Literature DB >> 29774076

The human somatostatin receptor type 2 as an imaging and suicide reporter gene for pluripotent stem cell-derived therapy of myocardial infarction.

Katrien Neyrinck1,2, Natacha Breuls3, Bryan Holvoet1, Wouter Oosterlinck4, Esther Wolfs5, Hubert Vanbilloen1, Olivier Gheysens1, Robin Duelen3, Willy Gsell6, Ivo Lambrichts5, Uwe Himmelreich6, Catherine M Verfaillie2, Maurilio Sampaolesi3, Christophe M Deroose1.   

Abstract

Rationale: Pluripotent stem cells (PSCs) are being investigated as a cell source for regenerative medicine since they provide an infinitive pool of cells that are able to differentiate towards every cell type of the body. One possible therapeutic application involves the use of these cells to treat myocardial infarction (MI), a condition where billions of cardiomyocytes (CMs) are lost. Although several protocols have been developed to differentiate PSCs towards CMs, none of these provide a completely pure population, thereby still posing a risk for neoplastic teratoma formation. Therefore, we developed a strategy to (i) monitor cell behavior noninvasively via site-specific integration of firefly luciferase (Fluc) and the human positron emission tomography (PET) imaging reporter genes, sodium iodide symporter (hNIS) and somatostatin receptor type 2 (hSSTr2), and (ii) perform hSSTr2-mediated suicide gene therapy via the clinically used radiopharmacon 177Lu-DOTATATE.
Methods: Human embryonic stem cells (ESCs) were gene-edited via zinc finger nucleases to express Fluc and either hNIS or hSSTr2 in the safe harbor locus, adeno-associated virus integration site 1. Firstly, these cells were exposed to 4.8 MBq 177Lu-DOTATATE in vitro and cell survival was monitored via bioluminescence imaging (BLI). Afterwards, hNIS+ and hSSTr2+ ESCs were transplanted subcutaneously and teratomas were allowed to form. At day 59, baseline 124I and 68Ga-DOTATATE PET and BLI scans were performed. The day after, animals received either saline or 55 MBq 177Lu-DOTATATE. Weekly BLI scans were performed, accompanied by 124I and 68Ga-DOTATATE PET scans at days 87 and 88, respectively. Finally, hSSTr2+ ESCs were differentiated towards CMs and transplanted intramyocardially in the border zone of an infarct that was induced by left anterior descending coronary artery ligation. After transplantation, the animals were monitored via BLI and PET, while global cardiac function was evaluated using cardiac magnetic resonance imaging.
Results: Teratoma growth of both hNIS+ and hSSTr2+ ESCs could be followed noninvasively over time by both PET and BLI. After 177Lu-DOTATATE administration, successful cell killing of the hSSTr2+ ESCs was achieved both in vitro and in vivo, indicated by reductions in total tracer lesion uptake, BLI signal and teratoma volume. As undifferentiated hSSTr2+ ESCs are not therapeutically relevant, they were differentiated towards CMs and injected in immune-deficient mice with a MI. Long-term cell survival could be monitored without uncontrolled cell proliferation. However, no improvement in the left ventricular ejection fraction was observed.
Conclusion: We developed isogenic hSSTr2-expressing ESCs that allow noninvasive cell monitoring in the context of PSC-derived regenerative therapy. Furthermore, we are the first to use the hSSTr2 not only as an imaging reporter gene, but also as a suicide mechanism for radionuclide therapy in the setting of PSC-derived cell treatment.

Entities:  

Keywords:  myocardial infarction; noninvasive imaging; stem cell therapy; suicide gene

Mesh:

Substances:

Year:  2018        PMID: 29774076      PMCID: PMC5957010          DOI: 10.7150/thno.22980

Source DB:  PubMed          Journal:  Theranostics        ISSN: 1838-7640            Impact factor:   11.556


Introduction

Myocardial infarction (MI) is one of the major reasons for mortality in the western world. It is caused by a temporary or permanent occlusion of one of the coronary arteries, resulting in an ischemic area and the loss of billions of cardiomyocytes (CMs). As CMs have only a limited proliferative capacity (annual turnover rate of less than 1%), the heart is unable to recover from this massive cell loss. Therefore, stem cells and more specifically pluripotent stem cell (PSC)-derived CMs have been investigated for their potential to repopulate the damaged heart 1-5. PSCs have an indefinite self-renewal capacity and are able to differentiate towards every cell type of the human body. Hence, they have an enormous potential within regenerative medicine. Unfortunately, differentiation protocols do not provide a pure CM population, thereby potentially leaving undifferentiated cells that can form a teratoma, a neoplastic lesion containing cells of the three germ layers 6. Despite this risk, numerous pre-clinical studies have demonstrated that PSC-derived CMs are able to couple with the host myocardium and partially repair a MI 1-4. Moreover, a patient suffering from a MI showed improvements after receiving an injection with PSC-derived cardiovascular progenitors. However, no direct link between the cell injection and the observed improvement could be drawn as the patient also received a coronary bypass 7. Currently, tissue sampling is the golden standard to follow-up cell engraftment in the clinic, thereby limiting information on the behavior, localization and viability of the cells over time. Therefore, imaging methods have been developed to noninvasively monitor stem cell distribution 8, 9. Here, we have focused on reporter gene imaging as it allows long-term cell tracking and only visualizes viable cells 8. Previously, exogenous genes were incorporated randomly in the genome using viral vectors. This can potentially induce insertional mutagenesis and unstable reporter gene expression 10. Furthermore, a heterogeneous cell population will be generated, as cells will bear different copy numbers of the reporter gene 11, 12. Therefore, alternative gene-editing strategies have been developed for site-specific reporter gene integration. One example is the use of zinc finger nucleases (ZFNs), consisting of a DNA binding domain, a zinc finger, and an endonuclease domain, FokI. Upon dimerization, a double strand DNA break is generated that can be repaired either by non-homologous end joining or by homologous recombination if a donor plasmid is provided with homologous sequences towards the regions of the double stranded DNA breaks 13. The adeno-associated virus integration site 1 (AAVS1) locus, encoding the ubiquitously expressed protein phosphatase 1 regulatory subunit 12 C on chromosome 19, is a known 'safe harbor' locus, meaning that integration of foreign material does not evoke pathological responses and perturbs neither proliferation nor the characteristics of the cell. In addition, this region is always located in open chromatin and is not hampered with reporter gene silencing 13, 14. These features make targeted integration into the AAVS1 locus a better and safer strategy to express exogenous genes. The radionuclide imaging reporter genes human somatostatin receptor type 2 (hSSTr2) and human sodium iodide symporter (hNIS) were chosen as they both are of human origin and allow cell tracking using clinical radionuclide imaging devices. Different groups have already demonstrated the ability to monitor stem cells in the heart via the hNIS 15-17, but this has not been demonstrated for hSSTr2. Furthermore, therapeutic radiopharmaceuticals, such as 177Lu-DOTATATE, have been shown to specifically target hSSTr2-overexpressing tumors, resulting in prolonged progression-free survival in patients with midgut neuroendocrine tumors (NETs) 18. In this study, we explored the possibility to gene-edit and monitor human embryonic stem cells (ESCs) by both radionuclide imaging reporter genes (hSSTr2 and hNIS). Furthermore, we assessed if hSSTr2 could be used as a suicide gene in case of uncontrolled cell proliferation. After differentiation towards CMs, we assessed the feasibility of long-term cell tracking via bioluminescence imaging (BLI) and small animal positron emission tomography (PET) and the potential therapeutic efficacy using cardiac magnetic resonance imaging (MRI).

Materials

Cell culture

H9 (WA09, WiCell Research Institute, Madison, USA) human ESCs were cultured and gene-edited as described previously 19.

Cardiac differentiation

According to the PSC CM Differentiation Kit (Gibco, Waltham, MA, USA), ESCs were differentiated towards CMs.

Gene expression analysis

RNA was isolated using the PureLink RNA Mini Kit (Invitrogen, Carlsbad, CA, USA) and 500 ng of RNA was retro-transcribed into cDNA using the Superscript III Reverse Transcriptase First-Strand Synthesis SuperMix (Invitrogen). Next, quantitative real-time PCR (qRT-PCR) was performed with the Platinum SYBR Green qRT-PCR SuperMix-UDG (Invitrogen). The cycle consisted of 2 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 45 s at 60 °C. All primers are listed in Table .

Immunofluorescence

ESC-derived CMs were fixed and stained according to the protocol previously described 20 with rabbit anti-CX-43 (1/1000, Abcam, Cambridge, United Kingdom) primary antibody at 4 °C, overnight. Next, the cells were stained with anti-rabbit Alexa fluorophore 488 (1/500, Invitrogen, Thermo Fisher Scientific) and mouse anti-α-smooth muscle actin (αSMA)-Cy3 antibody at room temperature for 60 min and 2 h, respectively. Afterwards, Hoechst (1/1000, Sigma-aldrich, Saint Louis, Missouri, UDA) staining was performed for 5 minutes.

Teratoma assay

The Ethical Committee of the KU Leuven (P160/2015 & P096/2016) approved all animal experiments. Five-week-old female thymic aplasia nude (NMRI-nu; Janvier Labs) mice (~20 g) were subcutaneously injected with 1.5-2 million ESCs expressing either hNIS (injection right side) or hSSTR2 (injection left side) (n=17). During this procedure, the mice were anaesthetized with 3% isoflurane (IsoVET, 100 mg/g, Eurovet, Piramal Healthcare) in 100% O2 (flow rate 2 L/min).

Bioluminescence imaging

In vitro BLI experiments were performed as described previously 19. Briefly, cells were incubated with 0.3 mg/L D-luciferin (Promega, Benelux, Leiden, The Netherlands) and light photons were detected with the IVIS Spectrum (Caliper Life Sciences, Hopkington, MA, USA). For the in vivo BLI, mice were sedated with 2-3% isoflurane in 100% O2 (2 L/min) and subcutaneously injected with 126 mg/kg D-luciferin (Promega). Light photons were detected with the IVIS Spectrum (Caliper Life Sciences).

Radionuclide experiments

Tracer uptake

Tracer uptake experiments were performed as previously described 19. Efflux of 99mTcO4- and 68Ga-DOTATATE from hNIS+ and hSSTr2+ cells was measured by incubating the cells with 99mTcO4- and 68Ga-DOTATATE, respectively for 1 h or 10 min, followed by an incubation with tracer-free DMEM for 5, 15, 30 and 60 min. Afterwards, the same steps were used as previously described 19.

177Lu-DOTATATE treatment

In vitro: hNIS+ or hSSTr2+ ESCs were plated on matrigel-coated 24-well plates and kept under normoxic conditions. The following day, a baseline in vitro BLI scan was performed. Next, hSSTr2+ ESCs and hNIS+ ESCs were exposed to either PBS (vehicle) or 4.8 MBq 177Lu-DOTATATE for 1 h followed with 5 times of rinsing. Follow-up BLI scans were performed 2, 4 and 6 days after exposure. In vivo: The animals with subcutaneous teratomas received an intravenous tail injection of 55.5 MBq of 177Lu-DOTATATE or sterile saline, 60 days after cell injection.

Small animal PET

hSSTr2+ and hNIS+ ESCs were visualized by an intravenous injection of 5-7 MBq 68Ga-DOTATATE or 124I, respectively. A 20 min static scan was acquired 2 h after 124I and 1 h after 68Ga-DOTATATE administration, using the Focus 220 small-animal PET system (Siemens Medical Solutions, Knoxville, TN, USA). For every scan, a transmission scan was obtained using a 57Co-source (5 mCi; Eckert & Ziegler, Berlin, Germany). During injection and PET imaging, mice were anaesthetized with 2-3% isoflurane (Piramal Healthcare) in 100% O2 (2 L/min). PET images were reconstructed through a maximum a posteriori (MAP) reconstruction algorithm and further analyzed with PMOD 3.0 (PMOD technologies, Zürich, Switzerland). Images were converted to standardized uptake values (SUV), calculated according to the following formula: Volumes of interest (VOI) were positioned manually around the graft regions with the contralateral side as control.

Intra-myocardial cell injection and myocardial infarct model

For intra-myocardial cell (n=4) or sham (n=4) injection, 12-week-old Rag2/γc-/- mice (body weight ≥22 g) were anaesthetized via intraperitoneal injection of 5 mg/mL ketamine (Nimatek, 100 mg/mL, Eurovet, Piramal Healthcare) and 0.05 mg/mL domitor (1 mg/mL, Vétoquinol, Lure cedex, France) and subsequently 0.05 mg/mL atropine (0.5 mg/mL, Sterop Group, Brussels, Belgium). Mechanical ventilation (Minivent 845; Hugo Sachs/Harvard Apparatus, March-Hugstetten, Germany) was started with 50% oxygenated air, a tidal volume of three times body weight + 155 µL and respiratory rate of 135 strokes/min. First, a MI was generated by permanent occlusion of the left anterior descending coronary artery (LAD), as previously described 21. Afterwards, the mice received three injections of either CMs, each time 1 million hSSTr2+ ESC-derived CMs, or sham injections in the border region of the infarct. Afterwards, the mice were awakened by intraperitoneal administration of 0.25 mg/mL Antisedan (5.0 mg/mL, Vétoquinol). During the surgical procedure, ECG was monitored and the body temperature was maintained at physiological levels of 37±1 °C.

Cardiac MRI

MRI measurements were performed 3-5 days before inducing a MI. Immediately after the induction of a MI, cells or matrigel (sham) were injected and MRI scans were obtained 1, 2 and 4 weeks after MI induction. Mice were anaesthetized with isoflurane (induction: 2-3%, during measurement: 1.5-2%, both in O2) and adjusted to keep respiration rate at 100-120 breaths per minute. Body temperature was maintained at 37±1 °C. Cardiac MRI was performed using a small animal MRI scanner (Bruker Biospec 70/30; field strength 7 T; horizontal bore 30 cm; Bruker BioSpin, Ettlingen, Germany) equipped with an actively shielded gradient insert (200 mT/m) and quadrature volume coil (Bruker Biospin). MRI protocols were similar to previously described experiments 21. Briefly, after planning the geometry of the short axis view of the heart, two-dimensional short- and long-axis T1-weighted bright blood images were recorded using FLASH self-gated sequences (intragate) (repetition time = 10.32 ms; echo time = 3.92 ms; flip angle = 20°, field-of-view = 25 mm × 25 mm; matrix = 128×128; slice thickness = 1 mm throughout the heart). For image processing, the software Paravision 6 (Bruker Biospin) was used. Afterwards, left ventricular ejection fraction (LVEF) were manually calculated using the formula described below:

Statistical analysis

Data are presented as mean ± SD. One-way or two-way ANOVA was performed with a Tukey post-hoc test if the samples were normally distributed and had equal variances. Otherwise, the Kruskal-Wallis test was performed followed by the Dunns post-hoc test. P-values < 0.05 were considered statistically significant. Data were processed using GraphPad Prism version 5.00 for Windows (GraphPad Software, San Diego, California, USA).

Results

Embryonic stem cells maintained pluripotency and had functional reporter gene expression after gene-editing via zinc finger nucleases

Two human ESC lines expressing two different radionuclide reporter genes (hSSTr2+ and hNIS+ ESCs) were generated through ZFN-mediated site-specific integration in the AAVS1 locus. Besides the radionuclide reporter genes, eGFP and firefly luciferase (Fluc) were present in the cassette. The reporter gene cassette was driven by the hybrid CAGGS promoter. qPCR analysis showed similar expression values of pluripotency transcription factors OCT4, NANOG, SOX2 and C-MYC before and after gene-editing (Figure ). Gene-edited ESCs showed a functional Fluc expression as they produced BLI signals after incubation with D-luciferin, while only background values were obtained in wild-type (WT) ESCs (fold change: >105; p<0.01; Figure ). The functionality of both radionuclide reporter genes was assessed by in vitro radioligand uptake experiments. Cells were incubated with 124I and after one hour, 59.5±8.6% of 124I was taken up by hNIS+ ESCs. This uptake was ~100 times higher compared to hSSTr2+ and WT ESCs (p<0.001; Figure ). hSSTr2+ ESCs were able to bind 3.4±0.4% of 68Ga-DOTATATE after one hour of incubation and thus showed ~7 times more tracer binding than hNIS+ and WT ESCs (p<0.001; Figure ). To evaluate tracer retention, hNIS+ ESCs and hSSTr2+ ESCs were incubated for one hour with 99mTcO4- and 68Ga-DOTATATE, respectively, followed by re-incubation with cold medium for various periods of time. A rapid reduction in tracer retention was observed in hNIS+ ESCs with only ~15% of the tracer remaining intracellular after one hour. In contrast, stable 68Ga-DOTATATE retention was shown in hSSTr2+ ESCs (80.5±0.8% after one hour; Figure ). In general, the tracer retention in hSSTr2+ ESCs was significantly higher compared to the tracer retention in hNIS+ ESCs for all evaluated time points (p<0.0001).

Selective killing of hSSTr2-expressing embryonic stem cells by 177Lu-DOTATATE

To evaluate if 177Lu-DOTATATE specifically targets hSSTr2-expressing cells, both hNIS+ and hSSTr2+ ESCs were exposed to 4.8 MBq of the radiopharmaceutical. Afterwards, cell viability was assessed by in vitro BLI. Results were plotted as relative BLI signals, the photon flux of each condition at each time point divided by the photon flux before exposure (Figure ). Both hNIS+ and hSSTr2+ ESCs showed an increase in BLI signal over time when not treated with 177Lu-DOTATATE (hNIS+ day 2: 2.0±1.1 and day 6: 9.9±1.3; hSSTr2+ day 2: 1.2±0.1 and day 6: 8.3±0.5). hNIS+ ESCs exposed to 177Lu-DOTATATE showed a similar increase in BLI signal (day 2: 1.5±0.4 day 6: 8.6±1.0). In contrast, hSSTr2+ ESCs exposed to 177Lu-DOTATATE showed a significantly lower BLI signal than the untreated group at day 4 (0.3±0.2; p<0.0001) and day 6 (0.5±0.3; p<0.0001). No differences were observed between untreated and 177Lu-DOTATATE hNIS+ ESCs. Afterwards, these findings were confirmed through nuclear staining (Figure ). To validate the potential of 177Lu-DOTATATE to specifically kill hSSTr2+ ESCs in vivo, hSSTr2+ and hNIS+ teratomas were grown subcutaneously on the left and right flank of nude mice, respectively. At day 59, animals received a baseline small-animal PET scan with 68Ga-DOTATATE. Clear focal uptake of 68Ga-DOTATATE was observed on the left flank of the animals, where hSSTr2+ ESCs were injected, while no specific tracer uptake was present on the contralateral side (Figure ). At day 60 post cell-injection, animals received either 55.5 MBq 177Lu-DOTATATE (n=10) or saline (n=7), intraveneously. At day 87, another small-animal PET scan with 68Ga-DOTATATE was performed and total lesion uptake was plotted relative to the baseline total lesion uptake. In the animals receiving 177Lu-DOTATATE, a decreased total lesion uptake of 65±7% was observed in the hSSTr2+ teratomas compared to baseline. In contrast, hSSTr2+ teratomas exposed to saline had an increased total lesion uptake of 67±25% after 28 days (Figure ). Therefore, a significant reduction in relative total lesion uptake was observed in hSSTr2+ teratomas treated with 177Lu-DOTATATE (p<0.0001). To evaluate the effect of 177Lu-DOTATATE on hNIS+ teratomas, animals were scanned with 124I on day 59 (baseline) and at day 88 (n=4). At day 59, clear focal 124I uptake could be observed on the right flank of the mice, which was not present on the contralateral side (Figure ). After receiving either 177Lu-DOTATATE or saline at day 60, no significant differences in relative total 124I lesion uptake were demonstrated at day 88 between both groups (saline: 113±23%; 177Lu-DOTATATE: 100±18%; Figure ). Throughout this experiment, teratoma volumes were macroscopically monitored using a Caliper. Similar baseline teratoma volumes were shown at day 59 for both the saline (hSSTr2+: 87±18 mm3; hNIS+: 77±16 mm3) and the 177Lu-DOTATATE (hSSTr2+: 74±12 mm3; hNIS+: 80±16 mm3) exposed groups. Starting from day 73, a significant reduction in teratoma volume could be observed in 177Lu-DOTATATE-treated teratomas expressing hSSTr2 (36±13 mm3) compared to saline-injected hSSTr2+ teratomas (117±14 mm3; p<0.05) (Figure ). This reduced teratoma volume remained until the end of the experiment at day 88 (saline: 169±62 mm3; 177Lu-DOTATATE: 28±8 mm3; p<0.01). In contrast, no shrinkage of hNIS+ teratomas exposed to 177Lu-DOTATATE (day 88: 110±15 mm3) was observed compared to saline-injected ones (day 88: 100±39 mm3) (Figure ). In the same animals, teratoma kinetics were monitored via BLI (Figure ). As before, BLI signals were quantified using the relative changes to baseline. Six days after treatment, a lower relative BLI signal was shown in the hSSTr2+ teratomas receiving 177Lu-DOTATATE (70±13%) compared to the saline-treated group (240±109%; p<0.05). This difference remained consistent throughout the rest of the experiment but was only significantly different at day 80 (177Lu-DOTATATE treated group: 47±6%; saline-treated group: 190±59%; p<0.05) (Figure ). For the hNIS+ teratomas, no difference in relative BLI signal could be observed between animals receiving either 177Lu-DOTATATE (day 66: 186±26%; day 80: 171±76%) or saline (day 66: 288±189%; day 80: 202±109%) (Figure ). Histological examination of hSSTr2+ teratomas exposed to 177Lu-DOTATATE showed large vacuoles and deteriorated morphology, while saline-exposed hSSTr2+ teratomas remained intact and showed clear cellular structures of the three germ layers (data not shown).

Successful differentiation of pluripotent stem cells towards cardiomyocyte-like cells with maintained reporter gene expression

As undifferentiated PSCs are not therapeutically relevant, gene-edited cells were differentiated towards CMs following the Gibco PSC CM differentiation kit. After 8 days, spontaneous beating could be observed in both gene-edited and WT ESCs, with an average beating frequency of 61±26 bpm; 40±18 bpm and 55±34 bpm for hNIS+, hSSTr2+ and WT ESC-derived CMs, respectively (Figure ). After 15 days of differentiation, the pluripotency gene SOX2 was downregulated in both hNIS+ (ΔCt of 1.7±1.2 to -6.2±1.1) and hSSTr2+ (ΔCt of 2.4±3.4 to -2.2±3.0) ESCs, as well as WT ESCs (ΔCt of 3.3±2.1 to -4.1±2.9) (Figure ). Differentiation towards CMs was demonstrated by the upregulation of early (TBX5) and late (cardiac myosin heavy chain (cMHC)) genetic markers of cardiomyogenesis. The TBX5 transcript was upregulated after 15 days of cardiac differentiation in hNIS+ ESCs (ΔCt of -8.3±2.2 to 2.5±0.5), hSSTR2+ ESCs (ΔCt of -8.1±3.0 to 2.8±0.4) and WT ESCs (ΔCt of -7.9±2.2 to -0.5±3.3). This same upregulation was observed for cMHC after differentiation (hNIS+ ΔCt of -5.3±2.8 to 6.9±0.1; hSSTR2+ ΔCt of -4.9±3.1 to 8.1±1.5; WT ΔCt of -4.8±2.7 to 3.4±5.6) (Figure ). These findings were confirmed at the protein level by immunofluorescence since all cell types tested positive for αSMA and CX-43 at day 15 of CM differentiation (Figure ). After differentiation, cells were re-tested for functionality of the reporter genes. Both hSSTr2+ and hNIS+ ESC-derived CMs had significantly higher BLI signals after incubation with D-luciferin, in contrast to WT ESC-derived CMs (Figure ; p<0.01). After incubation with 99mTcO4-, both undifferentiated hNIS+ ESCs (48.2±1.6%) and hNIS+ ESC-derived CMs (28.0±8.7%) showed a tracer uptake that was significantly higher than WT ESCs (0.9±0.3%; p<0.001). Moreover, a significantly lower tracer uptake was present in the differentiated hNIS+ CMs compared to the undifferentiated hNIS+ ESCs (p<0.001) (Figure ). hSSTr2+ ESC-derived CMs, incubated with 68Ga-DOTATATE, showed a tracer uptake of 2.4±0.4%, while undifferentiated hSSTr2+ ESCs had an uptake of 3.2±0.4%. Only low tracer uptake was shown in WT ESCs (0.5±0.1%) (Figure ). Thus, a significantly higher tracer uptake was observed both in hSSTr2+ ESCs and hSSTr2+ ESC-derived CMs compared to WT ESCs (p<0.001), while no significant difference could be observed between the differentiated or undifferentiated state of hSSTr2+ cells (p>0.05).

Intra-myocardial injection of hSSTr2+ embryonic stem cell-derived cardiomyocytes in an immune-deficient myocardial infarction mouse model

A MI was induced in Rag/γ2-/- mice by permanent ligation of the LAD (n=4). Afterwards, one million hSSTr2+ ESC-derived CMs were injected at three sites of the MI border region. As a control, the same set-up was used but animals received sham injections (n=4). At day 10 post cell-injection, animals received an intravenous injection with 68Ga-DOTATATE. In cell-injected animals, a clear tracer uptake in the heart region could be observed, while this was absent in the sham-injected animals (Figure ). Significantly higher mean SUVs were observed in the heart region of cell-injected (0.20±0.06) animals compared to sham-injected animals (0.04±0.01; p<0.01) (Figure ). Clear BLI signals could be retrieved from the heart at day 3 post cell-injection (6.6±1.2x105 p/s), while no BLI signals were observed in the sham-injected animals (1.2±0.3x104 p/s) (Figure ). hSSTr2+ CMs showed an initial increase in BLI signal the first 10 days after injection (2.1±1.0x106 p/s). Afterwards, a limited reduction in cell survival was observed. However, BLI signals at the end of the experiment had similar values as three days post-injection (d3: 6.6±1.2x105 p/s; d28: 6.9±2.1x105 p/s) (Figure ). Upon sacrifice, an ex vivo BLI scan showed clear engraftment of the cells in the heart and absence of BLI signal from the lungs (Figure ). MRI and calculation of the LVEF were performed to determine if the hSSTr2+ ESC-derived CMs had a therapeutic effect. Before permanent ligation of the LAD, a baseline MRI scan showed a clear muscularized left ventricular wall (Figure ). Furthermore, both the cell- and sham-injected groups had similar LVEF before the procedure (cell: 73.9±2.3%; sham: 71.4±2.8%) (Figure ). After the induction of a MI, loss of CMs was seen together with an akinetic region of the heart (indicated by yellow arrow) (Figure ). This resulted in significantly reduced LVEF in both groups that continued to worsen over time (Figure ). Between the sham- and cell-injected groups, no difference was found in LVEF at week 1 (cell 53.3±10.4%; sham 55.7±13.7%), week 2 (cell 46.3±16.7%; sham 49.3±10.4%) and week 4 (cell 42.1±13.8%; sham 50.0±11.3%). On the four-chamber view, an indication of ventricular wall thickening was shown after one week in the cell-injected animals (indicated by green arrow). However, this did not persist over time (Figure ).

Discussion

The present work focuses on providing a safety-switch for PSC-derived cell therapy by using the hSSTr2 both as an imaging and suicide reporter gene. Here, we demonstrated that hSSTr2 allows long-term visualization of stem cell distribution and can detect potential uncontrolled cell proliferation. Furthermore, it allows intervention with a specific therapeutic radiopharmacon and therefore addresses an additional safety aspect towards translating PSC-derived therapies to the clinic. Previously, incorporation of imaging reporter genes has mainly been performed by the use of retro- or lentiviral vectors that have the tendency to integrate in sites of active gene transcription. Therefore, there is a higher chance of insertional mutagenesis 22, 23. Moreover, during differentiation or cell expansion, random reporter gene incorporation can result in genetic silencing 24. Furthermore, heterogeneity is induced in the cell population as the reporter gene construct is integrated at different sites and each cell will carry different copy numbers of the reporter gene construct. The development of site-specific gene-editing by ZFNs avoids these disadvantages as a single copy of the reporter gene construct is integrated in a specific target site of the DNA, in our case the safe harbor locus AAVS1 13, 14. Our data is in accordance with literature since the integration in the AAVS1 locus did not impair pluripotency nor the differentiation capacity of the ESCs and allowed stable transgene expression over time both in pluripotent and differentiated cell state 13, 14, 19, 25. Only in the 99mTcO4- uptake experiment, a reduction in tracer uptake was observed in hNIS+ CMs. This can be caused by the use of a different medium to dissolve the tracer or, more likely, by a decrease in the sodium gradient that drives hNIS-mediated 99mTcO4- uptake in spontaneous contracting CMs. This last postulation is supported by the fact that there was no reduction of the in vitro BLI signal after differentiation, while Fluc and hNIS are linked to each other by a peptide 2A sequence. Furthermore, in a previous article by our group we demonstrated that tracer uptake was maintained after differentiation of hNIS+ ESCs towards hepatocytes 19. At present, stem cell therapy is struggling in the clinic to reach the beneficial effects observed in pre-clinical research. One of the issues is the inability to monitor stem cell fate in a clinical setting, as tissue biopsies are limited. Therefore, molecular and cellular imaging can provide an essential tool to visualize the bio-distribution and viability of the cells noninvasively over time 9, 26. To allow clinical translation, we have used two human radionuclide reporter genes, hNIS and hSSTr2, which avoid immunogenicity and allow cell tracking with clinical radionuclide imaging devices. In this study, we confirmed that PET allows long-term PSC tracking after site-specific gene-editing 19. hNIS is a relatively well-established radionuclide reporter gene that has been shown to track cells both in rodents 20, 27 and in larger animals 15, 17. The feasibility to use hNIS for monitoring murine teratoma formation, after stable murine ESC transfection, has also been demonstrated by Lehner et al. 28. In contrast, hSSTr2 has not been frequently used for cell tracking. The use of imaging reporter genes allowed us to visualize the neoplastic teratoma growth, noninvasively. As a limitation, the increase in total lesion uptake of 68Ga-DOTATATE and 124I- in both hSSTr2+ and hNIS+ teratomas respectively, was limited. Therefore, it might be advisable to combine the imaging methods with analysis of serum biomarkers indicative for teratoma formation as determined by Riegler et al. 29. However, it should be noted that these biomarkers are a consequence of PSC differentiation and do not detect PSCs, the neoplastic part of the teratoma. This was highlighted further by the fact that they were unable to detect one out of the eight teratomas. Furthermore, they are highly dependent on the differentiated progeny and a broad multicenter study should be performed to test the consistency of these biomarkers in teratomas derived from different cell origins. Within our study, these biomarkers could not be tested as insufficient blood could be retrieved from the mice. Although PSCs have an enormous potential for the regenerative medicine field, the risk of neoplastic lesion formation still exists because of remaining PSCs in the cell mixture after differentiation or the potential transdifferentiation towards their PSC state. Therefore, we assessed hSSTr2 not only as an imaging reporter gene but also as a suicide gene. SSTr2 is overexpressed on NETs, and peptide receptor radionuclide therapy with 177Lu-DOTATATE has demonstrated to have a significantly higher response rate than high-dose octreotide. Furthermore, the recently published phase III NETTER-1 trial showed that patients with a SSTr2+ midgut NET had an increased progression-free survival after 177Lu-DOTATATE treatment 18. In this study, we confirmed specific cell killing of hSSTr2+ cells after 177Lu-DOTATATE exposure. After in vitro exposure of hSSTr2+ cells to 177Lu-DOTATATE, a significant decrease in cell survival was seen both by BLI and Hoechst staining. However, different kinetics could be observed between these two methods. This suggests that different cell plating densities at the start of the experiment cause a difference in cell survival kinetics. In addition, we are the first to demonstrate that in vivo 177Lu-DOTATATE exposure was associated with decreased total 68Ga-DOTATATE uptake in hSSTr2+ teratomas and a reduction in teratoma size compared to saline-treated hSSTr2+ teratomas. As a confirmation of the cytotoxic effect of 177Lu-DOTATATE on hSSTR2+ and not hNIS+ ESCs, in vivo BLI was performed in addition to PET imaging. Indeed, the BLI signal decreased in hSSTR2+ teratomas after 177Lu-DOTATATE exposure, which was not the case for the hNIS+ cells. It can be noted that different baseline BLI signals were present before therapy in hSSTr2+ and hNIS+ teratomas, which can be explained by the fact that different cell lines generate different teratoma morphologies 19. In addition, hSSTr2-expressing teratomas might have a decreased proliferation rate as it is known that receptor activation inhibits cell growth 30, 31. However, when we look to hSSTr2+ or hNIS+ teratomas separately, comparable BLI signals could be observed the day before administration of 177Lu-DOTATATE or saline, allowing us to make the assessment on the effect of 177Lu-DOTATATE on teratoma growth. Moreover, our imaging-based approach gives the possibility to monitor each individual teratoma longitudinally. Therefore, our results were expressed as relative lesion uptake or relative BLI signal to account for the unavoidable differences in baseline teratoma size. Despite 177Lu-DOTATATE treatment, still a small teratoma lesion could be retrieved upon sacrifice of the animals. Therefore, it might be advisable to perform repeated rounds of 177Lu-DOTATATE administration, as it has been shown to enhance therapeutic outcome and is standardly performed in a clinical setting 18, 32. In the literature, the most widely used combined imaging and suicide gene is the herpes simplex virus type 1 thymidine kinase (HSV-tk) reporter gene. PSC overexpressing HSV-tk have been generated and noninvasively monitored by PET 33. In addition, several groups showed that selective killing of HSV-tk-overexpressing ESCs was feasible after continuous exposure to ganciclovir (GCV). Unfortunately, they did not combine this with noninvasive cell monitoring 33-36. In the majority of the studies, no complete removal of the teratomas could be obtained, as was the case for our 177Lu-DOTATATE-based approach. In contrast, the suicide gene HSV-tk has already been successful in different clinical trials as a safety-switch upon development of graft-versus-host disease (GVHD) 37-41. Administration of GCV resulted in complete removal of the infused genetically engineered lymphocytes and the associated GVHD 37-41. This discrepancy in complete graft removal can be explained by the fact that teratomas consist of a mixture of differentiated and undifferentiated cells. Since terminally differentiated cells do not divide anymore, they become resistant to GCV treatment 41, 42. Similarly, these non-dividing cells might be more resistant to radiotherapy, but after repeated cycles of 177Lu-DOTATATE exposure the cumulative dose might be high enough to induce cell death in terminally differentiated cells. The major advantage of the GCV-HSV-tk system is the absence of any adverse events, even after continuous exposure, since the viral thymidine kinase (TK) has a 1000-fold higher efficiency in converting GCV towards its cytotoxic metabolite than mammalian mitochondrial TK 38-41, 43. This is not feasible with radionuclide therapy since the radionuclide as such is the cytotoxic part and not a metabolite of the administered substrate. Furthermore, SSTr2 is endogenously expressed in certain tissues, leading to specific accumulation of 177Lu-DOTATATE in these organs. The phase III NETTER-1 trial demonstrated mainly limited grade 1 or 2 adverse events (abdominal pain, fatigue, thrombocytopenia, etc.). Only in 1%, 2%, and 9% of patients receiving 177Lu-DOTATATE, were grade 3 or 4 neutropenia, thrombocytopenia or lymphopenia observed, respectively 18. Despite the fact that the safety profile of the GCV-HSV-tk system is superior compared to our proposed 177Lu-DOTATATE-hSSTr2 system, we do believe that our approach holds merit as it has been demonstrated that specific immunization towards the viral HSV-tk can occur 37, 39, while our system is of human origin. Furthermore, it does not prohibit the use of antiviral treatment 44. Lastly, as HSV-TK is a cytoplasmic protein, an additional surface marker needs to be incorporated into the reporter gene construct to allow selection of the transduced cells 37, 39-41. In contrast, our hSSTr2 is a membrane receptor that can immediately be used to isolate the hSSTr2+ cell population. hNIS was not used as suicide gene since no stable radionuclide incorporation could be achieved due to the lack of iodide organification, thus resulting in substantial tracer elution from the cells. Therefore, we believe that hSSTr2 is a better alternative as it allows long-term radiopharmaceutical retention. However, some groups have demonstrated the feasibility of using 131I or 188Rh for killing hNIS-overexpressing cells 45-49. While they also observed a similar efflux of the radiopharmacon both in vitro and in vivo, an in vivo retention time of less than one day was apparently long enough to exert the toxic effects if repeated administration was performed 46-48. As undifferentiated PSCs are not therapeutically relevant, we have differentiated them towards CMs. As previously described, this resulted in spontaneously contracting CMs expressing CX-43 50. Upon transplantation in a MI mouse model, long-term cell survival could be achieved. Like previously demonstrated by Laflamme et al., proliferation of the transplanted CMs occurred the first days post-injection, indicated by an increase in BLI signal from day 3 to day 10 51. In contrast to the study by Laflamme et al., this increased proliferation did not persist until week 4 and after 10 days a reduction in BLI signal was shown, indicating that not all cells had a permanent and successful engraftment. This in vivo cell behavior might be explained by the fact that we injected the cells in matrigel, full of growth factors, which might boost cell proliferation in the initial days. The reduction afterwards might be mediated by the growing infarct area over time induced by the permanent ligation of the LAD. At the end of the experiment (day 28), similar BLI signals were demonstrated compared to day 3 post-injection, indicating a high engraftment rate and long-term survival of these hSSTr2+ ESC-derived CMs. Despite long-term cell survival, no therapeutic effect was seen. The absence of a therapeutic effect might be explained by the high heart rate of rodents compared to the human heart and our human ESC-derived CMs. Other groups already showed that arrhythmias by human PSC-derived CMs only appeared in larger animal models with MI and were not detected in rodents with MI 2-4. Unfortunately, we were only able to visualize cell survival and not electrical coupling of our injected CMs. This would provide us with information on the functionality of the cells in vivo. Another reason to evaluate PSC-derived therapy in larger animals is the ability to do echo-guided injections, thereby allowing controlled cell injections in the close proximity of the infarct. With our radionuclide imaging reporter genes, we would then still be able to track the cells via PET. To achieve therapeutic efficacy, a milder MI model, namely ischemia/reperfusion, might be more beneficial as a chronic ligation is potentially too severe to repair with cell therapy. By the use of an ischemia/reperfusion model in rats, successful PSC-derived CM therapy has been achieved by Laflamme et al 1.

Conclusion

In this study, we have generated isogenic ESCs via ZFN-based gene-editing, expressing human radionuclide imaging reporter genes that have the potential for regulatory approval and can be used for cell monitoring in various cell therapy applications via clinical radionuclide imaging devices. As PSC-derived cell therapy does not yield 100% purity, the risk for neoplastic teratoma formation is still present. We are the first to demonstrate that hSSTr2-based radionuclide therapy can be used as a safety-switch in case of unwanted teratoma development. The safe reporter gene incorporation and double role of hSSTr2 as a radionuclide imaging and suicide gene further increases the potential of stem cell reporter gene-based imaging to become clinically applied. Supplementary figures. Click here for additional data file.
Table 1

Primers for qPCR

PrimerPrimer Sequence
Pluripotency markers (human)
OCT4ForwardCGAGCAATTTGCCAAGCTCCTGAA
ReverseGCCGCAGCTTACACATGTTCTTGA
SOX2ForwardTGGCGAACCATCTCTGTGGT
ReverseCCAACGGTGTCAACCTGCAT
NANOGForwardGATTTGTGGGCCTGAAGAAA
ReverseAAGTGGGTTGTTTGCCTTTG
C-MYCForwardTCCTCGGATTCTCTGCTCTCCT
ReverseAGAAGGTGATCCAGACTCTGACCT
Cardiac markers (human)
TBX5ForwardCTGTGGCTAAAATTCCACGAAGT
ReverseGTGATCGTCGGCAGGTACAAT
cMHCForwardGCCCTTTGACATTCGCACTG
ReverseCGGGACAAAATCTTGGCTTTGA
Housekeeping genes (human)
RPL13aForwardCCTGGAGGAGAAGAGGAAAGAGA
ReverseTTGAGGACCTCTGTGTATTTGTCAA
TMEM85ForwardCGCTTCAAGTGGGCCATTG
ReverseACTGGGTAGAGCGAGTCTCC
GUSBForwardGTCTGCGGCATTTTGTCGG
ReverseCACACGATGGCATAGGAATGG
  51 in total

1.  Radiolabeling strategies for radionuclide imaging of stem cells.

Authors:  Esther Wolfs; Catherine M Verfaillie; Koen Van Laere; Christophe M Deroose
Journal:  Stem Cell Rev Rep       Date:  2015-04       Impact factor: 5.739

2.  Human embryonic stem cell-derived cardiac progenitors for severe heart failure treatment: first clinical case report.

Authors:  Philippe Menasché; Valérie Vanneaux; Albert Hagège; Alain Bel; Bernard Cholley; Isabelle Cacciapuoti; Alexandre Parouchev; Nadine Benhamouda; Gérard Tachdjian; Lucie Tosca; Jean-Hugues Trouvin; Jean-Roch Fabreguettes; Valérie Bellamy; Romain Guillemain; Caroline Suberbielle Boissel; Eric Tartour; Michel Desnos; Jérôme Larghero
Journal:  Eur Heart J       Date:  2015-05-19       Impact factor: 29.983

3.  Molecular Imaging of Human Embryonic Stem Cells Stably Expressing Human PET Reporter Genes After Zinc Finger Nuclease-Mediated Genome Editing.

Authors:  Esther Wolfs; Bryan Holvoet; Laura Ordovas; Natacha Breuls; Nicky Helsen; Matthias Schönberger; Susanna Raitano; Tom Struys; Bert Vanbilloen; Cindy Casteels; Maurilio Sampaolesi; Koen Van Laere; Ivo Lambrichts; Catherine M Verfaillie; Christophe M Deroose
Journal:  J Nucl Med       Date:  2017-06-08       Impact factor: 10.057

4.  Administration of herpes simplex-thymidine kinase-expressing donor T cells with a T-cell-depleted allogeneic marrow graft.

Authors:  P Tiberghien; C Ferrand; B Lioure; N Milpied; R Angonin; E Deconinck; J M Certoux; E Robinet; P Saas; B Petracca; C Juttner; C W Reynolds; D L Longo; P Hervé; J Y Cahn
Journal:  Blood       Date:  2001-01-01       Impact factor: 22.113

5.  Antitumor effects of HSV-TK-engineered donor lymphocytes after allogeneic stem-cell transplantation.

Authors:  Fabio Ciceri; Chiara Bonini; Sarah Marktel; Elisabetta Zappone; Paolo Servida; Massimo Bernardi; Alessandra Pescarollo; Attilio Bondanza; Jacopo Peccatori; Silvano Rossini; Zulma Magnani; Monica Salomoni; Claudia Benati; Maurilio Ponzoni; Luciano Callegaro; Paolo Corradini; Marco Bregni; Catia Traversari; Claudio Bordignon
Journal:  Blood       Date:  2007-02-27       Impact factor: 22.113

Review 6.  Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human pluripotent stem cells.

Authors:  Joseph Collin; Majlinda Lako
Journal:  Stem Cells       Date:  2011-07       Impact factor: 6.277

7.  Use of rhenium-188 for in vivo imaging and treatment of human cervical cancer cells transfected with lentivirus expressing sodium iodide symporter.

Authors:  Min Zhang; Shuo Shi; Rui Guo; Yin Miao; Biao Li
Journal:  Oncol Rep       Date:  2016-08-24       Impact factor: 3.906

8.  Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts.

Authors:  Michael A Laflamme; Kent Y Chen; Anna V Naumova; Veronica Muskheli; James A Fugate; Sarah K Dupras; Hans Reinecke; Chunhui Xu; Mohammad Hassanipour; Shailaja Police; Chris O'Sullivan; Lila Collins; Yinhong Chen; Elina Minami; Edward A Gill; Shuichi Ueno; Chun Yuan; Joseph Gold; Charles E Murry
Journal:  Nat Biotechnol       Date:  2007-08-26       Impact factor: 54.908

9.  HSV-TK gene transfer into donor lymphocytes for control of allogeneic graft-versus-leukemia.

Authors:  C Bonini; G Ferrari; S Verzeletti; P Servida; E Zappone; L Ruggieri; M Ponzoni; S Rossini; F Mavilio; C Traversari; C Bordignon
Journal:  Science       Date:  1997-06-13       Impact factor: 47.728

10.  Tracking of dendritic cell migration into lymph nodes using molecular imaging with sodium iodide symporter and enhanced firefly luciferase genes.

Authors:  Ho Won Lee; Seung Yun Yoon; Thoudam Debraj Singh; Yoon Ju Choi; Hong Je Lee; Ji Young Park; Shin Young Jeong; Sang-Woo Lee; Jeoung-Hee Ha; Byeong-Cheol Ahn; Yong Hyun Jeon; Jaetae Lee
Journal:  Sci Rep       Date:  2015-05-14       Impact factor: 4.379

View more
  7 in total

1.  A Theranostic Cellulose Nanocrystal-Based Drug Delivery System with Enhanced Retention in Pulmonary Metastasis of Melanoma.

Authors:  Surachet Imlimthan; You Cheng Khng; Outi Keinänen; Wenzhong Zhang; Anu J Airaksinen; Mauri A Kostiainen; Brian M Zeglis; Hélder A Santos; Mirkka Sarparanta
Journal:  Small       Date:  2021-03-18       Impact factor: 13.281

2.  Simultaneous in vivo PET/MRI using fluorine-18 labeled Fe3O4@Al(OH)3 nanoparticles: comparison of nanoparticle and nanoparticle-labeled stem cell distribution.

Authors:  Sarah Belderbos; Manuel Antonio González-Gómez; Frederik Cleeren; Jens Wouters; Yolanda Piñeiro; Christophe M Deroose; An Coosemans; Willy Gsell; Guy Bormans; Jose Rivas; Uwe Himmelreich
Journal:  EJNMMI Res       Date:  2020-06-30       Impact factor: 3.138

3.  In Vivo Myoblasts Tracking Using the Sodium Iodide Symporter Gene Expression in Dogs.

Authors:  Isabel Punzón; David Mauduit; Bryan Holvoet; Jean-Laurent Thibaud; Pauline de Fornel; Christophe M Deroose; Nicolas Blanchard-Gutton; Jean-Thomas Vilquin; Maurilio Sampaolesi; Inès Barthélémy; Stéphane Blot
Journal:  Mol Ther Methods Clin Dev       Date:  2020-01-09       Impact factor: 6.698

4.  Enhanced noninvasive imaging of oncology models using the NIS reporter gene and bioluminescence imaging.

Authors:  Rianna Vandergaast; Sarawut Khongwichit; Huailei Jiang; Timothy R DeGrado; Kah-Whye Peng; Duncan R Smith; Stephen J Russell; Lukkana Suksanpaisan
Journal:  Cancer Gene Ther       Date:  2019-01-24       Impact factor: 5.987

Review 5.  (Epi)genetic Modifications in Myogenic Stem Cells: From Novel Insights to Therapeutic Perspectives.

Authors:  Natacha Breuls; Giorgia Giacomazzi; Maurilio Sampaolesi
Journal:  Cells       Date:  2019-05-09       Impact factor: 6.600

6.  PINCH1 knockout aggravates myocardial infarction in mice via mediating the NF-κB signaling pathway.

Authors:  Xuejun Wang; Jinwen Su; Zhikang Lin; Kangyong Liu; Yu Zhuang
Journal:  Exp Ther Med       Date:  2021-11-22       Impact factor: 2.447

7.  Genome-wide interaction target profiling reveals a novel Peblr20-eRNA activation pathway to control stem cell pluripotency.

Authors:  Cong Wang; Lin Jia; Yichen Wang; Zhonghua Du; Lei Zhou; Xue Wen; Hui Li; Shilin Zhang; Huiling Chen; Naifei Chen; Jingcheng Chen; Yanbo Zhu; Yuanyuan Nie; Ilkay Celic; Sujun Gao; Songling Zhang; Andrew R Hoffman; Wei Li; Ji-Fan Hu; Jiuwei Cui
Journal:  Theranostics       Date:  2020-01-01       Impact factor: 11.556

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.