Development of microsatellite markers for the wind cave-associated shrub Lonicera alpigena subsp. glehnii (Caprifoliaceae).

PREMISE OF THE STUDY: Microsatellite markers were developed for the wind cave-associated shrub Lonicera alpigena subsp. glehnii to conduct phylogeographic studies on the species. METHODS AND
RESULTS: Based on the sequence data obtained by 454 sequencing, a total of 81 primer pairs were designed and 18 successfully amplified the microsatellite regions. These markers were highly variable (i.e., average number of alleles per locus = 6.2 [range = 2-15]; average expected heterozygosity per locus = 0.489 [range = 0.149-0.729]). Cross-species amplification of the primers was tested in 10 congeneric taxa (L. caerulea var. emphyllocalyx, L. chamissoi, L. chrysantha, L. gracilipes var. glandulosa, L. japonica, L. kurobushiensis, L. morrowii, L. ramosissima, L. sachalinensis, and L. strophiophora), and six to 11 primers amplified the microsatellite markers.
CONCLUSIONS: The microsatellite markers developed in this study will be useful for phylogeographic studies and conservation genetics of L. alpigena subsp. glehnii as well as congeneric species.

There are many wind caves in the northern part of the Japanese Archipelago, from which very cold winds, often at temperatures less than 4°C, blow even in the summer. The temperature around wind caves is low, and is often less than 5°C even though the surrounding area may have a temperature greater than 25°C. Consequently, unique flora, including species distributed normally in more northern or high altitudinal areas, often develop near wind caves (Iokawa and Ishizawa, 2003).

Lonicera alpigena L. (sensu lato) is disjunctly distributed in Europe and the Far East from Sakhalin to the Japanese Archipelago. Although the populations in the Far East had been treated as the separate species L. glehnii F. Schmidt, Hara (1983) treated the populations as a subspecies of L. alpigena (i.e., L. alpigena subsp. glehnii (Fr. Schm.) H. Hara) because the differences between the European and the Far East populations are not so distinct. Lonicera alpigena subsp. glehnii is listed as “endangered (EN)” in the Red Data Book of Japanese plant species (Japanese Ministry of the Environment, 2015) and is a representative of the unique flora formed near wind caves. In the Japanese Archipelago, the main distribution of the taxon is located above approximately 42°N in latitude, and this species grows in the understory. Below this latitude, the taxon is restricted to locations near wind caves, and less than 20 populations of the taxon have been reported to date (Iokawa and Ishizawa, 2003).

Two hypotheses are possible for the origins of populations of L. alpigena subsp. glehnii occurring near wind caves in the southern part of the distribution. The first is that the populations are relicts that had a continuous range during the last glacial era, and that the populations near wind caves have been maintained after the end of the glacial era due to the specific cool environment (Iokawa and Ishizawa, 2003). The second hypothesis is that the populations originated from long‐distance dispersal by birds. However, there are no data to support either of these hypotheses, and phylogeographic analyses are required. Preliminary surveys have indicated that chloroplast DNA variations found in populations of L. alpigena subsp. glehnii are not sufficiently informative for phylogeographic study of this taxon (T. Miyazaki, unpublished data) and more variable markers are necessary for further studies, because few markers are available for the focal taxon and its congeneric species at present (but see Rocha et al., 2014). The microsatellite markers developed in this study will be useful for testing the hypotheses regarding the origin of the populations near wind caves and will also be useful for other congeneric species, depending on the results of cross‐species amplification tests.

Methods and results

Leaves were collected from an individual belonging to a population of L. alpigena subsp. glehnii near a wind cave in Mt. Kanpu‐zan, Oga‐si, Akita Prefecture, Japan (Appendix 1). Total DNA was extracted from two mature leaves according to the cetyltrimethylammonium bromide (CTAB) method of Doyle and Doyle (1990). Using Roche Junior Titanium Series kits (Roche Diagnostics, Mannheim, Germany), 500‐ng aliquots of the genomic DNA were nebulized at 0.21 MPa for 1 min, and then a shotgun library was generated and pyrosequenced using the GS Junior 454 System (Roche Diagnostics) according to the manufacturer's instructions. A total of 52,591 reads (average length 447.94 bp) were obtained, and library‐specific FASTA files were generated after trimming the information except sequences. The reads were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA; Bioproject number PRJNA415337). Based on screening using the MISA Perl script (Thiel et al., 2003), 2082 of these reads were found to contain microsatellite motifs of at least eight and five dinucleotide and trinucleotide repeats, respectively. Primers were designed for potential microsatellite loci with at least eight dinucleotide and trinucleotide repeats using Primer3 version 2.0 software (Rozen and Skaletsky, 1999), using default settings, with each primer designed to amplify a total length of less than 350 bp. Consequently, a total of 343 primer pairs were designed, 81 of which were tested because their sequence lengths were sufficient for designing anchor primers outside of the repeat region. PCR amplification was conducted in a volume of 4 μL containing approximately 60 ng of genomic DNA, 2 μL of 2× Type‐it Multiplex PCR Master Mix (QIAGEN, Germantown, Maryland, USA), 0.25 μM reverse primer with a PIG‐tail (5′‐GTTCTT‐3′; Brownstein et al., 1996), 0.075 μM forward primer with a fluorescent universal tail attached at its 5′ end (Table 1), and 0.1 μM of the fluorescence‐labeled universal primers used by Blacket et al. (2012). The following profiles were used for all of the primer pairs: initial denaturation at 95°C for 5 min; followed by 35 cycles of 95°C for 30 s, 55°C for 90 s, and 72°C for 45 s; with a final extension at 60°C for 30 min. The PCR products were run with a GeneScan 600 LIZ internal size standard (Applied Biosystems, Foster City, California, USA) on an ABI 3130 Genetic Analyzer (Applied Biosystems). The fragment lengths were obtained using GeneMapper software (Applied Biosystems). Eighteen primer pairs amplified clear and reproducible bands in the initial screen using 16 individuals of L. alpigena subsp. glehnii from the Ketto population in Niigata Prefecture (Table 1). The remaining primers produced bands with lengths far from the expected ones (i.e., amplified nontargeted regions) or amplified in only a small number of the individuals screened.

Table 1

Characteristics of 18 polymorphic simple sequence repeat markers developed for Lonicera alpigena subsp. glehnii

Locusa	Primer sequences (5′–3′)b	Repeat motif	Allele size range (bp)	Groupc	GenBank accession no.
ezoh4	F: [Tail B] TTGGCAACTGGAGGTTTTGC	(GCT)13	328–365	1	LC311613
	R: TAAGGGCTAAGGCGAACCAG
ezoh5	F: [Tail A] AACCTGTTCCTATAGGCGGC	(TCA)12(TTA)5	266–302	2	LC311614
	R: AGCAGCAGCAACTTGAGGAT
ezoh13	F: [Tail C] TTTGTTCCGGTGGAAGGAGG	(GT)8(GA)10	146–178	1	LC311615
	R: AGCACCACCACCATCACAAT
ezoh17	F: [Tail B] ATCACACAGAAAGGCCCACC	(CT)12	178–205	2	LC311616
	R: AGAGTGTAGTTCCGGCAAGC
ezoh20	F: [Tail D] GTTGACGCCGATGTTCCTTG	(GA)12	187–193	1	LC311617
	R: CCTACGCAATGCCCTAGACA
ezoh27	F: [Tail C] CCCTTTGGCGGGTACACTAA	(AG)14	213–240	2	LC311618
	R: ACGGAGAGAGAGAATCCTCCC
ezoh36	F: [Tail A] CATCTGCGTTGATTGGCGAG	(TC)9(TA)9	223–252	3	LC311619
	R: GGAAACCCCGTTGAATTGCC
ezoh39	F: [Tail D] GCACCTCCAGCCAAGAAGAT	(TC)8(TA)8	178–196	3	LC311620
	R: TGGCGTTGAATACCCTGCAT
ezoh42	F: [Tail D] ACGAAGAGAGGTCTGGTCGA	(AT)10	254–271	4	LC314220
	R: GACCAGCCAGAGGAGTTGTC
ezoh43	F: [Tail A] TGCAGCACACAGACCAGATT	(TA)10	184–206	4	LC311621
	R: AGAAGATCGATGAGCTATTGATGCT
ezoh57	F: [Tail C] TGATTCAACCTCCCACACAA	(TA)9	152–170	5	LC311622
	R: TCATGGCCACCAGTTAAGAA
ezoh58	F: [Tail D] CCACCTTGTCACATGTTTGC	(TC)9	212–222	5	LC311623
	R: GAGGGCATAAGATGCGATGT
ezoh62	F: [Tail C] TTGACCTGACCCTAGCTCTTG	(TA)8	257–290	6	LC311624
	R: CTTTGTCAAATCCCGTGTCC
ezoh67	F: [Tail D] GCATGAGATTCAACAATCTGG	(AT)8	193–209	6	LC311625
	R: CAGTGGACCACAAACCTCAA
ezoh69	F: [Tail B]GTCGAACCAACTCCACCAGT	(CT)8	192–194	5	LC311626
	R: CAACAACCCAAGAATGCTCA
ezoh73	F: [Tail A] TGTGATTCAAATACTATGGGAGCTT	(AT)11	109–123	6	LC311627
	R: TTTGTTGTGGCATTTCAATCA
ezoh77	F: [Tail C] ATCCAGCCTTTGAGTTGTGC	(AT)11	241–253	4	LC311628
	R: CTGCAATCTCGTGGTGATCT
ezoh81	F: [Tail A] ATCCAGGTTCATCTGCTGCT	(AGC)8	232–248	5	LC311629
	R: GGTGAGGATGTTGTTGTTGC

Annealing temperature was 55°C for all loci.

Sequences and fluorescent dyes of the tail primers: Tail A = <6‐FAM>GCCTCCCTCGCGCCA, Tail B = GCCTTGCCAGCCCGC, Tail C = CAGGACCAGGCTACCGTG, Tail D = CGGAGAGCCGAGAGGTG.

Loci with the same number were multiplexed in the same genotyping run.

Genotyping using these 18 primer pairs was performed for 15–19 individuals in three populations (Ketto in Niigata Prefecture, Natsugori in Iwate Prefecture, and Yamada in Hokkaido Prefecture). DNA extractions were carried out in the same way as for next‐generation sequencing. Of the 18 loci, one locus and six loci were monomorphic in the Natsugori and Ketto populations, respectively, while all loci were polymorphic in the Yamada population. The observed and expected heterozygosities were calculated using GenAlEx 6.503 (Peakall and Smouse, 2012); observed heterozosity values ranged from 0.306–0.608, and expected heterozygosity values ranged from 0.291–0.643 across the three populations (Table 2). Nine, one, and five loci departed significantly from Hardy–Weinberg equilibrium, as determined using GENEPOP version 4.2 software (Rousset, 2008) (Table 2). No null alleles were detected in any of the three populations using MICRO‐CHECKER 2.2.3 software (van Oosterhout et al., 2004).

Table 2

Genetic variation of the 18 polymorphic loci developed for Lonicera alpigena subsp. glehnii in three populations.a

Locus	Natsugori (N = 19)				Ketto (N = 16)				Yamada (N = 15)
	A	H o	H e	P valueb	A	H o	H e	P valueb	A	H o	H e	P valueb
ezoh4	4	0.737	0.720	0.034	3	0.563	0.604	0.046	7	0.667	0.689	0.534
ezoh5	3	0.895	0.630	0.090	1	0.000	0.000	NA	9	0.733	0.838	0.020
ezoh13	5	0.947	0.773	0.008	2	0.000	0.305	0.001	8	0.600	0.724	0.071
ezoh17	2	0.053	0.051	NA	1	0.000	0.000	NA	5	0.133	0.396	0.001
ezoh20	2	0.105	0.188	0.161	2	0.375	0.305	1.000	4	0.667	0.642	0.738
ezoh27	3	0.211	0.576	0.000	2	0.188	0.170	1.000	12	1.000	0.902	0.600
ezoh36	5	0.579	0.457	0.848	2	0.438	0.342	0.544	9	0.867	0.829	0.659
ezoh39	4	0.526	0.464	1.000	3	0.625	0.633	0.559	7	0.533	0.787	0.024
ezoh42	4	0.737	0.727	0.041	1	0.000	0.000	NA	5	0.733	0.589	0.750
ezoh43	3	0.632	0.497	0.223	4	0.813	0.662	0.059	10	0.867	0.831	0.970
ezoh57	5	0.789	0.691	0.001	4	0.625	0.697	0.250	9	0.733	0.800	0.398
ezoh58	4	0.842	0.614	0.125	1	0.000	0.000	NA	5	0.600	0.664	0.616
ezoh62	4	0.895	0.564	0.008	1	0.000	0.000	NA	4	0.333	0.296	1.000
ezoh67	5	0.895	0.672	0.101	3	0.563	0.490	0.546	6	0.333	0.744	0.001
ezoh69	2	0.789	0.494	0.022	1	0.000	0.000	NA	2	0.200	0.278	0.326
ezoh73	7	0.474	0.733	0.000	2	0.438	0.342	0.545	6	0.533	0.527	0.424
ezoh77	5	0.842	0.740	0.022	3	0.625	0.477	0.504	4	0.467	0.673	0.158
ezoh81	1	0.000	0.000	NA	2	0.250	0.219	1.000	2	0.067	0.358	0.006
Mean	3.78	0.608	0.533		2.11	0.306	0.291		6.33	0.559	0.643

A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; NA = not applicable due to no or very few variations.

Voucher and locality information are provided in Appendix 1.

Significant level for deviation from Hardy–Weinberg equilibrium.

Cross‐species amplification of the 18 loci developed in this study was examined in five individuals of each of the 10 congeneric taxa: L. caerulea L. var. emphyllocalyx (Maxim.) Nakai, L. chamissoi Bunge, L. chrysantha Turcz. ex Ledeb., L. gracilipes Miq. var. glandulosa Miq., L. japonica Thunb., L. kurobushiensis Kadota, L. morrowii A. Gray, L. ramosissima Franch. & Sav. ex Maxim., L. sachalinensis (F. Schmidt) Nakai, and L. strophiophora Franch. Six (L. sachalinensis) to 11 loci (L. chrysantha and L. morrowii) were successfully amplified in these 10 taxa (Table 3).

Table 3

Allele size ranges obtained during cross‐amplification trials of simple sequence repeat markers isolated from Lonicera alpigena subsp. glehnii and tested in 10 congeneric species.a

Locus	L. strophiophora	L. japonica	L. caerulea var. emphyllocalyx	L. morrowii	L. chamissoi	L. ramosissima	L. sachalinensis	L. gracilipes var. glandulosa	L. chrysantha	L. kurobushiensis
ezo4	337	—	—	313–341	—	—	—	—	339	339
ezo5	215–230	—	—	—	—	—	—	—	—	—
ezo13	—	130–152	—	—	—	143	—	147–169	133–141	133–137
ezo17	183–191	185–187	—	181	176–178	193–199	181	—	173–174	174
ezo20	—	—	193	—	—	—	—	—	—	217–219
ezo27	245–256	220–238	231–240	237–247	216–238	229–239	—	220–271	226–230	212
ezo36	220–233	214–225	220–229	259–281	220–241	233–243	223–253	223–241	221–223	217–219
ezo39	—	—	—	180	—	182–198	—	181–192	182	182
ezo42	—	—	—	—	261–275	—	256–264	—	—	—
ezo43	190–198	195–197	187–208	187	—	186	—	188–190	—	—
ezo57	—	—	—	—	—	—	—	—	—	—
ezo58	226–252	220–232	223–235	212–218	211–213	218–231	—	—	218–233	216–229
ezo62	—	268–274	—	247–264	—	—	—	—	—	—
ezo67	—	—	—	—	—	—	—	—	—	—
ezo69	194–202	194–196	192–196	198–206	211–213	194	200–209	208–216	214–228	—
ezo73	105–107	115–123	111–115	111–121	117–127	119–125	113–125	117–123	113–117	111–123
ezo77	—	—	239	—	—	—	—	239	241	—
ezo81	241–244	229–241	232–238	223	227–232	232–235	226–238	235–241	232	232

— = no signal or nonspecific amplification was detected in PCR amplification.

Voucher and locality information are provided in Appendix 1.

Conclusions

We developed 18 polymorphic simple sequence repeat markers in L. alpigena subsp. glehnii, which will be valuable for phylogeo‐graphic studies and conservation genetics of this wind cave–associated taxon, as well as for population genetics of other Lonicera species.

Species	Collection locality	Geographic coordinates	Voucher specimena
L. alpigena L. subsp. glehnii (Fr. Schm.) H. Hara	Mt. Kanpu, Oga City, Akita Pref.	39.93125°N, 139.87009°E	Maki 17006
	Natsugori, Hachimantai City, Iwate Pref.	40.15200°N, 140.91701°E	Maki 13273
	Ketto, Tsunan Town, Niigata Pref.	36.92500°N, 138.63921°E	Maki 17015
	Yamada, Shikaoi Town, Hokkaido Pref.	43.30697°N, 143.12411°E	Maki 17008
L. caerulea L. var. emphyllocalyx (Maxim.) Nakai	Uenae, Tomakomai City, Hokkaido Pref.	42.68956°N, 141.71942°E	Maki 17011
L. chamissoi Bunge	Mt. Ashibetu, Furano City, Hokkaido Pref.	43.23768°N, 142.29533°E	Kimura TK100
L. chrysantha Turcz. ex Ledeb.	Musa, Kushiro City, Hokkaido Pref.	42.98922°N, 144.43065°E	Maki 17009
L. gracilipes Miq. var. glandulosa Miq.	Obara‐Uwadai, Shiroishi City, Miyagi Pref.	37.95716°N, 140.51025°E	Maki 17013
L. japonica Thunb.	Kounominato, Munakata City, Fukuoka Pref.	33.85070°N, 130.49919°E	Oiki 1
L. kurobushiensis Kadota	Mt. Kurobushi, Higashine City, Yamagata Pref.	38.44078°N, 140.52271°E	Miyazaki TM1
L. morrowii A. Gray	Mt. Kanpu, Oga City, Akita Pref.	39.93120°N, 139.87000°E	Maki 17007
L. ramosissima Franch. & Sav. ex Maxim.	Obara‐Uwadai, Shiroishi City, Miyagi Pref.	37.95702°N, 140.51015°E	Maki 17012
L. sachalinensis (F. Schmidt) Nakai	Uenae, Tomakomai City, Hokkaido Pref.	42.68818°N, 141.71775°E	Maki 17010
L. strophiophora Franch.	Fukkoshi, Yokohama Town, Aomori Pref.	41.00226°N, 141.24004°E	Maki 16018

All voucher specimens are deposited in the Herbarium of the Botanical Garden, Tohoku University (TUS), Sendai, Miyagi, Japan.