Literature DB >> 29774093

Distribution of virulence-associated genes and antimicrobial susceptibility in clinical Acinetobacter baumannii isolates.

Chao Liu1, Yaowen Chang1, Ying Xu2, Yun Luo1, Linrong Wu1, Zhanjun Mei1, Shigang Li1, Rui Wang1, Xu Jia1.   

Abstract

Acinetobacter baumannii is undoubtedly one of the most clinically significant pathogens. The multidrug resistance and virulence potential of A. baumannii are responsible for hospital-acquired nosocomial infections. Unlike numerous investigations on the drug-resistant epidemiology of A. baumanni, virulence molecular epidemiology is less studied. Here, we collected 88 A. baumannii clinical isolates, tested their antimicrobial susceptibility to 10 commonly used antibiotics and analyzed the distribution of 9 selected virulence-associated genes, aims to investigate the primary characteristics of the virulence-associated genes that exist in clinically multidrug resistant (MDR) and non-MDR isolates of A. baumannii. The MIC results showed the resistance rates of ciprofloxacin (68.2%, 60/88), gentamicin (67.0%, 59/88), amikacin (58.0%, 51/88), tobramycin (58.0%, 51/88), doxycycline (67.0%, 59/88), meropenem (54.5%, 48/88) and imipenem (65.9%, 58/88) were all above 50%, except for levofloxacin (34.1%, 30/88), minocycline (1.1%, 1/88) and polymyxin B (0%, 0/88). The Pulsed field gel electrophoresis (PFGE) analysis revealed that the resistance rate of MDR A. baumannii isolates in the Epidemic group was predominant (79.5%, 44/58), but in the Sporadic group was only 6.7% (2/30). Further investigation on the distribution of virulence genes showed the virulence genes bap (95.5%), surA1 (92.0%), BasD (92.0%), paaE (88.6%), pld (87.5%), BauA (62.5%), omp33-36 (59.1%) and pglC (53.4%) were accounted for high proportion, except for traT (0%). Overall, our results revealed that MDR isolates predominated in the Epidemic A. baumannii isolates, and contained a very high proportion of virulence genes, which may lead to high risk, high pathogenicity and high treatment challenge.

Entities:  

Keywords:  Acinetobacter baumannii; MDR; PFGE; antimicrobial resistance; virulence genes

Year:  2018        PMID: 29774093      PMCID: PMC5955172          DOI: 10.18632/oncotarget.24651

Source DB:  PubMed          Journal:  Oncotarget        ISSN: 1949-2553


INTRODUCTION

Acinetobacter spp. were glucose-non-fermentative, non-motile, non-fastidious, catalase-positive, oxidative-negative, and aerobic Gram-negative coccobacilli. Acinetobacter baumannii is the most clinically significant Acinetobacter species associated with hospital-acquired infections worldwide [1]. Although A. baumannii used to be considered as a low virulence pathogen, pneumonia has been the main manifestation of nosocomial infections caused by this pathogen, resulting in a significant impact on the mortality rate of patients [2]. This microorganism has also been identified as the etiological agent responsible for a wide range of other infections, including septicemia, meningitis, and more recently, severe and deadly cases of necrotizing fasciitis [3]. A. baumannii was originally recognized as one of the six ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) by Infectious Diseases Society of America (IDSA) in 2004 [4]. Soon afterwards it quickly developed into pan-drug resistance and has since received rapid recognition as one of the most important bacterial pathogens for healthcare-associated infections (HAIs) [5, 6]. The increased multidrug resistance and long period nosocomial persistence of A. baumannii resulted in a serious threat to hospitalized patients. The hallmark of the extreme drug resistance (XDR) phenotype is carbapenems resistance (CR), accounting for the majority of A. baumannii strains in many hospitals today. CR strains are often resistant to all other routinely tested antibiotics, except polymyxins, tigecycline, and sometimes aminoglycoside [7-10]. Treatment of CR-A. baumannii infection therefore involves the use of combinations of last resort agents such as colistin, but their efficacy and safety are yet to be defined. Despite the increasing importance of MDR A. baumannii in nosocomial infections, the role and mechanism of virulence factors in A. baumannii pathogenesis for human infections remain largely obscure. Recently, animal models of disease and cell infestation combined with bacterial mutagenesis have provided some valuable insights into mechanisms of A. baumannii pathogenesis. Some potential virulence factors seem to be important for disease, including outer membrane porins, surface structures including capsule and lipopolysaccharide, enzymes such as phospholipase D, iron acquisition systems, and regulatory proteins. These virulence factors may involve in the infection process, such as transmission, binding to host structures, cellular damage and A. baumannii invasion [11]. The propensity for biofilm formation is likely to contribute to transmission, which is the initial step in disease. Established factors that contribute to A. baumannii biofilm formation include pili (aromatic compounds, paaE [12]), outer membrane proteins (surface antigen protein 1, surA1 [13]), glycoproteins and capsular polysaccharides (O-pentasaccharide, pglC or pglL [14, 15]), and extracellular polysaccharide (Phospholipase D, pld [16, 17]). Binding to host structures may be the first stage in the development of pneumonia. The molecular basis for such interactions is being unraveled; adhesins that mediate binding to host cells include OmpA, Bap, and Omp33–36 [18]. Following binding to host cells is cellular damage and A. baumannii invasion. Once inside host cells, BasD and BauA (involved in the synthesis and transport of small, iron chelating molecules called siderophores) are required for survival [3]. Bloodstream infection is a common complication of A. baumannii infection; the virulence gene traT, encoded the R6-5 plasmid-specified outer membrane protein, has previously been shown to mediate resistance to Gram-negative bacterial killing by serum [19]. Our previous surveys revealed that the antibiotic resistance among A. baumannii clinical isolates is very serious. [20, 21]. And antimicrobial- resistant A. baumannii has very high potential to spread among ill patients in ICU (intensive care units), so it is crucial to adopt early recognition and timely implementation of appropriate infection control measures in preventing outbreaks. Owing to the lack of new antimicrobials in the pipeline for problematic MDR organisms, understanding the role and mechanism of virulence factors in A. baumannii pathogenesis constitute novel therapeutic targets for rational drug design. We conducted a prospective exploratory study by investigating the prevalence of A. baumannii within a general hospital in western China, then analyzing the distribution of 9 virulence genes, and trying to explore the primary characteristics of the virulence genes within clinically MDR and non-MDR isolates of A. baumannii.

RESULTS

Clinical information of the isolates

To investigate the epidemiology of A. baumannii, a total of 88 A. baumannii clinical isolates causing nosocomial infections were identified. The clinical characteristics of the 88 patients with A. baumannii infections were summarized in Supplementary Table 1. Epidemiological analysis of the 88 patients carrying A. baumannii (56 males and 32 females) revealed that 25 were ≥79 years old, 32 were between 69 and 79 years old, 17 were between 59 and 69 years old and 14 were ≤59 years old (Figure 1a). This indicates that the risk of A. baumannii infection would be increased with compromised immunity in aging demographics. The 88 A. baumannii clinical isolates were obtained from different types of specimens including sputum (71.6%, 63/88), sputum suction (13.6%, 12/88), douche (12.5%, 11/88), urine (1%, 1/88) and blood (1%, 1/88). Most of the clinical specimens were isolated from sputum and sputum suction, which is consistent with that A. baumannii is a major pathogen associated with respiratory tract infection. The most prevalent department of isolation was the Respiratory department (37.5%, 33/88), followed by ICU (23.9%, 21/88), Neurology department (7.9%, 7/88), Cardiovascular department (6.8%, 6/88), Nephrology department (5.7%, 5/88), and other wards (18.2%, 16/88) (Figure 1b).
Figure 1

(a) Distribution of the age of biocides for 88 clinical isolates of A. baumannii. (b) The source distribution for 88 clinical of A. baumannii. (c) Distribution of the source for the larger cluster (A, D, H and M).

(a) Distribution of the age of biocides for 88 clinical isolates of A. baumannii. (b) The source distribution for 88 clinical of A. baumannii. (c) Distribution of the source for the larger cluster (A, D, H and M).

Genotyping of A. baumannii clinical isolates

To determine the spread of A. baumannii within the hospital setting, all isolates were genotyped using PFGE (Pulsed Field Gel Electrophoresis). PFGE results were analyzed by BioNumerics and pulsotype designation was based on isolates showing ≥80% relatedness. PFGE fingerprinting analysis revealed that 58 A. baumannii isolates (all ≥80% relatedness) were Epidemic group and the remaining 31 A. baumannii isolates (all <80% relatedness) were Sporadic group (Supplementary Figure 1). The Epidemic group were classified into 13 major clusters from A to M, in which the Larger Clusters (cluster A, D, H and M, N ≥5) contains a total of 44.3%. Cluster A (19.3%, 17/88) was most frequently detected in the clinical isolates and was responsible for an epidemic between January and February in 2014, and in the Respiratory department (N = 9), ICU (N = 5), Internal Medicine Ward (N = 1), General surgery ward (N = 1) and Cardiovascular department (N = 1). Cluster D (12.5%, 11/88) was second most frequent that detected in the clinical isolates and was closely correlated in August (N = 3), July (N = 1) and September (N = 1) in 2014 and January (N = 3), August (N = 2) and July (N = 1) in 2015, with a source of Respiratory department (N = 6), ICU (N = 3), Nephrology department (N = 1) and Neurology department (N = 1). Cluster H (6.8%, 6/88) was closely correlated with April (N = 5) and July (N = 1) in 2014, and comes from the ICU (N = 3), Respiratory department (N = 1), Geriatric Medicine (N = 1) and Cardiovascular department (N = 1). Cluster M (5.7%, N = 5) was closely correlated with December in 2013 (N = 4) and August in 2014, and distributed in the Respiratory department (N = 2), ICU (N = 2) and Digestive System Department (N = 1) (Supplementary Table 1). Although a small proportion of these Larger Clusters were discretely distributed at different wards, most of the strains were found within were mainly concentrated in respiratory and ICU wards (Figure 1c).

Antimicrobial susceptibility of A. baumannii clinical isolates

To understand the drug-resistance of 88 A. baumannii clinical isolates, antimicrobial susceptibility testing was performed. The results showed that the resistance rates to levofloxacin, ciprofloxacin, gentamicin, amikacin, tobramycin, minocycline, doxycycline, meropenem, imipenem and polymyxin B accounted for 34.1% (30/88), 68.2% (60/88), 67.0% (59/88), 58.0% (51/88), 58.0% (51/88), 1.1% (1/88), 67.0% (59/88), 54.5% (48/88), 65.9% (58/88) and 0% (0/88), respectively (Table 1). The resistance rates of ciprofloxacin, gentamicin, amikacin, tobramycin, doxycycline, meropenem and imipenem were all above 50%, while those of levofloxacin, polymyxin B and minocycline were only 34.1%, 0% and 1.1%, respectively. Most importantly, in the Larger Clusters (cluster A, D, H and M), the rates of resistance to some antibiotics were almost over 80% (Table 1). From these results we can reasonably infer that minocycline and polymyxin B may be used as empiric treatment agents for A. baumannnii in China. Interestingly, the resistance rate of all the antibiotics in the Epidemic group was significantly higher than that of the Sporadic group, except for minocycline and polymyxin B (P value <0.05).
Table 1

Data of A. baumannii isolates resistant to selected antibiotics and genotyping

Antimicrobial agentsAllLarger Clusters (N=39)EpidemicSporadicP value
88 (%)Cluster ACluster DCluster HCluster M58 (n, %)30 (n, %)
17 (%)11 (%)6 (%)5 (%)
LEV34.158.845.533.360.028, 48.32, 6.7<0.000
CIP68.294.190.910080.051, 87.99, 30<0.000
MIN1.100020.01, 1.701
DOX67.010090.910080.051, 87.98, 26.7<0.000
AMK58.010054.510060.047, 81.04, 13.3<0.000
GEN67.010063.610080.049, 84.510, 33.3<0.000
TOB58.094.154.510060.045, 77.66, 20<0.000
MERO54.594.172.710060.043, 74.15, 16.7<0.000
IMP65.910090.910060.050, 86.28, 26.7<0.000
PB0000000
MDR52.394.154.510060.044, 75.92, 6.7<0.000

LEV, Levofloxacin; CIP, Ciprofloxacin; MIN, Minocycline; DOX, Doxycycline; AMK, Amikacin; GEN, Gentamicin; TOB, Tobramycin; IMP, Imipenem; MERO, Meropenem; Polymyxin B, PB; MDR, Multidrug resistance; P value, Chi-square test or Fisher exact test. Larger Clusters mean clusters contains a larger number of strains (N≥5).

LEV, Levofloxacin; CIP, Ciprofloxacin; MIN, Minocycline; DOX, Doxycycline; AMK, Amikacin; GEN, Gentamicin; TOB, Tobramycin; IMP, Imipenem; MERO, Meropenem; Polymyxin B, PB; MDR, Multidrug resistance; P value, Chi-square test or Fisher exact test. Larger Clusters mean clusters contains a larger number of strains (N≥5). For cross-resistance profile in these isolates, we found that the prevalence of MDR A. baumannii isolates was 52.3% (46/88) in the present study. Combined with the genotype data of these 88 A. baumannii isolates, the resistance rate of MDR A. baumannii in the Sporadic group was only 6.7% (2/30) (P value <0.01, Table 1). On the contrary, MDR A. baumannii isolates almost predominated in the Epidemic group, and A. baumannii isolates in cluster A (94.1%, 16/17) and cluster H (100%, 6/6) were almost all MDR. Above all, the high proportion of MDR A. baumannii in the Epidemic group indicated that MDR A. baumannii is more likely to spread and cause infection in the hospital.

Prevalence of virulence genes among A. baumannii

To investigate the virulence potential of 88 A. baumannii clinical isolates, PCR was conducted to detected 9 virulence associated genes (mentioned in the Introduction section and listed in Table 2). The results showed that the virulence genes bap (95.5%, 84/88), surA1 (92.0%, 81/88), BasD (92.0%, 81/88), paaE (88.6%, 78/88) and pld (87.5%, 77/88) were accounted for high proportion (>80%) in these 88 A. baumannii isolates. Meanwhile, more than half of the clinical isolates carried BauA (62.5%, 55/88), omp33-36 (59.1%, 52/88) and pglC (53.4%, 47/88). However, no traT (serum resistance gene) were detected in these A. baumannii isolates (Table 3).
Table 2

Virulence genes among multidrug resistance and genotyping Acinetobacter baumannii strains isolated

All (n, %)cluster A (N=17)cluster D (N=11)cluster H (N=6)cluster M (N=5)MDR (N=46) (n, %)non- MDR (N=42) (n, %)P valueEpidemic N=58 (n, %)Sporadic N=30 (n, %)P value
bap84, 95.510010010080.045, 97.839, 92.90.54557, 98.327, 90.00.22
surA181, 92.010010010060.046, 10035, 83.30.00455, 94.526, 86.80.355
BasD81, 92.010010010060.044, 95.737, 88.10.36155, 94.526, 86.90.071
BauA55, 62.588.272.783.360.036, 78.319, 45.20.00144, 75.911, 36.7<0.000
pld77, 87.510010010040.044, 95.733, 78.60.01653, 91.424, 800.234
omp-33-3652, 59.152.963.666.740.026, 56.526, 61.90.60829, 50.023, 76.70.016
paaE78, 88.610090.910060.045, 97.833, 78.60.01254, 93.124, 800.138
pglC47, 53.441.272.716.760.021, 45.726, 61.90.12731, 53.416, 53.30.992
tra T000000000
Table 3

Virulence genes among antibiotic resistance and sensitive of Acinetobacter baumannii strains isolated

Virulence genesLEVPCIPPMINPDOXPAMKPGENPTOBPIMPPMEROp
R 30Non-R 58R 60Non-R 28R 1Non-R 87R 59Non-R 29R 51Non-R 37R 59Non-R 29R 51Non-R 37R 58Non-R 30R 48Non-R 40
bap29555826126572750345727493557274737
surA1285358230235724*5130*57245031*5823*4833*
BasD27545625025552649325526483356254635
BauA2530*469*08**469*4114*4510*4015*4411*3619*
pld26515621*0215522*4928*5522*4928*5621*4631*
omp33-361240*3517018331929233418302235173121
paaE28505721*0215622*5028*55234929*5622*4731
pglC15323116116311624232819232429182225
tra T000000000000000000

LEV, Levofloxacin; CIP, Ciprofloxacin; MIN, Minocycline; DOX, Doxycycline; AMK, Amikacin; GEN, Gentamicin; TOB, Tobramycin; IMP, Imipenem; MERO, Meropenem; R, Resistant; non-R, non- resistant; P, P value, Chi-square test or Fisher exact test; *, P value < 0.05; Same as in Table 2.

LEV, Levofloxacin; CIP, Ciprofloxacin; MIN, Minocycline; DOX, Doxycycline; AMK, Amikacin; GEN, Gentamicin; TOB, Tobramycin; IMP, Imipenem; MERO, Meropenem; R, Resistant; non-R, non- resistant; P, P value, Chi-square test or Fisher exact test; *, P value < 0.05; Same as in Table 2. Associated with the drug-resistance of 88 A. baumannii clinical isolates, the results revealed that the distribution of each virulence associated gene has some unique characteristics. The rate of surA1 among aminoglycosides (tobramycin and amikacin), doxycycline and carbapenems (imipenem and meropenem) resistant isolates was significantly higher than that in homologous sensitive isolates. The rate of BauA among the vast majority of antibiotics resistant (levofloxacin, ciprofloxacin, gentamicin, tobramycin, amikacin, doxycycline, imipenem and meropenem) isolates was significantly higher than that of homologous sensitive isolates. The rate of pld among doxycycline, aminoglycosides and carbapenem resistant isolates was significantly higher than that of homologous sensitive isolates. The rate of paaE among ciprofloxacin, gentamicin, tobramycin, amikacin, doxycycline, imipenem and meropenem resistant isolates was significantly higher than that of homologous sensitive isolates. But what’s interesting is that the rate of omp33-36 among levofloxacin sensitive isolates was significantly higher than that of levofloxacin resistance isolates. In summary, these relationships are statistically significant (P value <0.05) (Table 4), and the antibiotic-resistant A. baumannii carries more virulence genes.
Table 4

Virulence genes primer used in this study and the protein functions

Virulence geneNucleotide sequenceProtein function/descriptionReference
bapF: AGTTAAAGAAGGGCAAGAAGR: GGAGCACCACCTAACTGABiofilm maturation, maintenance[54]
surA1F: CAATTGGTAGCTGGCGATCAR: TTAGGCGGGACTCAGCTTTTSurface antigen protein 1[13]
BasDF: CTCTTGCATGGCAACACCACR: CCAACGAGACCGCTTATGGTAcinetobactin biosynthesisIron acquisition system[55, 56]
BauAF: TGGCAAGGTGAAAATGCACGR: GCCGCATATGCCATCAACTGAcinetobactin transportIron acquisition system
PldF: CCGTCAATTACGCCAAGCTGR: CTGACGCTACCTGACGGTTTPhospholipase D[57, 58]
omp33-36F: ATTAGCCATGACCGGTGCTCR: CCACCCCAAACATGGTCGTAOuter membrane porin[5961]
paaEF: CTATTTAGGCGTTGCTGCGGR: CCTTACAACGACAGGTCGCAphenylalanine catabolic pathway[62, 63]
pglCF: TGGATGAGTTAGCTGCR: TTTTACAAATAGTTAAGCO-glycosylation systemcapsular polysaccharide[14, 64]
traTF: GGTGTGGTGCGATGAGCACAGR: CACGGTTCAGCCATCCCTGAGSerum-resistance-associated[65]
Further analysis in cross-resistance profile found that, the carriage ratio of surA1, BauA, pld and paaE in MDR A. baumannii isolates (100.0%, 78.3%, 95.7%, 97.8%) was significantly higher (P value <0.05) than in non-MDR A. baumannii isolates (83.3%, 45.2%, 78.6%, 78.6%), and the carriage ratio of BasD in Epidemic isolates (94.5%) was significantly higher (P value <0.05) than in Sporadic isolates (86.9%) (Table 3).

DISCUSSION

Acinetobacter spp. was initially considered as an opportunistic human pathogen of low virulence with minimal significance. However, during the last two decades, the increasing ubiquity and intensity of mechanical ventilation, central venous and urinary catheterization, and antibacterial therapy have caused a surge in the frequency and severity of Acinetobacter infections [22-24]. A. baumannii is endowed with an open pan genome, which means it can easily acquire new function. The persistence of A. baumannii in the hospital setting, together with the strong selection pressure imposed by the use of antimicrobials in the clinical practice, has promoted the evolution of clinical A. baumannii towards drug resistance isolates and the formation of some virulence factors which facilitate the survival of A. baumannii in the hospital [25]. Drug-resistant A. baumannii is more likely to survive in hospital environment, causing an outbreak in the hospital [26, 27]. The treatment of A. baumannii infections is becoming a serious problem because of its strong antibiotic resistance [28]. Especially, surveillance by the CHINET project demonstrated that resistance of A. baumannii strains to carbapenems increased from 31 to 66.7% between 2005 and 2014 [29]. The current data showed that the resistance rate of imipenem (65.9%, Table 1) was higher than our previous report (60.9%) [10]. Although the resistance rate is lower than in Turkey (94.9%) [30] and Iran (82%) [31], it is still in a rising tendency. This suggests that carbapenems can’t be habitually used in A. baumannii infectious treatment. Here, we found that the MDR A. baumannii in the Epidemic group (44/58, 75.9%) was higher than that of Sporadic group (2/30, 6.7%) (P value < 0.05, Table 1). In addition, the Larger Clusters A, D, H and M in the Epidemic group are all substantially composed of MDR A. baumannii, and showed resistance to most of the antibiotics. This result may due to the clinical abuse of antibiotics, and resistant A. baumanii was screened to survive, and then gradually developed into MDR A. baumannii. So, their persistent selection and ongoing transmission in hospital may result in epidemic outbreak [32, 33]. Traditional thinking was that antibiotic resistance caused a metabolic cost to the bacterium and hence the “anti-virulence” factor [34]. However, the White paper reported that a lung and blood clinical isolate (A. baumannii HUMC1) is not only an extreme drug-resistant isolate (almost resistant to all antibiotics, except colistin), but also a hyper-virulent isolate [35]. Meanwhile, some researchers have also suggested that MDR A. baumannii can survive proliferation even after the host treated with antibiotics, and then producing a variety of metabolites that upset the physiological balance of the host as a virulence effect [13, 36]. Accordingly, the clinical outcome of A. baumannii infections is jointly influenced by antimicrobial resistance and virulence factor. The infection symptoms caused by A. baumannii are closely associated with its virulence factor. But the virulence genes distribution in clinical A. baumannii were rarely reported, except for bap, omp33-36 and traT [37, 38]. This work examined the distribution of 9 virulence genes in clinically collected A. baumannii isolates. Our results showed that the existence rate of each virulence gene in the A. baumannii isolates was more than 50%, except traT (Table 3). Furthermore, the virulence genes carriage rate of A. baumannii in MDR was significantly higher than that of non-MDR A. baumannii (P< 0.05, Table 3), such as surA1, BauA, pld and paaE. This suggests that the drug resistant A. baumannii isolates appear to have greater potentials for toxicity. Biofilm is an important virulence factor of A. baumannii. Loehfelm et al. suggested the development and thickness of the mature biofilm structure and intercellular adhesion were closely associated with Bap family proteins (coded gene bap) [39]. The bap genes were detected with very high frequency in clinical A. baumannii from Iran (92%) [40], Republic of Korea (100%) [37] and USA (84%) [41]. This work also showed that A. baumannii isolates frequently possess bap genes (95.5%). These results indicate that most A. baumannii may have the biofilm formation ability. Baumannii acinetobactin utilization (BauA) is an outer membrane protein, acting out the siderophore-ferric complex receptor [42]. Whole protein includes 2 domains comprising a cork domain at N terminal of the protein and a transmembrane barrel at the C terminal [43]. This work showed the rate of virulence gene BauA was significantly higher in drug-resistant A. baumannii (P<0.05, Table 4), and A. baumannii isolates with BauA gene seems to show a wide range of drug resistance. So, we speculate that the transmembrane barrel may be associated with drug resistance in A. baumannii. A. baumannii phenylacetate degradation pathway was a hybrid pathway [12], and a key step in this pathway is performed by the paaE gene [44]. This study indicates that the rates of paaE were higher in the ciprofloxacin, tobramycin, amikacin, doxycycline or imipenem resistant A. baumannii isolates than in the corresponding sensitive isolates (P< 0.05, Table 4). We speculate these antibiotics may be metabolized as substrates during the metabolism of phenylacetic. Some recent studies have reported that the virulence gene omp33-36 contributes to resistance to carbapenems in A. baumannii [45-47]. But in our work, there was no significant difference in the frequency of omp33-36 gene carried between carbapenems-resistant and -sensitive A. baumannii (Table 4). In contrast, our work showed that A. baumannii, which was found to be levofloxacin-sensitive, appears to carry more virulence gene omp33-36, and only a few A. baumannii isolates developed resistance to levofloxacin. We think levofloxacin is an effective drug for the treatment of A. baumannii infection. A recent study reported that traT (80%) was found high frequency in CR-A. baumannii isolates in Iran [38]. However, this study showed that none of the 88 A. baumannii clinical isolates carried the traT gene, which was similar to the report of Brasil, 2004 [48]. This indicates that traT gene frequently existing in CR- A. baumannii is not a universal phenomenon, for the moment only finding in Iran. In summary, our findings showed that the prevalence of MDR A. baumannii isolates collected from different wards was 52.3%, and the MDR A. baumannii in the Epidemic group was significant higher than that of Sporadic group. Virulence associated genes detected in this study accounted for a high proportion among the 88 A. baumannii clinical isolates, especially in the MDR A. baumannii isolates, which means high risk, high pathogenicity and high treatment challenge. At the same time, our work indicates that some potential links between virulence genes and drug resistance. This work strongly suggests that hospitals need to strengthen infection control to prevent A. baumannii from causing an outbreak of infection.

MATERIALS AND METHODS

Bacterial isolates and growth conditions

The 88 nonrecurring clinical isolates of A. baumannii used in this study were collected from patients with nosocomial infections during the period from April 2013 to October 2015, at the First Affiliated Teaching Hospitals of Chengdu Medical College in Sichuan province, China. All isolates were collected as part of routine care, data were collected, identified and handled anonymously. The strains were stored in glycerol at -80°C and bacteria were grown on MacConkey Agar (MCA plates) (Oxoid, England) before tested. Isolates were identified by VITEK 2 (bioMe’rieux, Marcy-l’E’toile, France) automated microbiology system. Besides, all isolates were further verified by detecting the existence of the rpoB and sequencing the 16S-23S rRNA gene spacer region [10].

Pulsed-field gel electrophoresis testing

All the 88 A. baumannii isolates were genotyped by using Pulsed-Field Gel Electrophoresis (PFGE) analysis as previously described [49]. A. baumannii isolates were grown on Mueller-Hinton agar medium plates overnight at 37 °C and bacterial genomic DNAs were prepared. After the genomic DNA was digested with ApaI (TaKaRa, Dalian, China), the DNA fragments were separated by electrophoresis in 1% gold agarose (Lonza) in 0.5 × Tris - borate - EDTA buffer with a CHEF apparatus (CHEF Mapper XA, Bio-Rad, USA). The conditions included 14°C and 6V/cm with alternating pulses at a 120° angle with a 5-35s pulse time gradient for a total of 22 h. The same method was also used to extract the Salmonella enterica serotype Braenderup H9812 genomic DNAs, which was used as the size marker after being digested by XbaI (TaKaRa, Dalian, China) [50]. The similarity examination of DNA patterns analyzed with BioNumerics 7.0 (Applied Math, USA) was based on Tenover criteria and Dice coefficient, and 80% relatedness was used as the threshold to distinguish the pulsotype [51].

Antimicrobial susceptibility testing

The 88 A. baumannii strains were tested for their susceptibilities to 10 antibiotics: levofloxacin, ciprofloxacin, gentamicin, amikacin, tobramycin, minocycline, doxycycline, meropenem, imipenem and polymyxin B. The minimal inhibitory concentrations (MICs) were determined by agar dilution method and interpreted as previously described in the guidelines according to the 2017 Clinical and Laboratory Standards Institute (CLSI) [52]. Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were both used as quality control strains. The MICs value used to indicate antibiotic resistance are ≥4 μg/ml for ciprofloxacin and polymyxin B in accordance with CLSI, ≥8 μg/ml for levofloxacin, meropenem and imipenem, ≥16 μg/ml for gentamicin, tobramycin, minocycline and doxycycline, and ≥64 μg/ml for amikacin.

Definition of multidrug resistance (MDR)

Base on researchers’ definition of MDR among A. baumannii in many published works [53], we defined MDR A. baumannii as containing resistance to any combination of 3 or more of the 4 drug classes commonly used to treat Gram negative infections: fluoroquinolones, aminoglycosides, carbapenems and tetracyclines. Resistance to an antibiotic class was defined as resistance to all drugs representative of that class in this panel.

PCR amplification and DNA sequencing for virulence genes detecting

9 virulence genes as listed in Table 2 were detected by PCR to investigate the distribution in the 88 A. baumannii strains. The primers used were also listed in Table 2 and PCR was carried out according to references in the same table. The PCR products were sequenced by TSINGKE (Chengdu, China) and then confirmed by sequence alignment to the corresponding genes of A. baumannii with NCBI Nucleotide Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi)
  59 in total

Review 1.  The genomics of Acinetobacter baumannii: insights into genome plasticity, antimicrobial resistance and pathogenicity.

Authors:  Francesco Imperi; Luísa C S Antunes; Jochen Blom; Laura Villa; Michele Iacono; Paolo Visca; Alessandra Carattoli
Journal:  IUBMB Life       Date:  2011-10-27       Impact factor: 3.885

Review 2.  Clinical impact and pathogenicity of Acinetobacter.

Authors:  M-L Joly-Guillou
Journal:  Clin Microbiol Infect       Date:  2005-11       Impact factor: 8.067

3.  Association of the outer membrane protein Omp33 with fitness and virulence of Acinetobacter baumannii.

Authors:  Younes Smani; Juan Dominguez-Herrera; Jerónimo Pachón
Journal:  J Infect Dis       Date:  2013-08-01       Impact factor: 5.226

4.  Inactivation of phospholipase D diminishes Acinetobacter baumannii pathogenesis.

Authors:  Anna C Jacobs; Indriati Hood; Kelli L Boyd; Patrick D Olson; John M Morrison; Steven Carson; Khalid Sayood; Peter C Iwen; Eric P Skaar; Paul M Dunman
Journal:  Infect Immun       Date:  2010-03-01       Impact factor: 3.441

Review 5.  Acinetobacter outbreaks, 1977-2000.

Authors:  Maria Virginia Villegas; Alan I Hartstein
Journal:  Infect Control Hosp Epidemiol       Date:  2003-04       Impact factor: 3.254

6.  traT gene sequences, serum resistance and pathogenicity-related factors in clinical isolates of Escherichia coli and other gram-negative bacteria.

Authors:  M A Montenegro; D Bitter-Suermann; J K Timmis; M E Agüero; F C Cabello; S C Sanyal; K N Timmis
Journal:  J Gen Microbiol       Date:  1985-06

7.  Identification and characterization of an Acinetobacter baumannii biofilm-associated protein.

Authors:  Thomas W Loehfelm; Nicole R Luke; Anthony A Campagnari
Journal:  J Bacteriol       Date:  2007-11-16       Impact factor: 3.490

8.  Epidemiology of bloodstream infections caused by Acinetobacter baumannii and impact of drug resistance to both carbapenems and ampicillin-sulbactam on clinical outcomes.

Authors:  Teena Chopra; Dror Marchaim; Reda A Awali; Amar Krishna; Paul Johnson; Ryan Tansek; Khawar Chaudary; Paul Lephart; Jessica Slim; Jatinder Hothi; Harris Ahmed; Jason M Pogue; Jing J Zhao; Keith S Kaye
Journal:  Antimicrob Agents Chemother       Date:  2013-10-07       Impact factor: 5.191

9.  Persistence of Multidrug-Resistant Acinetobacter baumannii Isolates Harboring blaOXA-23 and bap for 5 Years.

Authors:  Ji Youn Sung; Sun Hoe Koo; Semi Kim; Gye Cheol Kwon
Journal:  J Microbiol Biotechnol       Date:  2016-08-28       Impact factor: 2.351

10.  Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii.

Authors:  Steven E Fiester; Brock A Arivett; Robert E Schmidt; Amber C Beckett; Tomislav Ticak; Mary V Carrier; Rajarshi Ghosh; Emily J Ohneck; Maeva L Metz; Marlo K Sellin Jeffries; Luis A Actis
Journal:  PLoS One       Date:  2016-11-22       Impact factor: 3.240

View more
  9 in total

1.  Trends and Development in the Antibiotic-Resistance of Acinetobacter baumannii: A Scientometric Research Study (1991-2019).

Authors:  Xuebing Liu; Xiaoheng Wu; Jianhua Tang; Lin Zhang; Xu Jia
Journal:  Infect Drug Resist       Date:  2020-09-16       Impact factor: 4.003

2.  Delineating the Immuno-Dominant Antigenic Vaccine Peptides Against gacS-Sensor Kinase in Acinetobacter baumannii: An in silico Investigational Approach.

Authors:  A S Smiline Girija
Journal:  Front Microbiol       Date:  2020-09-08       Impact factor: 5.640

3.  The Acinetobacter trimeric autotransporter adhesin Ata controls key virulence traits of Acinetobacter baumannii.

Authors:  Marko Weidensdorfer; Masahito Ishikawa; Katsutoshi Hori; Dirk Linke; Bardya Djahanschiri; Ruben Iruegas; Ingo Ebersberger; Sara Riedel-Christ; Giulia Enders; Laura Leukert; Peter Kraiczy; Florian Rothweiler; Jindrich Cinatl; Jürgen Berger; Katharina Hipp; Volkhard A J Kempf; Stephan Göttig
Journal:  Virulence       Date:  2019-12       Impact factor: 5.882

4.  Mutation of CarO participates in drug resistance in imipenem-resistant Acinetobacter baumannii.

Authors:  Li-Jing Zhu; Xiao-Ying Chen; Pan-Fei Hou
Journal:  J Clin Lab Anal       Date:  2019-07-18       Impact factor: 2.352

5.  Molecular Epidemiology and Clone Transmission of Carbapenem-Resistant Acinetobacter baumannii in ICU Rooms.

Authors:  Xiufeng Zhang; Fangping Li; Furqan Awan; Hongye Jiang; Zhenling Zeng; Weibiao Lv
Journal:  Front Cell Infect Microbiol       Date:  2021-02-26       Impact factor: 5.293

6.  A Comprehensive Study of the Relationship between the Production of β-Lactamase Enzymes and Iron/Siderophore Uptake Regulatory Genes in Clinical Isolates of Acinetobacter baumannii.

Authors:  Mahyar Porbaran; Hamed Tahmasebi; MohammadReza Arabestani
Journal:  Int J Microbiol       Date:  2021-03-17

Review 7.  Adverse clinical outcomes associated with carbapenem-resistant Acinetobacter (CRA) infections: a systematic review and meta-analysis.

Authors:  Weiping Ling; Luis Furuya-Kanamori; Yukiko Ezure; Patrick N A Harris; David L Paterson
Journal:  JAC Antimicrob Resist       Date:  2021-11-05

8.  Genomic Investigation of Two Acinetobacter baumannii Outbreaks in a Veterinary Intensive Care Unit in The Netherlands.

Authors:  Soe Yu Naing; Joost Hordijk; Birgitta Duim; Els M Broens; Linda van der Graaf-van Bloois; John W Rossen; Joris H Robben; Masja Leendertse; Jaap A Wagenaar; Aldert L Zomer
Journal:  Pathogens       Date:  2022-01-20

9.  Using comparative genomics to understand molecular features of carbapenem-resistant Acinetobacter baumannii from South Korea causing invasive infections and their clinical implications.

Authors:  Min Hyung Kim; Haeyoung Jeong; Young Mi Sim; Soohyun Lee; Dongeun Yong; Choong-Min Ryu; Jun Yong Choi
Journal:  PLoS One       Date:  2020-02-21       Impact factor: 3.240

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.