Development of polymorphic EST-SSR markers in Itea chinensis (Iteaceae) and cross-amplification in related species.

PREMISE OF THE STUDY: We isolated and characterized 16 expressed sequence tag-simple sequence repeat (EST-SSR) markers in Itea chinensis (Iteaceae), a common evergreen broadleaf tree, for future studies on the genetic diversity and spatial genetic structure of the species. METHODS AND
RESULTS: Based on transcriptome data of I. chinensis, a total of 36 primer pairs were initially designed and tested. Of these, 16 were successfully amplified and showed clear polymorphism. For these markers, the number of alleles per locus varied from two to 15. The observed and expected heterozygosity ranged from 0 to 0.600 and 0.072 to 0.554, respectively. Furthermore, all loci were successfully cross-amplified in two congeneric species, I. oblonga and I. yangchunensis.
CONCLUSIONS: The EST-SSR markers described here can be used to study the genetic diversity and phylogeographic patterns of I. chinensis and other related species in Itea.

Itea L. is the only member of the family Iteaceae within the order Saxifragales (Chase et al., 2016). The genus is distributed mainly from the Himalayas to Japan with about 20 species, and only one species (I. virginica L.) is disjunctly distributed and unique to eastern North America (Guo and Ricklefs, 2000; Jin and Ohba, 2001). Southeastern China is the center of diversity for the genus, where there are about 15 species, 10 of which are endemic (Jin and Ohba, 2001; Hermsen, 2013). The plants of Itea are shrubs and small trees and generally occur in montane forest or wet habitats ranging in elevation from sea level up to about 3000 m.

Itea chinensis Hook. & Arn. is a widespread species in the genus. It grows in mountain slopes, sparse forests, along streams, or in valleys from 100–2400 m and is a common component in the understory of evergreen broadleaf forests (Jin and Ohba, 2001). It has been reported that individuals are variable in the shape, size, and marginal dentation of leaf blades (Jin, 1995). It is unknown whether these variations are the result of phenotypic plasticity or ecotypic variation, and molecular data may help to resolve the question. However, genetic markers for the analysis of genetic variation of the species or other species within the genus have not yet been developed. Therefore, we developed and characterized 16 microsatellite markers for I. chinensis that we will use to investigate its genetic diversity, especially spatial genetic structure, to understand the effects of environment on the genetic structure of the species. We also tested the transferability of these markers in three populations of two congeneric species endemic to China, I. oblonga Hand.‐Mazz. and I. yangchunensis S. Y. Jin.

Methods and results

A total of 60 individuals of I. chinensis were collected from three natural populations in Guangdong Province (Heishiding, Fengkai County [HSD]; Dinghushan, Zhaoqing County [DHS], and Shimentai, Yingde County [SMT]; Appendix 1). Genomic DNA was isolated from silica‐dried leaves of the individuals using the HiPure SF Plant DNA Kit (Magen, Guangzhou, Guangdong, China) following the manufacturer's protocol. Voucher specimens are deposited at the Herbarium of Sun Yat‐sen University (SYS), Guangzhou, Guangdong, China (Appendix 1).

For RNA extraction, young and healthy leaves of an I. chinensis seedling were obtained from the Heishiding Nature Reserve, Guangdong Province, and transported to the laboratory in liquid nitrogen. Total RNA was extracted by using a modified cetyltrimethylammonium bromide (CTAB) method (Fu et al., 2005). Subsequently, the integral cDNA libraries were constructed for sequencing using the Illumina HiSeq 2500 System (Illumina, San Diego, California, USA). Using Trinity (trinityrnaseq‐2.1.1) with the default parameters (Grabherr et al., 2011), 90,263 nucleotide paired‐end reads were generated. All sequence information has been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (accession no. SRR6067069). The transcripts, with further processing and filtering by CAP3 (minimum identity = 99%), yielded a set of 80,181 nonredundant sequences with an average length of 600.48 bp and an N50 length of 860 bp (Huang and Madan, 1999). Simple sequence repeats (SSRs) from the unigenes were detected using MISA version 1.0 with the default parameters (Thiel et al., 2003). We screened for SSRs containing motifs of two to six nucleotides with the minimum number of repeats as follows: six for dinucleotide and five for trinucleotide, tetranucleotide, pentanucleotide, and hexanucleotide. Finally, 23,363 SSR regions were selected, and 36 of them were chosen at random to develop primers using Primer3 (Rozen and Skaletsky, 1999). The optimum conditions were set at: primer length of 22–25 bp, annealing temperature of 60–65°C, and product size range of 100–500 bp.

For trial PCR, three individuals were randomly selected from each population (i.e., total of nine samples) for tests on the amplification of the 36 primer pairs. PCR amplifications were performed on a 2720 Thermal Cycler (Applied Biosystems, Foster City, California, USA) under the following conditions: initial denaturation was at 94°C for 4 min; followed by 30 cycles at 94°C for 30 s, then annealing at 62°C for 45 s, and 72°C for 30 s; with a final extension of 5 min at 72°C. PCR products were visualized on 6% polyacrylamide gel with a 10‐bp DNA ladder (TransGen Biotech Co., Beijing, China). Of the 36 primer pairs, 20 did not amplify at all, and 16 produced PCR products with clear and polymorphic bands among the nine individuals. The sequences of the SSR regions were deposited in GenBank (Table 1).

Table 1

Details of the 16 SSR markers developed for Itea chinensis

Locusa	Primer sequences (5′–3′)	Repeat motif	Allele size range (bp)	Fluorescent label	GenBank accession no.	Putative function	E‐value
Ic1_Itea	F: GCAAGTTATCTGCAGTCCCTCT	(GA)9G(GA)7	307–311	FAM	MF980986	Uridine kinase‐like protein 3 [Gossypium arboretum]	2e‐96
	R: CCCCACATTCCCTTTACATACA
Ic3_Itea	F: CTCGCTGTCTCTGGATTTTCTT	(ACG)7	345–348	HEX	MF980987	Uncharacterized protein LOC104879598 [Vitis vinifera]	2e‐16
	R: CCCTCCGAAGTGTTCGTAACTA
Ic4_Itea	F: GATCTCGACTCGTTAATCTCCG	(GGC)7	363–366	HEX	MF980988	Hypothetical protein [Morus notabilis]	2e‐75
	R: TTCCGCTTGAGAACCATCTAAT
Ic10_Itea	F: TCGGCAGGTCATACAGATACAC	(AGG)8	315–318	HEX	MF980989	Probable arabinosyltransferase ARAD1 [Helianthus annuus]	1e‐130
	R: CACCGAGTCTCTCTTCTCCCT
Ic11_Itea	F: ATCAACAGCAGAGAAATCAGCA	(CAG)8	156–159	FAM	MF980990	Uncharacterized protein LOC105642574 [Jatropha curcas]	3e‐127
	R: CAATGTTGGTCAAAACTGAGGA
Ic14_Itea	F: GATGGAGAAAGCAAGGAGAGAA	(GA)22	205–207	FAM	MF980991	Probable methyltransferase PMT27 [Malus domestica]	7e‐12
	R: GCATGCATGGTGAGAACTTTAG
Ic15_Itea	F: GGAGGGGATGGGTGTTATATTT	(GGC)7	404–407	HEX	MF980992	Glycine‐rich protein 2‐like [Juglans regia]	2e‐15
	R: TAAAGACACAGCCAGACGAAGA
Ic17_Itea	F: GTTCTTGTTCTCCAGTCTGCCT	(TTTTA)8	314–319	HEX	MF980993	Serine/threonine‐protein kinase BRSK1 isoform X2 [Sus scrofa]	0.180
	R: CTTGAATTTGTCTTTCCATCCC
Ic19_Itea	F: ACATCAAGCAGAGAAGCATTCA	(GCTTGA)7	421–427	HEX	MF980994	Protein unc‐45 homolog A, transcript variant X3 [Nelumbo nucifera]	2e‐142
	R: GGTGTACAGCCTGTGAAGTGAG
Ic20_Itea	F: GATAACAGCTGGATCTGAAGCA	(AAG)14	282–285	FAM	MF980995	Mitogen‐activated protein kinase 1‐like [Manihot esculenta]	5e‐14
	R: GATGAGGGAATCAAAGCAGAAG
Ic22_Itea	F: GCTGTACTAAATGGGCACATCA	(AGAA)6	222–226	FAM	MF980996	RING‐H2 finger protein ATL52‐like [Prunus avium]	1e‐61
	R: GGCTGCTGGCATCTACTTCTAC
Ic26_Itea	F: GTTGCTGAACTGGGGAAAATAC	(T)15	415–416	HEX	MF980997	Patellin‐3‐like protein [Manihot esculenta]	0.000
	R: GATGCATCTATCCCCTAAGCAC
Ic29_Itea	F: AGTGGCTCCATTGATTTACAGG	(ATAG)5	407–411	HEX	MF980998	Hypothetical protein [Populus trichocarpa]	1e‐53
	R: CACTCATTCATCCATCTCTCCA
Ic31_Itea	F: GAGAATCGTAGAAAGGAAGAGAACA	(AAG)10	161–164	FAM	MF980999	Palmitoyltransferase ZDHHC 18‐like protein [Stegastes partitus]	3e‐05
	R: CAGGATTCTGATTTTGGAAAGG
Ic32_Itea	F: CATGATGAAGATTCAGAGCAGG	(AG)20	204–206	FAM	MF981000	Integral membrane protein GPR137B [Pygocentrus nattereri]	8e‐12
	R: TTCACTCTCTAACTCACGGCTC
Ic34_Itea	F: CGAAGAGAAGCCAAAAAGTAA	(GA)6A(AG)6	247–251	FAM	MF981001	Uncharacterized protein At1g76660 isoform X2 [Vitis vinifera]	0.000
	R: GGAGAGGGAGAAGTTTAAGGGA

Annealing temperature was 62°C for all loci.

To further evaluate the level of polymorphism of the SSR markers, genotyping was performed on all individuals of I. chinensis. PCR amplifications were performed in a final volume of 20 μL, containing 20 ng of genomic DNA, 1× PCR buffer (10 mM Tris‐HCl [pH 8.4] and 1.5 mM MgCl2; TransGen Biotech Co.), 0.2 mM dNTPs (TransGen Biotech Co.), 0.5 μM of each primer (5′ labeled with FAM or HEX) (Life Technologies, Shanghai, China), and 1 unit EasyTaq DNA polymerase (TransGen Biotech Co.). The PCR reactions were carried out on a 2720 Thermal Cycler (Applied Biosystems) under the same conditions as the trial PCR. PCR products were analyzed on an ABI 3730XL DNA analyzer (Applied Biosystems) and resolved with the GeneScan 500 LIZ internal size standard (Applied Biosystems). The peaks of the loci were read using Peak Scanner version 1.0 (Applied Biosystems).Basic statistical parameters, including the number of alleles, observed heterozygosity, unbiased expected heterozygosity, and fixation index, were obtained using GenAlEx version 6.5 (Peakall and Smouse, 2012). Deviations from Hardy–Weinberg equilibrium (HWE) at each locus in each population were estimated using GENEPOP version 4.3 (Rousset, 2008). MICRO‐CHECKER (van Oosterhout et al., 2004) was employed for testing scoring errors and null alleles.

In I. chinensis, the number of alleles per locus ranged from two to 15, the observed heterozygosity from 0 to 0.600, and the expected heterozygosity from 0.072 to 0.554 (Table 2). Of the 16 polymorphic SSR loci, four, five, and four loci showed significant deviations from HWE in populations HSD, DHS, and SMT, respectively (Table 2). Seven of these loci without HWE also showed signs of null alleles (Table 2), which indicated that deviations from HWE may have been related to the presence of null alleles. The interspecific transferability of these markers was tested in three populations of two related species, I. oblonga and I. yangchunensis (20 individuals for each species; Appendix 1). All markers were successfully cross‐amplified, and the number of alleles per locus varied from one to seven in I. oblonga and one to six in I. yangchunensis (Table 3).

Table 2

Results of the initial primer screening in three natural populations of Itea chinensis.a

Locus	HSD population (N = 20)				DHS population (N = 20)				SMT population (N = 20)
	A	H o	H e	F c	A	H o	H e	F c	A	H o	H e	F c
Ic1_Iteab	6	0.300	0.345	0.133	7	0.150	0.281	0.472***	15	0.400	0.436	0.084**
Ic3_Itea	5	0.225	0.241	0.067	5	0.425	0.326	−0.221	5	0.325	0.270	−0.211
Ic4_Itea	5	0.375	0.388	0.036	4	0.300	0.301	−0.313	5	0.325	0.375	0.136
Ic10_Itea	3	0.300	0.295	−0.015	5	0.600	0.554	0.009	5	0.375	0.345	−0.089
Ic11_Itea	7	0.425	0.403	−0.056	6	0.225	0.306	0.269	3	0.075	0.072	−0.039
Ic14_Itea	10	0.325	0.360	0.100	10	0.325	0.406	0.204**	7	0.400	0.365	−0.099
Ic15_Iteab	4	0.100	0.257	0.618**	3	0.100	0.249	0.605**	5	0.325	0.292	−0.115
Ic17_Iteab	8	0.100	0.158	0.372**	4	0.150	0.207	0.281	4	0.200	0.317	0.375**
Ic19_Iteab	7	0.300	0.401	0.256***	6	0.350	0.353	0.008	7	0.175	0.341	0.494***
Ic20_Itea	8	0.375	0.371	−0.011	6	0.475	0.407	−0.172	9	0.375	0.358	−0.049
Ic22_Iteab	5	0.075	0.331	0.778***	4	0.300	0.327	0.085	7	0.350	0.385	0.094
Ic26_Iteab	7	0.150	0.252	0.411	5	0.000	0.239	1.000***	7	0.200	0.384	0.485***
Ic29_Iteab	9	0.350	0.395	0.117	7	0.300	0.394	0.243**	6	0.225	0.311	0.282
Ic31_Itea	2	0.225	0.179	−0.267	3	0.425	0.267	−0.615	4	0.345	0.258	−0.473
Ic32_Itea	4	0.375	0.258	−0.473	3	0.400	0.264	−0.535	4	0.300	0.230	−0.313
Ic34_Itea	4	0.325	0.278	−0.173	3	0.150	0.192	0.224	4	0.175	0.158	−0.108

A = number of alleles; F = fixation index; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals analyzed.

aLocality and voucher information are provided in Appendix 1.

bLocus harboring null alleles (null allele frequency >5%).

cSignificant deviations from Hardy–Weinberg equilibrium after sequential Bonferroni corrections: ***represents significance at the 0.1% nominal level; **represents significance at the 1% nominal level.

Table 3

Cross‐amplification of 16 SSR loci in three populations of two species closely related to Itea chinensis.a

Locus	Itea oblonga						Itea yangchunensis
	JQS population (N = 10)			WZF population (N = 10)			EFZ population (N = 20)
	A	H o	H e	A	H o	H e	A	H o	H e
Ic1_Itea	5	0.000	0.358	6	0.000	0.411	4	0.100	0.137
Ic3_Itea	1	0.000	0.000	2	0.050	0.050	3	0.225	0.184
Ic4_Itea	3	0.000	0.284	3	0.000	0.242	3	0.150	0.296
Ic10_Itea	1	00.000	0.000	2	0.050	0.050	2	0.225	0.179
Ic11_Itea	4	0.200	0.300	2	0.200	0.263	1	0.000	0.000
Ic14_Itea	6	0.200	0.384	7	0.35	0.345	5	0.275	0.370
Ic15_Itea	1	0.000	0.000	2	0.050	0.050	4	0.075	0.207
Ic17_Itea	2	0.000	0.263	2	0.000	0.263	1	0.000	0.000
Ic19_Itea	4	0.250	0.376	6	0.350	0.337	5	0.350	0.344
Ic20_Itea	2	0.100	0.093	2	0.050	0.132	5	0.400	0.302
Ic22_Itea	2	0.000	0.095	3	0.100	0.282	3	0.005	0.211
Ic26_Itea	4	0.000	0.368	3	0.150	0.324	4	0.150	0.342
Ic29_Itea	5	0.350	0.392	4	0.350	0.306	6	0.200	0.306
Ic31_Itea	4	0.500	0.329	3	0.450	0.282	3	0.375	0.333
Ic32_Itea	5	0.450	0.326	4	0.500	0.382	3	0.450	0.283
Ic34_Itea	5	0.100	0.184	2	0.100	0.095	3	0.200	0.233

A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals analyzed.

Locality and voucher information are provided in Appendix 1.

Conclusions

This is the first set of SSR markers developed for the genus Itea. The 16 expressed sequence tag (EST)–SSR markers of I. chinensis will be useful for future investigation of genetic diversity, population structure, and phylogeography of the species. All the markers were successfully cross‐amplified in two congeneric species, suggesting that they may also be used to study other related species in Itea.

Species	Population code	Voucher no.	Collection locality	Geographic coordinates	N
Itea chinensis Hook. & Arn.	HSD	Shixg161001	Heishiding Nature Reserve, Zhaoqing, Guangdong, China	23°27′37.39″N, 111°54′9.78″E	20
	DHS	Shixg161012	Dinghushan Nature Reserve, Zhaoqing, Guangdong, China	23°10′30.14″N, 112°32′10.08″E	20
	SMT	Shixg161211	Shimentai Nature Reserve, Yingde, Guangdong, China	24°23′38.18″N, 113°09′4.66″E	20
I. oblonga Hand.‐Mazz.	JQS	Shixg170501	Jiuqushui, Yanlin, Hunan, China	26°33′38.11″N, 114°04′42.57″E	10
	WZF	Shixg170511	Wuzhifeng, Shangyou, Jiangxi, China	25°54′48.67″N, 114°02′56.47″E	10
I. yangchunensis S. Y. Jin	EFZ	Shixg170302	Efangzhang Nature Reserve, Yangchun, Guangdong, China	21°55′30.40″N, 111°32′14.53″E	20