 | 164 |
| CAGTCTGCGTTTGGAGTGGTAG | |||
| Bax | TCTGACGGCAACTTCAACTG | NM-173894.1 | 205 |
| TGGGTGTCCCAAAGTAGGAG | |||
| Caspase 3 | AGCCATGGTGAAGAAGGAATCA | NM-001077840.1 | 156 |
| ACCACAGTCCAGTTCTGTGCCT | |||
| Caspase 9 | TCCTTTGTTCATCTCCTGCTTG | XM-004013798.1 | 115 |
| TTTTCCTTGGCTTGGCTTTG | |||
| Bcl-2 | GATGACCGAGTATCTGAACCG | NM-001166486.1 | 120 |
| GACAGCCAGGAGAAATCAAACA | |||
| GAPDH | TTGTCTCCTGCGACTTCA | HM043737.1 | 135 |
| CCACCACCCTGTTACTGTT |
Effect of butyrate on morphometric parameters of rumen papillae of goat†.
| Parameters | 5 h | 7 h | 9 h | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Groups | Groups | Groups | |||||||
| B | A | B | A | B | A | ||||
| Length, mm | 5.48 ± 0.21 | 4.50 ± 0.14 | 0.011 | 5.21 ± 0.15 | 4.11 ± 0.11 | 0.001 | 5.61 ± 0.13 | 4.72 ± 0.19 | 0.011 |
| Width, mm | 1.91 ± 0.13 | 1.41 ± 0.10 | 0.026 | 1.94 ± 0.11 | 1.43 ± 0.10 | 0.017 | 2.21 ± 0.14 | 1.62 ± 0.11 | 0.016 |
| Density, n/cm2 | 89.25 ± 4.7 | 71.25 ± 4 | 0.029 | 87.50 ± 3.2 | 75.25 ± 2.8 | 0.029 | 88.75 ± 4.3 | 67.75 ± 3.1 | 0.010 |
| Surface, mm2/cm2 | 1867.33 ± 136 | 922.24 ± 131 | 0.002 | 1785.60 ± 183 | 889.83 ± 86 | 0.010 | 2199.16 ± 129 | 1028.78 ± 45 | 0.001 |
| Length, mm | 4.31 ± 0.13 | 3.62 ± 0.15 | 0.015 | 4.31 ± 0.12 | 3.77 ± 0.14 | 0.028 | 4.54 ± 0.18 | 3.70 ± 0.15 | 0.013 |
| Width, mm | 1.81 ± 0.07 | 1.40 ± 0.07 | 0.008 | 1.81 ± 0.06 | 1.60 ± 0.04 | 0.039 | 1.93 ± 0.13 | 1.54 ± 0.10 | 0.057 |
| Density, n/cm2 | 93.00 ± 4.4 | 78.50 ± 3.7 | 0.047 | 91.75 ± 3.7 | 74.0 ± 2.9 | 0.010 | 89.75 ± 3.1 | 73.0 ± 4.4 | 0.024 |
| Surface, mm2/cm2 | 1449.13 ± 49 | 803.04 ± 76 | 0.001 | 1438.27 ± 110 | 895.23 ± 57 | 0.005 | 1580.03 ± 119 | 824.34 ± 35 | 0.001 |
| Length, mm | 3.46 ± 0.12 | 2.70 ± 0.13 | 0.006 | 3.22 ± 0.12 | 2.58 ± 0.15 | 0.019 | 3.42 ± 0.14 | 2.75 ± 0.15 | 0.020 |
| Width, mm | 1.75 ± 0.08 | 1.30 ± 0.07 | 0.010 | 1.70 ± 0.06 | 1.48 ± 0.04 | 0.032 | 1.74 ± 0.15 | 1.30 ± 0.08 | 0.054 |
| Density, n/cm2 | 89.75 ± 2.6 | 77.75 ± 3.8 | 0.041 | 90.75 ± 5 | 74.75 ± 3.90 | 0.046 | 85.25 ± 4.2 | 71.25 ± 4.2 | 0.059 |
| Surface, mm2/cm2 | 1091.93 ± 83 | 553.21 ± 62 | 0.002 | 991.37 ± 52 | 574.64 ± 41 | 0.001 | 1009.02 ± 80 | 505.92 ± 35 | 0.001 |
Effect of ruminal butyrate infusion on cell density of rumen epithelial strata in goats†.
| Parameters | 5 h | 7 h | 9 h | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Groups | Groups | Groups | |||||||
| B | A | B | A | B | A | ||||
| SS+ SG, n/mm2 | 9148.18 ± 291 | 7936.03 ± 186 | 0.010 | 9096.93 ± 264 | 7797.93 ± 125 | 0.010 | 8047.62 ± 258 | 6883.95 ± 197 | 0.012 |
| SB, n/mm | 292.04 ± 13.2 | 250.83 ± 4.9 | 0.027 | 293.87 ± 15.0 | 246.58 ± 4.8 | 0.042 | 283.75 ± 12.4 | 242.52 ± 4.1 | 0.039 |
Correlation between ruminal butyrate and mRNA concentration level of genes.
| Item | ||
|---|---|---|
| Butyrate × Cyclin A | 0.146 | 0.730 |
| Butyrate × Cyclin B1 | –0.048 | 0.910 |
| Butyrate × Cyclin D1 | 0.773 | 0.025 |
| Butyrate × Cyclin E1 | 0.713 | 0.047 |
| Butyrate × CDK1 | 0.075 | 0.859 |
| Butyrate × CDK2 | 0.864 | 0.006 |
| Butyrate × CDK4 | 0.954 | 0.000 |
| Butyrate × CDK6 | 0.773 | 0.024 |
| Butyrate × P21 | 0.892 | 0.003 |
| Butyrate × Caspase 3 | 0.789 | 0.020 |
| Butyrate × Caspase 9 | 0.927 | 0.001 |
| Butyrate × Bax | 0.863 | 0.006 |
| Butyrate × Bcl-2 | –0.028 | 0.947 |