Bin Chen1, Akao Zhu1, Lei Tian2, Ying Xin3, Xinchun Liu2, Yunpeng Peng2, Jingjing Zhang2, Yi Miao2, Jishu Wei2. 1. Hepatopancreatobiliary Surgery Department, The Affiliated Hangzhou Hospital of Nanjing Medical University, Hangzhou, Zhejiang 310006, P.R. China. 2. The Pancreas Center, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, P.R. China. 3. Thyroid Breast Surgery Department, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, Hangzhou, Zhejiang 310014, P.R. China.
Abstract
The present study aimed to explore the effects and underlying mechanisms of microRNA (miR)‑23a on pancreatic cancer (PC) cells progression. Reverse transcription‑quantitative polymerase chain reaction and western blot analysis were used to detect the mRNA and protein miR‑23a and PLK‑1 level. Cell viability, cell cycle, migration and invasion assasy, and in vivo tumorigenicity assay were used to investigate the effects of miR‑204. Further luciferase reporter assay was used to explore the mechanisms contributing to miR‑204 effects. It was observed that miR‑23a expression was upregulated and negatively associated with polo‑like kinase‑1 (PLK‑1) expression in human PC tissues. PLK‑1 was a direct target of miR‑23a in PC cells. Functional analysis demonstrated that miR‑23a overexpression suppressed cell proliferation, inhibited cell migration and invasion and promoted cell apoptosis in vitro. When PC cells were transfected with has‑miR‑23a PLK‑1 was downregulated and its downstream molecules were deregulated, including decreased expression of B‑cell lymphoma‑2, cyclin B1 and vimentin, and increased expression of Bax and E‑cadherin. The inhibitory effect of miR‑23a on PC cell progression was observed in vivo tumor xenografts. The results of the study suggest that miR‑23a inhibits PC cell progression by directly targeting PLK‑1‑associated signaling and promoting miR‑23a expression may be a potential method for treating patients with PC.
The present study aimed to explore the effects and underlying mechanisms of microRNA (miR)‑23a on pancreatic cancer (PC) cells progression. Reverse transcription‑quantitative polymerase chain reaction and western blot analysis were used to detect the mRNA and protein miR‑23a and PLK‑1 level. Cell viability, cell cycle, migration and invasion assasy, and in vivo tumorigenicity assay were used to investigate the effects of miR‑204. Further luciferase reporter assay was used to explore the mechanisms contributing to miR‑204 effects. It was observed that miR‑23a expression was upregulated and negatively associated with polo‑like kinase‑1 (PLK‑1) expression in human PC tissues. PLK‑1 was a direct target of miR‑23a in PC cells. Functional analysis demonstrated that miR‑23a overexpression suppressed cell proliferation, inhibited cell migration and invasion and promoted cell apoptosis in vitro. When PC cells were transfected with has‑miR‑23a PLK‑1 was downregulated and its downstream molecules were deregulated, including decreased expression of B‑cell lymphoma‑2, cyclin B1 and vimentin, and increased expression of Bax and E‑cadherin. The inhibitory effect of miR‑23a on PC cell progression was observed in vivo tumor xenografts. The results of the study suggest that miR‑23a inhibits PC cell progression by directly targeting PLK‑1‑associated signaling and promoting miR‑23a expression may be a potential method for treating patients with PC.
Although tremendous efforts have been obtained to heighten early diagnosis and clinical outcomes of patients with pancreatic cancer (PC), the overall prognosis and survival rate is still very poor (1). Therefore, it is urgent to reveal novel biomarkers for PC early diagnosis and therapy.MicroRNAs (miRNAs), are short (17–25 nucleotides) non-coding RNAs that regulate gene expression by binding to 3′-untranslated regions (3′-UTR) sequence of target mRNAs (2). MiRNA-23a is a critical regulator in carcinogenesis and aberrant miR-23a expression has been detected in many cancers (3,4). Bioinformatic analysis of breast cancer tissue-based miRNA panel shows that miR-23a possibly functions as an oncogenic governor and promotes breast cancer progression by directly activating transcription of Forkhead box protein M1 (FOXM1) and Histidine-rich glycoprotein (HRG) (5). However, miR-23a also acts as a negative regulator of oncogene in several kinds of cancer. It has been reported that miR-23a is down-regulated in nephroblastomas (6). In PC, miR-23a is overexpressed using miRNA microarray-based analysis (7), suggesting that it can be used to as a potential biomarker for diagnosis and treatment in PC. Although some studies suggest that miR-23a functions as an oncogenic regulator in PC (8), the detailed roles and other molecular mechanisms remain to be revealed.Polo-like kinase-1 (PLK-1) is a crucial mitotic protein kinase that regulates multiple intracellular mitotic processes including DNA replication, G2/M transition and cytokinesis (9). PLK-1 is overexpressed in various tumors and negatively correlated with a wide spectrum of human cancers (10). Numerous studies reveal that there are a great number of miRNAs which inhibit PLK-1 expression and further repress oncogenesis, including non-small cell lung cancer (11,12). Considering the important roles of miRNAs and PLK-1, it is necessary to screen novel miRNAs targeting PLK-1for PC diagnosis and treatment.Herein, we found that PLK-1 was a potential target of miR-23a in PC cells. Further research showed that miR-23a restrained cell proliferation, invasion and migration in PC cell lines, while promoted cell apoptosis possibly through inhibiting PLK1 expression and its related signaling in vitro and in vivo. Taken together, these findings might provide new sight for early diagnosis and developing new therapeutic approaches for PC.
Materials and methods
Clinical samples, cell lines and cell transfection
A total of 20 cases of primary PC patients and their paired adjacent non-tumor tissues were obtained from the Affiliated Hangzhou Hospital of Nanjing Medical University. All procedures performed in studies involving human participants were in accordance with ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent for publication was obtained from all individual participants included in the present study. Human PC cell lines hTERT-HPNE, MIA-PaCa-2, PANC-1, and Aspc-1were purchased from the Cell Biology Institute of Shanghai (Shanghai, China). All cell lines were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and maintained at 37°C in a 5% CO2 atmosphere. To construct overexpression plasmid, we synthesized sequences of human pre-miR-23a (miR23a-P1 (HpaI): TATCACATTGCCAGGGATTTCCTTCAGAGAGGAAATCCCTGGCAATGTGATTTTTTTC, miR23a-P2 (XhoI): TCGAGAAAAAAATCACATTGCCAGGGATTTCCTCTCTTGAAGGAAATCCCTGGCAATGTGATA), then inserted it into the linear plasmid PLL3.7. miR-23a inhibitors and inhibitor NC were purchased from Guangzhou RiboBio Co., Ltd., (Guangzhou, China). Before transfection, cells were seeded at 24-well plates and transfected with blank, PLL-3-blank, PLL-3-miR-23a, miR-23a-inhibitor, inhibitor NC using Lipofectamine™ 2000 Transfection Reagent (cat. no. 11668-500; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) applying with 100 pmol oligonucleotides in each well according to the manufacturer's instructions.
Quantitative RT-PCR (qPCR)
Total RNA was isolated from the tissues and cells utilizing TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The primers for qRT-PCR were indicated in Table I. GAPDH or U6 snRNA served as an internal control for mRNA and miRNA expression, respectively, and quantified relative to control using the delta-delta CT method.
Table I.
Quantitative polymerase chain reaction primer sequences.
Gene
Sequences (5′-3′)
miR-23a forward
ATTGTATGTGGTCTCCGCTGTTTG
miR-23a reverse
TTTCTTTTGGGTTGAGCCTTTTTT
U6 snRNA forward
CAGCACATATACTAAAATTGGAACG
U6 snRNA reverse
ACGAATTTGCGTGTCATCC
PLK-1 forward
CCCACTGCCCGCCCAACCATTAAC
PLK-1 reverse
CTCCTCTTGCCTGACCAGCCCACG
GAPDH forward
CGGAGTCAACGGATTTGGTCGTAT
GAPDH reverse
AGCCTTCTCCATGGTGGTGAAGAC
miR, microRNA; sn, small nuclear; PLK-1, polo-like kinase-1.
Western blot analysis
Protein extraction from tissues and cells were performed according to the manufacturer's instructions. Immunoblotting was conducted using the following primary antibodies: anti-PLK-1, Bax, Bcl2, cyclinB1, E-cadherin, Vimentin (Abcam, Cambridge, USA), anti-GAPDH (Abcam), and the second antibody horseradish peroxidase conjugated against mouse or rabbit IgG (1:2,000 dilution; ZhongShan, Guangdong, China). Signals were exposed to a film (FujiFilm, Tokyo, Japan) with ECL Plus (Beyotime Institute of Biotechnology, Haimen, China) according to the manufacturer's instructions.
Cell proliferation analysis
CCK8 Kit (YEASEN, Shanghai, China) was used to analyze cell proliferation rate of cells with different treatments. In brief, cells were suspended and seeded into 96-well plates, after culturing for 24, 48 and 72 h. CCK8 was added into the medium following the manufacturer's instruction. The absorbance was detected at 450 nm. Cell proliferation rate was presented with the value relative to control group.
Migration and matrigel invasion assays
We added suspended and stained (Cell-Tracker-Red; Invitrogen; Thermo Fisher Scientific, Inc.) MIA-PaCa-2 cells on a confluent HMC monolayer, which was stained with the fluorescence dye Cell-Tracker-Green (Invitrogen; Thermo Fisher Scientific, Inc.). 24 h for migration analysis, and 48 h for invasion analysis.
Cell apoptosis assay
Cells were grown in 6-well plates to about 50–60% confluence and transiently transfected with blank, PLL3-blank, PLL-3-miR-23a, miR-23a-inhibitor and inhibitor NC respectively. Cells were trypsinized and collected at 48 h post-transfection before washing with PBS twice, treated by Annexin V-EGFP Apoptosis Detection kit according to the manufacturer's instructions (Nanjing KeyGen Biotech., Co., Ltd., Jiangsu, China), and analyzed with a flow cytometer (FACS calibur; BD Biosciences, Franklin Lakes, NJ, USA).
Luciferase reporter assay
PLK1-3′UTR-WT and PLK1-3′UTR-mut plasmids were obtained from GeneChem, Inc., (Daejeon, Korea). Cells were cotransfected with non-relative control RNA duplex and PLK1-3′UTR-WT, or cotransfected with non-relative control RNA duplex and PLK1-3′UTR-mut plasmids were served as control groups. Cells cotransfected with PLL3-miR23a and PLK1-3′UTR-WT or PLK1-3′UTR-mut were defined as case groups. The pRL-TK (Promega Corporation, Madison, WI, USA) was used as a normalization control. Cells were collected at 24 h after transfection, and luciferase activity was measured using a dual-luciferase reporter assay kit (Promega Corporation) and recorded by chemiluminescence meter (Promega Corporation).
In vivo tumorigenicity assay
All experiments were carried out under the ethical approval of Ethics Committee for Animal Experimentation of The Affiliated Hangzhou Hospital of Nanjing Medical University. Four-week-old female BALB/c nude mice were purchased from ShangHai and maintained in specific pathogen-free conditions. To build the subcutaneous human MIA-PaCa-2 tumor xenograft model, MIAPaca-2 cells were subcutaneously inoculated (5×106 cells suspended in a 1:1 mixture of serum free-Dulbecco's modified Eagle's medium/Matrigel (BD Biosciences per site); total volume 0.1 ml) bilaterally into the flanks of athymic mice. When tumors were grown at approximately 100 mm3, mice were injected with miR-23a agomir or agomir NC (Guangzhou RiboBio Co., Ltd.) following the manufacturer's recommendation. The animals were monitored for activity, physical condition, determination of body weight, and measurement of tumor volume (1/2 × length × width2) were made twice a week. After 4 weeks of treatment, tumors were harvested and weighed. To measure the tumors accurately, mice were rendered unconscious with and digital calipers were used to measure the tumor size over time.
Statistical analysis
All data were obtained from at least three independent experiments, and presented as the mean ± standard deviation. Datasets with only two groups were analyzed using a Student's t-test. Differences between multiple groups were analyzed using one-way analysis of variance with the Tukey-Kramer post-hoc test. P<0.05 was considered to indicate a statistically significant difference. All of the statistical calculations were performed using the SPSS software v15.0 (SPSS, Inc., Chicago, IL, USA).
Results
PLK-1 acts as a potential target of miR-23a in human PC cells
Sequence analyses of the mature sequence of miR-23a showed that miR-23a could be the potential functional regulator of 3′UTR of PLK mRNA. To assess whether PLK1 was a potential target of miR-23a, we performed qPCR to detect expression levels of miR-23a and PLK-1 in three human PC cell lines (PANC-1, MIA-PaCa-2 and Aspc-1) and one human pancreatic ductal epithelial cells hTERT-HPNE. As shown in Fig. 1A and B, the expression level of miR-23a and PLK-1 mRNA were significantly increased in three PC lines compared to hTERT-HPNE cell. However, the expression pattern of miR-23a and PLK-1 showed a reverse trend in three PC cell lines. For example, compared with MIA-PaCa-2 and Aspc-1 cell lines, the highest expression of miR-23a was shown in PANC-1 cells, while PLK-1 level was lowest in PANC-1 cells. To further verify the direct relationship between miR-23a and PLK1, we constructed PLK1-3′UTR-WT and PLK1-3′UTR-mut plasmids to perform double luciferase reporter assay in MIA-PaCa-2 cell line. Results indicated that up-regulation of miR-23a dramatically repressed the luciferase activity by 50% when cotransfected with PLK-1 3′UTR-WT in PC cells, but there was no change in the PLK-1 3′UTR-mut group (Fig. 1C and D). Therefore, these findings suggest that PLK-1 is a potential target of miR-23a in PC cells.
Figure 1.
PLK-1 is a potential target of miR-23a in PC cells. The transcriptional expression pattern of (A) miR-23a and (B) PLK-1 in PC cells. (C) Alignment between the predicted miR-23a target sites in the PLK-1 3′-UTR and miR-23a. (D) The relative luciferase activity among PLK-1 3′-UTR-WT and PLK-1 3′-UTR-mut were shown. Data were presented as the mean ± standard deviation. **P<0.01 vs. the control. PC, pancreatic cancer; miR, microRNA; PLK-1, polo-like kinase-1; WT, wild-type; UTR, untranslated region; NC, negative control.
Overexpression of miR-23a suppresses the proliferation, migration, and invasion of MIA-PaCa-2 cells
We further explored whether miR-23a could affect biological functions of PC cells. Cell proliferation assay suggested that miR-23a overexpression significantly suppressed the proliferation of PC cell at 24~48 h post transfection, while transfection with miR-23a inhibitor moderately enhanced the multiplication capacity of PC cells compared with control groups (Fig. 2). According to the statistical analysis indicated that MIA-PaCa-2 cell growth rate was the lowest in miR-23a transfection group compared with the control groups, and the highest in group transfected with miR-23a inhibitor after transfection for 24, 48, and 72 h. However, there was no significant change among the three control groups at any point in time (Fig. 3A-C).
Figure 2.
Effects of miR-23a on proliferation and metastasis ability of pancreatic cancer cells. Cell proliferation ability was examined in the Blank, inhibitor-NC, PLL 3.7, miR-23a and inhibitor groups after (A) 24 h and (B) 48 h treatment. (C) The migration and invasion cell number was stained with crystal violet and numbered in each group. Data were presented as the mean ± standard deviation. **P<0.01 vs. the blank group. NC, negative control; miR, microRNA.
Figure 3.
Effects of miR-23a on pancreatic cancer cell proliferaton. The cell growth rates of each group was calculated at (A) 24, (B) 48 and (C) 72 h. (D) Relative has-miR-23a expression of the different groups was detected by reverse transcription-quantitative polymerase chain reaction analysis. Data were presented as the mean ± standard deviation. *P<0.05 and **P<0.01 vs. the blank group. NC, negative control; miR, microRNA; OD, optical density.
We further investigated the effects of miR-23a on the capability of migration and invasion in MIA-PaCa-2 cells. As shown in Fig. 2C, miR-23a overexpression prominently reduced cell migration compared with blank and PLL3.7 group, while miR-23a inhibitor increased the migration ability of MIA-PaCa-2 cells. Similar results were acquired in cell invasion assay (Fig. 2C, lower panel). Furthermore, transfection efficiency was also verified through detecting the transcriptional level of has-miR-23a to support our findings (Fig. 3D). Taken together, we demonstrate that miR-23a acts as a tumor suppressor in PC cells.
Increased expression of miR-23a induces PC cell apoptosis probably through modulating PLK-1
We sought to examine whether miR-23a could inhibit cell growth by modulating cellular apoptosis. Flow cytometry assays showed that miR-23a overexpression promoted cell apoptosis significantly (52.22% vs. 4.92%), while transfection with miR-23a inhibitor decreased cell apoptotic rate compared with NC group (4.32% vs. 10.68%) (Fig. 4A). To investigate the underlying mechanism of proliferation inhibition and apoptosis promotion induced by miR-23a, the expression level of several proliferation and apoptosis related proteins, including oncogene PLK-1, apoptotic activator Bcl-2-associated X protein (Bax), Bcl-2, tumor suppressor E-cadherin, cell cycle-associated protein Cyclin B1 and Vimentin were determined, respectively. As expected, the protein expression of PLK-1 was decreased or increased in cells transfected with miR-23a mimic or inhibitor, respectively (Fig. 4B). Moreover, miR-23a overexpression inhibited Bcl-2, Cyclin B1, and Vimentin expression, while promoted Bax and E-cadherin expression, while opposite effects were observed in cells transfected with miR-23a inhibitor. Therefore, our findings demonstrate that miR-23a mediates cell apoptosis probably by targeting PLK-1 and regulating downstream effectors.
Figure 4.
PC cell apoptosis induced by miR-23a and multiple signaling molecules expression. (A) Flow cytometry based apoptosis assay for PC cells with different treatment. (B) Protein expression of PLK1, Vimentin, Cyclin B1, Bcl-2, E-cadherin, and Bax proteins in MIA-PaCa-2 cells transfected with different plasmids were determined by western blotting assay with specific antibodies. PC, pancreatic cancer; miR, microRNA; Bcl, B-cell lymphoma; PLK, polo-like kinase-1; NC, negative control.
MiR-23a inhibits PC tumor growth in vivo
Furthermore, we tried to observe the critical anti-carcinoma role of miR-23a in vivo. As indicated in Fig. 5A, the tumor masses distinctly diminished in group of MIA-PaCa-2 cells injected with miR-23a agomir compared to control and negative control groups at 24 days after initial injection. We also stripped out the neoplasm at 31 days post-injection, the result showed that tumor size was the lowest in miR-23a agomir-treated group than control groups (Fig. 5B). Moreover, according to the statistic analyses of tumor growth curve, we could see from Fig. 5C, control and negative control group presented a similar increasing tendency, but up-regulation of miR-23a obviously slowed tumor growth. We further explored the transcriptional levels of miR-23a and PLK-1 of tumor mass in each group, and found PLK-1 expression was significantly suppressed in miR-23a agomir-treated group (Fig. 5D), and these data further verified the essential inhibition of miR-23a on cell proliferation in vivo.
Figure 5.
Inhibitory role of miR-23a on tumor growth in vivo. (A) Images of the tumors on mice in the Blank, NC and miR-23a group were captured at 21 days after the initial injection. (B) The tumor sizes of each group when mice were harvested at 31 days. (C) Average tumor growth curves in nude mice. The transcriptional expression of (D) miR-23a and (E) PLK-1 in tumors was detected by reverse transcription-quantitative polymerase chain reaction analysis. Data were presented as the mean ± standard deviation. **P<0.01 vs. the MIA-Paca-2 group. miR, microRNA; PLK, polo-like kinase-1; NC, negative control.
Mir-23a is highly expressed in human PC tissues
To further determine the correlation between miR23a and PLK-1in human PC samples, we examined transcriptional levels of miR-23a and PLK-1 in 20 cases of primary PC patients and their paired adjacent non-tumor tissues by using qPCR. Among 20 pairs of PC patient tissue samples, 19 (95%) cases showed remarkable up-regulation of miR-23a in cancer tissues (Fig. 6A and B). However, miR-23a expression was negatively correlated with tumor grade, tumor size and lymph node metastasis (Table II). As shown in Fig. 6C, 10 (50%) cases showed up-regulation of PLK-1 in cancer tissues compared with non-tumor tissues, indicating its high expression was potential correlation with the progression of PC. Conversely, 10 (50%) cases presented down-regulation of PLK-1 in tumor samples compared to non-tumor tissues. Importantly, pearson's correlation coefficient analysis indicated that miR-23a and PLK-1 expression was negatively correlated in PC tissues (Fig. 6D). Thus, these findings in human PC tissues present some contradictions with our in vitro data.
Figure 6.
The expression pattern of miR-23a and PLK-1 in human PC. (A) Relative expression of (A and B) miR-23a and (C) PLK-1 was detected in 20 cases human PC and normal adjacent samples. (D) Representative expression analysis of miR-23a in human pancreatic cancer samples and normal samples. PC, pancreatic cancer; miR, microRNA; PLK, polo-like kinase-1.
Table II.
Association between microRNA-23a expression and clinical pathological characteristics of 20 patients with pancreatic cancer.
Variables
n
Low miR-23a (%)
High miR-23a (%)
P-value
Age
>0.500
>40
12
5
7
≤40
8
4
4
Sex
>0.500
Male
13
8
5
Female
7
4
3
T grade of tumor
0.012
T1
5
4 (80.0)
1 (20.0)
T2
6
4 (66.7)
2 (33.3)
T3
4
3 (75.0)
1 (25.0)
T4
5
4 (83.3)
1 (16.7)
Tumor size
0.015
<6 cm
12
9 (75.0)
3 (25.0)
>6 cm
8
6 (75.0)
2 (25.0)
Lymph node metastasis
0.005
Negative
9
6 (66.7)
3 (33.3)
Positive
11
8 (72.8)
3 (27.2)
The median was used to determine the cut-off value for low/high.
Discussion
Many efforts have been made to define it as a therapeutic drug target in PC (13). However, due to the lack of specificity and high toxicity, PLK1-specific inhibitors are limited in clinical applications (14). Hence, the essential regulator role of PLK-1 in cancer still drive scientists to find novel targeted miRNAs which can be taken as a critical biomarker and targeted for drug discovery.Here, we verified the expression pattern of miR-23a and PLK-1, and revealed the negative correlation between them in human PC cell lines (PANC-1, MIA-PaCa-2 and Aspc-1). Our data illustrated miR-23a acted as a negative regulator of PLK-1 in PC cells. Our investigation demonstrated that miR-23a overexpression in MIA-PaCa-2 suppressed cell growth, as well as increased cell apoptosis. Xenograft experiment also verified the inhibition of miR-23a in tumor growth. Even though previous studies have confirmed that PLK-1 is associated with the development and progression of pancreatic carcinoma (15), the understanding of upstream and downstream regulators for PLK-1 are very poor. Moreover, the underlying mechanism of how PLK1 interaction with cell proliferation and apoptosis pathway in PC remains to be understood and needs further investigation. Our findings revealed a novel regulator of PLK-1 that could ameliorate the oncogenesis of PC through disturbing PLK-1 expression. Additionally, we found that up-regulation of miR-23a promoted the expression of Bcl-2-associated X protein (Bax) and E-Cadherin, suppressed the expression of Cyclin B1, Vimentin, and Bcl-2. Possibly, our findings provide a novel regulation mechanism of miR-23a by possibly targeting PLK-1 targeting PLK-1 in PC progression.Paradoxically, we and other researchers confirmed that miR-23a was obviously up-regulation in human PC tissues compared to normal pancreatic samples (7), indicating that miR-23a might act as an oncogenic regulator in PC patients. However, it can also function as a tumor suppressor in a few kinds of tumor. For example, previous study has suggested that miR-23a could enhance migration and invasion by down-regulation of PTEN in osteosarcoma (16). Some researchers indicated that miR-23a showed lower expression in osteosarcoma specimens and functioned as a tumor suppressor (17). Our observations demonstrated that miR-23a was overexpressed in PC patients, but miR-23a overexpression could inhibit PC progression in vitro. We thought there were three reasons: 1) The heterogeneity of miR-23a and PLK-1 expression between human PC samples and PC cells is due to that the in vivo tumor microenvironment was a highly complex and situational scene resulting in the diversity of signal molecule expression. 2) Possibly, miR-23a was indeed up-regulation in human PC and functioned as an oncogenic regulator by targeting kinds of tumor suppressor genes. However, the role of miR-23a on mediating the down-regulation of PLK-1 was covered up by its oncogenic role in human PC patients. 3) Considering that our statistical sample was extremely limited, a large number of samples need to be taken to obtain a meaningful result. Thus, miR-23a might play different roles and functions based on individual differences. Probably, miR-23a is an oncogene by modulating various tumor suppressors in PC. miR-23a functions as anti-oncogene through probably restraining the expression of oncogene PLK-1 and its downstream signaling pathway.In conclusion, we demonstrated the inhibitory roles of miR-23a possibly by targeting PLK-1 in vitro and in vivo. We were confident that miR-23a could inhibit PC progression in some patients or some PC cell lines by affecting the expression of PLK-1. However, the detailed mechanism and the possibility of the clinical application of miR-23a in PC still need to be investigated.
Authors: Monika Raab; Sven Kappel; Andrea Krämer; Mourad Sanhaji; Yves Matthess; Elisabeth Kurunci-Csacsko; Julia Calzada-Wack; Birgit Rathkolb; Jan Rozman; Thure Adler; Dirk H Busch; Irene Esposito; Helmut Fuchs; Valérie Gailus-Durner; Martin Klingenspor; Eckhard Wolf; Nicole Sänger; Florian Prinz; Martin Hrabě de Angelis; Jost Seibler; Juping Yuan; Martin Bergmann; Rainald Knecht; Bertolt Kreft; Klaus Strebhardt Journal: Nat Commun Date: 2011-07-19 Impact factor: 14.919
Authors: Mingyi Shang; Li Weng; Shaoqiu Wu; Bingyan Liu; Xiang Yin; Zhongmin Wang; Aiwu Mao Journal: Am J Cancer Res Date: 2021-06-15 Impact factor: 6.166