| Literature DB >> 29867463 |
Luana A Biondo1, Helena A Batatinha1, Camila O Souza1, Alexandre A S Teixeira1, Loreana S Silveira2, Maria I Alonso-Vale3, Lila M Oyama4, Michele J Alves1, Marilia Seelaender1,5, José C R Neto1.
Abstract
Doxorubicin (DX) is a chemotherapeutic drug that is used in clinical practice that promotes deleterious side effects in non-tumor tissues such as adipose tissue. We showed that DX leads to extensive damage in adipose tissue via a disruption in 5'-adenosine monophosphate-activated protein kinase (AMPK) and PPAR-gamma signaling. Thus, we investigated whether co-treatment with the biguanide drug metformin (MET) could prevent the side effects of DX through the activation of AMPK in adipose tissue. The goal of the present study was to verify the effects of DX and adjuvant MET treatment in subcutaneous adipose tissue (SAT) and to determine whether MET could protect against chemotherapy-induced side effects. C57/BL6 mice received DX hydrochloride (2.5 mg/kg) intraperitoneally 2 times per week for 2 weeks (DX), concomitantly or not, with MET administration (300 mg/kg oral daily) (DX + MET). The control group (CTRL) was pair-fed according to the food consumption of the DX group. After euthanasia, adipose tissue fat pads were collected, and SAT was extracted so that adipocytes could be isolated. Glucose uptake was then measured, and histological, gene, and protein analyses were performed. One-way analysis of variance was also performed, and significance was set to 5%. DX reduced retroperitoneal fat mass and epididymal pads and decreased glycemia. In cultured primary subcutaneous adipocytes, mice in the DX group had lower glucose uptake when stimulated with insulin compared with mice in the CTRL group. Adipocytes in the DX group exhibited a reduced area, perimeter, and diameter; decreased adiponectin secretion; and decreased fatty acid synthase gene expression. SAT from MET-treated mice also showed a reduction in collagen deposition. Treatment with MET prevented fibrosis and restored glucose uptake in SAT after insulin stimulation, yet the drug was unable to prevent other side effects of DX such as tissue loss and inflammatory response.Entities:
Keywords: adipose tissue; chemotherapy; doxorubicin; fibrosis; glucose; metformin
Year: 2018 PMID: 29867463 PMCID: PMC5952005 DOI: 10.3389/fphar.2018.00452
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Primer sequences.
| Gene | 5′-Forward Primer-3′ | 5′-Reverse Primer-3′ |
|---|---|---|
| CAATGCCAACTCCCGTCA | GTGTTTTTCCGGCAACGAG | |
| GATTCGGTGTATCCTGCTGTC | CATGCTTTAGCACCTGCTGT | |
| CCAGCAGATTGCCAACATC | ACTTCGGTACCTCTGCACCA | |
| TAGGTTTCTGGGCTTTGTGG | GATGGATCGATTGTGCTTCA | |
| CCTGAAGATGATGTGCCTTG | ATCAGGATGAGGGTGTGCTT | |
| GCTGCGGAATCACTTTGTGC | CACCTTGACACCTTTCTGGGT | |
| ATGTGGACCCCTCCTGATAGT | GCCCAGTGATTTCAGCAAAGG |