Jing Ju1,2, Nan Wang2, Jiali Wang2, Fanrong Wu1, Jinfang Ge1, Feihu Chen1. 1. School of Pharmacy, Anhui Medical University, Hefei, People's Republic of China. 2. Department of Pharmacy, Anqing Municipal Hospital, Anqing Anhui, People's Republic of China.
Abstract
BACKGROUND: 4-Amino-2-trifluoromethyl-phenyl retinate (ATPR), a novel retinoid derivative, inhibits proliferation and induces differentiation in many cancer cells. In this study, the inhibitory effects of ATPR on the proliferation, invasion, and migration of breast cancer (BC) cells, and the relationship between ATPR and the expression of the intracellular lipid-binding proteins CRABP2 and FABP5 were investigated. METHODS: CRABP2 and FABP5 expression was evaluated in infiltrating breast-infiltrating ductal carcinoma(BIDC) and benign breast fibroma (BBF) by immunohistochemistry and in MCF-7, MDA-MB-231, MDA-MB-435, and MDA-MB-453 cells by immunofluorescence. The inhibition of proliferation by ATPR in these cells was detected by MTT. After downregulation and upregulation of CRABP2 and FABP5 in MCF-7 or MDA-MB-231 cells using siRNA and plasmids, the effect of ATPR on proliferation was detected by MTT and real-time cell analysis, and the effects of ATPR on the invasion and migration of MDA-MB-231 cells were detected using a Boyden chamber assay and a wound healing assay. RESULTS: CRABP2 expression was moderately or strongly positive in BIDC and BBF. FABP5 expression was also moderately or strongly positive in BIDC, but weakly positive or negative in BBF. CRABP2 and FABP5 were highly expressed in MCF-7 cells, moderately expressed in MDA-MB-453 cells, and weakly expressed in MDA-MB-435 and MDA-MB-231 cells. ATPR inhibited proliferation more strongly in MCF-7 cells than in other cells. The inhibition of proliferation by ATPR depended on an increase in CRABP2, but not FABP5 expression. A decrease in FABP5 could inhibit the invasion and migration of BC cells. CONCLUSION: These findings indicate that ATPR might inhibit proliferation by upregulating CRABP2, and inhibit invasion and migration by downregulating FABP5 in BC cells. These findings may facilitate the use of differentiation therapy in BC.
BACKGROUND: 4-Amino-2-trifluoromethyl-phenyl retinate (ATPR), a novel retinoid derivative, inhibits proliferation and induces differentiation in many cancer cells. In this study, the inhibitory effects of ATPR on the proliferation, invasion, and migration of breast cancer (BC) cells, and the relationship between ATPR and the expression of the intracellular lipid-binding proteins CRABP2 and FABP5 were investigated. METHODS: CRABP2 and FABP5 expression was evaluated in infiltrating breast-infiltrating ductal carcinoma(BIDC) and benign breast fibroma (BBF) by immunohistochemistry and in MCF-7, MDA-MB-231, MDA-MB-435, and MDA-MB-453 cells by immunofluorescence. The inhibition of proliferation by ATPR in these cells was detected by MTT. After downregulation and upregulation of CRABP2 and FABP5 in MCF-7 or MDA-MB-231 cells using siRNA and plasmids, the effect of ATPR on proliferation was detected by MTT and real-time cell analysis, and the effects of ATPR on the invasion and migration of MDA-MB-231 cells were detected using a Boyden chamber assay and a wound healing assay. RESULTS: CRABP2 expression was moderately or strongly positive in BIDC and BBF. FABP5 expression was also moderately or strongly positive in BIDC, but weakly positive or negative in BBF. CRABP2 and FABP5 were highly expressed in MCF-7 cells, moderately expressed in MDA-MB-453 cells, and weakly expressed in MDA-MB-435 and MDA-MB-231 cells. ATPR inhibited proliferation more strongly in MCF-7 cells than in other cells. The inhibition of proliferation by ATPR depended on an increase in CRABP2, but not FABP5 expression. A decrease in FABP5 could inhibit the invasion and migration of BC cells. CONCLUSION: These findings indicate that ATPR might inhibit proliferation by upregulating CRABP2, and inhibit invasion and migration by downregulating FABP5 in BC cells. These findings may facilitate the use of differentiation therapy in BC.
Entities:
Keywords:
ATPR; CRABP2; FABP5; breast cancer; invasion; migration; proliferation
Breast cancer (BC) has one of the highest incidences and death rates among female cancers worldwide. The American Cancer Society estimates that BC accounts for 30% of new cases (250,000) and 14% (40,000) of deaths caused by female tumors in the United States in 2017.1 In China, BC is also the most common cancer in females, accounting for 268,000 new cases and 69,000 deaths in 2015.2 Current therapeutic methods for BC, such as surgery, chemotherapy, radiotherapy, and endocrine therapy, have major limitations. Differentiation therapy, which does not directly kill tumor cells, but induces it to differentiate into normal or nearly normal cells, has recently been proposed as a new method for cancer treatment.As a representative differentiation agent, many in vitro studies have shown that retinoids can effectively inhibit the growth of estrogen receptor (ER)-positive, but not ER-negative BC cells, which limits their clinical application in BC. The variation in the effects of retinoids3–5 may be related to differences in the expression of CRABP2 and FABP5. CRABP2 and FABP5 are both intracellular lipid-binding proteins. These proteins specifically deliver retinoids from the cytoplasm to nuclear retinoic acid receptors and PPARβ/δ, thereby triggering the expression of growth-inhibiting6 and growth-promoting genes.7 Partitioning of retinoids between the two receptors is regulated by CRABP2 and FABP5.8–10 Thus, the CRABP2/FABP5 ratio plays a key role in the different effects of retinoids on cancer cell growth.4-Amino-2-trifluoromethyl-phenyl retinate (ATPR), a novel retinoid derivative synthesized by our group, inhibits proliferation and induces differentiation in many cancer cells,11,12 including the ER-positive BC cell line MCF-7.13 However, the effects of ATPR on ER-negative cells and whether CRABP2 and FABP5 expression mediates the effects of ATPR are still unclear. In this study, the mechanisms of the anti-BC effects of ATPR, including the relationship between the effects of ATPR and the expression of CRABP2 and FABP5, were investigated.
Materials and methods
Drugs and reagents
ATPR was synthesized by the School of Pharmacy, Anhui Medical University (Hefei, China), with a purity of 99.66%. The structure of ATPR is shown in Figure 1. All-trans retinoic acid (ATRA) was purchased from Sigma-Aldrich Co. (St Louis, MO, USA). Anti-FABP5, anti-CRABP2, and FABP5 siRNA were obtained from Santa Cruz Biotechnology Inc. (Dallas, TX, USA). CRABP2 siRNA was synthesized by Sangon Biotech Co., Ltd. (Shanghai, China).
Figure 1
Structure of 4-amino-2-trifluoromethyl-phenyl retinate (ATPR).
Cell lines and culture conditions
MCF-7 human BC cells were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in MEM supplemented with 10% (FBS). MDA-MB-231, MDA-MB-435, and MDA-MB-453 human BC cells were purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China) and cultured in L15 supplemented with 10% FBS. All cells were also cultured at 37°C in a humidified atmosphere of 95% air and 5% CO2, and the culture medium was replaced every other day. Cells in exponential growth phase were used in the following experiments.
Immunohistochemistry
For immunohistochemistry, paraffin-embedded blocks of 92 breast-infiltrating ductal carcinoma samples and 22 benign breast fibroma (BBF) samples were obtained from female patients at the Pathology Department of the Anqing Hospital affiliated with Anhui Medical University between 2012 and 2015. This study was approved by the Ethics Committee of Anqing Hospital affiliated with Anhui Medical University (no: 2012KY002). Written informed consent was obtained from each patient. Paraffinized sections of the samples were incubated with anti-CRABP2 (1:200 dilution) and anti-FABP5 antibodies (1:200 dilution) overnight at 4°C in a humidified chamber. The color reaction was developed using DAB. Sections not subjected to the first antibody incubation were used as the background control. The staining results were evaluated by two researchers, and scored according to intensity as negative (−) if no immunolabeling was observed in target cells, weakly positive (+) if the labeling was faint, moderately positive (++) if the labeling was stronger, and strongly positive (+++) if the labeling was distinctly stronger than (++).14
Immunofluorescence
Cells were seeded on 24-well plates and incubated for 24 h, fixed using 4% paraformaldehyde solution for 15 min, and then permeabilized by 0.3% Triton X-100 for 30 min. The permeabilized cells were blocked with 2.5% bovine serum albumin for 1 h and then incubated with anti-CRABP2 or anti-FABP5 overnight at 4°C in the dark. Next, 10 mL of DAPI staining solution was added to the samples and a coverslip was gently placed on the DAPI staining solution, with no air bubble. Nail polish was used to fix the coverslip, and the images were acquired using a Leica Inverted MP microscope (Leica Microsystems, Wetzlar, Germany).
MTT assay
Cells were incubated in 96-well plates at a density of 1 × 104 per well. After 24 h, cells were treated with ATPR or ATRA for 24, 48, and 72 h. Then, the cells were incubated with 20 µL of 5 mg/mL MTT for 4 h at 37°C to evaluate cell proliferation. The medium was then discarded, and 150 µL of DMSO was added. After 15 min of incubation, absorbance at 490 nm was read using a microplate reader (Spectramax M2e; Molecular Devices LLC, Sunnyvale, CA, USA). Assays were repeated at least three times for each sample to determine cell proliferation.
siRNA silencing
RNA interference was used to knock down the expression of CRABP2 and FABP5. The sequences were 5′-GAAAUGGGAGAGUGAGAAUdTdT-3′ and 5′-AUUCUCACUCUCCCAUUUCdTdT-3′ for siRNA-CRABP2, and 5′-TGGGAAGGAAAGCACAATA-3′ for siRNA-FABP5. The siRNAs were transfected into MCF-7 cells using Lipofectamine 2000 according to the manufacturer’s protocol. Knockdown efficiency was determined by immunofluorescence.
Plasmid construction
Expression plasmids for CRABP2 and FABP5 were generated by amplifying cDNA encoding CRABP2 and FABP5 from the pancreas and inserting cDNA encoding CRABP2 and FABP5 into destination vectors. The following primers were used for amplification: forward: 5′-AAGCTTATGCCC AACTTCTCTGGCAACTGGAAAATCATCCGATCGGA AAACTTCGAGG-3′; reverse: 5′-GAATTCTCACTCTCGG ACGTAGACCCTGGTGCACACAACGTCATCCGCCGT CATGGTCA-3′ (CRABP2); forward: 5′-AAGCTTATGGCC ACAGTTCAGCAGCTGGAAGGAAGATGGCGCCTGGT GGAC-3′; reverse: 5′-GAATTCTTATTCTACTTTTTCAT AGATCCGAGTACAGGTGACATTGTTCAT-3′ (FABP5). Cell transfection was performed with Lipofectamine 2000 according to the manufacturer’s protocol.
Real-time cell analysis (RTCA)
Cells were seeded in two 8-well plates at a density of 5 × 103 per well with an integrated microelectronic sensor array in 200 µL of culture medium. After 24 h, cells were treated with ATPR at appropriate concentrations. Cell proliferation and survival were monitored in real time by measuring the cell-to-electrode responses of the seeded cells. The cell index was calculated for each E-plate well using RTCA Software 1.2 (Hoffman-La Roche Ltd., Basel, Switzerland). Graphs were generated in real time using the iCELLigence system.
Boyden chamber assay
In vitro invasion assays were performed using a 24-well Boyden chamber coated with Matrigel (BD, Franklin Lakes, NJ, USA). MDA-MB-231 cells were plated in the invasion chamber (1 × 105 cells per well). The lower chambers were filled with L15 containing 100 ng/mL EGF and 10% FBS. After 20 h, the cells remaining in the upper chamber were removed by scraping, and the cells that invaded through the Matrigel were fixed and stained using 0.5% crystal violet in methanol. All invading cells were counted by microscopic visualization. All analyses were performed in triplicate.
Wound healing assay
A wound healing assay was used to analyze cell migration. MDA-MB-231 cells were seeded into 24-well plates at 5 × 105 cells/well. A sterile micropipette tip was used to scratch the confluent monolayers in the shape of a straight line; the floating cells were washed with PBS three times. The cells were allowed to cover the wound for 48 h. Pictures of the same wound position were taken at the time of scratching and after 12, 24, and 48 h under a microscope.
Statistical analysis
Statistical analyses were performed using SPSS 11.5. All data were tested for normal distribution by Shapiro–Wilk normality test and for homogeneity of variance by Brown– Forsythe test. When the data were normally distributed and had similar variance, one-way ANOVA and unpaired Student’s t-test were performed to compare means among all measured variables. When ANOVA results were significant, multiple comparisons of means were applied with Tukey HSD post hoc analysis. When the data did not follow a normal distribution, nonparametric data were analyzed with Kruskal– Wallis (with pairwise Dunn’s method where applicable) and Mann–Whitney U tests. P < 0.05 was considered significant. Data are expressed as the mean ± SD.
Results
Expression of CRABP2 and FABP5 in breast tissue samples and cells
Immunohistochemistry and immunofluorescence analysis were used to detect the expression of CRABP2 and FABP5 in BC tissues and different BC cell lines (MCF-7, MDA-MB-231, MDA-MB-435, and MDA-MB-453 cells). The immunohistochemistry results showed that CRABP2 was expressed in both BC tissues and BBF tissues. FABP5 expression was positive or strongly positive in BC tissues, but was generally weakly positive or negative in BBF tissues (Figure 2A).
Figure 2
Expression of CRABP2 and FABP5 in breast cancer tissues and cells.
Notes: (A) Expression of CRABP2 and FABP5 in breast cancer and breast benign fibroma was detected by immunohistochemistry. The staining patterns were scored as negative (−) if no immunolabeling was observed, weakly positive (+) if the labeling was faint, moderately positive (++) if the labeling was stronger, and strongly positive (+++) if the labeling was distinctly stronger than (++). Representative images are shown at 100× objective. (B) Expression of CRABP2 and FABP5 in different breast cancer cells was detected by immunofluorescence. Representative images are shown at 200× objective.
The immunofluorescence results showed that in all BC cells, CRABP2 and FABP5 protein were primarily expressed in the cytoplasm, with some simultaneous co-expression in the nuclei and cytoplasm. However, the expression intensity was different in different cells: CRABP2 and FABP5 expression levels were highest in MCF-7 cells, followed by MDA-MB-453 cells, and the expression of these two proteins was relatively weak in MDA-MB-435 and MDA-MB-231 cells (Figure 2B).
Effect of ATPR on the proliferation of MCF-7, MDA-MB-231, MDA-MB-435, and MDA-MB-453 BC cells
To explore the relationship between the CRABP2/FABP5 ratio and the inhibitory effect on proliferation of ATPR in different BC cells, the MTT assay was used to observe the effect of various concentrations of ATPR (0.125, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 µmol/L) and ATRA (0.125, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 µmol/L) on the growth of four BC cell lines after 24, 48, and 72 h. As shown in Figure 3, the inhibitory effect of ATPR on proliferation was most pronounced in MCF-7 cells, and the effect increased as the drug concentration and treatment time increased. ATPR had weaker inhibitory effects on the proliferation of MDA-MB-231, MDA-MB-435, and MDA-MB-453 cells than on MCF-7 cells. These results all suggest that the inhibitory effect of ATPR on the proliferation of BC cells might be weakly correlated with the CRABP2/FABP5 ratio. Therefore, in the next study, we will evaluate the relationship between the anti-tumor effects of ATPR and the CRABP2 and FABP5 proteins individually.
Figure 3
Rate of inhibition of breast cancer cells treated with various concentrations of 4-amino-2-trifluoromethyl-phenyl retinate (ATPR) or all-trans retinoic acid (ATRA) for 24, 48, and 72 h (, n = 3). MCF-7, MDA-MB-231, MDA-MB-435, and MDA-MB-453 cells.
Effect of ATPR on the proliferation of MCF-7 cells after CRABP2 gene silencing
First, the correlation of CRABP2 expression and the inhibitory effect on proliferation of ATPR were explored. RNA interference was used to silence the CRABP2 gene in MCF-7 cells. Immunofluorescence staining showed that the expression of CRABP2 was significantly decreased in MCF-7 cells after siRNA treatment, indicating that RNA interference was successful (Figures 4A and S1). Next, the MTT assay was used to observe the sensitivity of MCF-7 cells to ATPR. MCF-7 cells were divided into siRNA(−), siRNA(+), and negative siRNA(+) groups. Each group was treated with ATPR (1 × 10−6 mol/L) for 24, 48, or 72 h and the differences in cell proliferation were observed. As shown in Figure 4B, CRABP2 silencing did not affect MCF-7 cell proliferation by itself (one-way ANOVA, P = 0.995). However, as the treatment time increased, ATPR decreased the proliferation rate of siRNA(−) and negative siRNA(+) cells significantly (P < 0.001). Compared to the CRABP2 siRNA(−) group, the inhibitory effect of ATPR on MCF-7 cells with silenced CRABP2 was significantly decreased (P < 0.001).
Figure 4
Effects of 4-amino-2-trifluoromethyl-phenyl retinate (ATPR) on proliferation of MCF-7 cells after silencing of CRABP2.
Notes: (A) Immunofluorescence staining on MCF-7 cells confirms significant reduction of CRABP2 expression in the CRABP2-siRNA group. Representative images obtained with a 200× objective. (B) An MTT assay was performed to evaluate transfected MCF-7 cells that were untreated or treated with 1 × 10−6 mol/L ATPR for 24, 48, and 72 h. *P < 0.05, ***P < 0.001. For 48 h, ATPR(−) siRNA(−) vs ATPR(+) siRNA (one-way ANOVA, P < 0.001), ATPR(+) negative siRNA(+) vs ATPR(+) CRABP2 siRNA(+) (one-way ANOVA, P = 0.048). For 72 h, ATPR(−) siRNA(−) vs ATPR(+) siRNA (one-way ANOVA, P < 0.001), ATPR(+) negative siRNA(+) vs ATPR(+) CRABP2 siRNA(+) (one-way ANOVA, P = 0.034).
Effect of ATPR on MDA-MB-231 cell proliferation after CRABP2 gene transfection
Previous studies showed that CRABP2 was expressed at a very low level in MDA-MB-231 cells, therefore we transfected plasmids into MDA-MB-231 cells to overexpress CRABP2 gene. Immunofluorescence results showed that after CRABP2 plasmid transfection, CRABP2 was stably expressed in MDA-MB-231 cells and its expression level was significantly increased compared with that in untransfected cells (Figures 5A and S2).
Figure 5
Effects of 4-amino-2-trifluoromethyl-phenyl retinate (ATPR) on the proliferation of MDA-MB-231 cells after overexpression of CRABP2.
Notes: (A) Immunofluorescence staining on MDA-MB-231 cells confirms significantly increased CRABP2 expression in the MDA-MB-231 (CP+) group. Representative images obtained using a 200× objective. (B) A real-time cell analysis was performed on transfected MDA-MB-231 cells that were untreated or treated with 1, 10, and 100 µM ATPR. CP−: cells untreated with CRABP2 transfection; CP+: cells treated with CRABP2 transfection.
Then, the RTCA system was used to determine the effect of CRABP2 overexpression on the ATPR-mediated inhibition of cell proliferation. As shown in Figure 5B, the untransfected cells had low sensitivity to ATPR. Additionally, ATPR (10 µM) had no inhibitory effect on cell proliferation, but ATPR with high concentration (100 µM) exhibited a significant inhibitory effect. The transfected cells had significantly high sensitivity to ATPR. An amount of 10 µM ATPR resulted in the stagnation of cell growth, whereas 100 µM ATPR resulted in significantly increased apoptosis or necrosis, and the effects were observed earlier. These results showed that ATPR inhibition of BC cells was closely related to CRABP2 protein expression. As CRABP2 protein expression increased, cell sensitivity to ATPR also increased.
Effect of ATPR on MCF-7 cell proliferation after FABP5 gene silencing
The correlation of FABP5 expression and the inhibitory effect on proliferation of ATPR was explored. RNA interference was used to silence the FABP5 gene in MCF-7 cells. Immunofluorescence staining showed that the protein expression of FABP5 was significantly decreased in MCF-7 cells after siRNA treatment (Figure 6A).
Figure 6
Effects of 4-amino-2-trifluoromethyl-phenyl retinate (ATPR) on proliferation of MCF-7 cells after silencing of the FABP5 gene.
Notes: (A) Immunofluorescence staining of MCF-7 cells confirms a significant reduction in FABP5 expression in the FABP5-siRNA group. Representative images were obtained using a 200× objective. (B) An MTT assay was performed on transfected MCF-7 cells that were untreated or treated with 1 × 10−6 mol/L ATPR for 24, 48, and 72 h. *P < 0.05. For 48 h, ATPR(−) siRNA(−) vs ATPR(+) siRNA(−) (one-way ANOVA, P = 0.012), ATPR(−) FABP5 siRNA(+) vs ATPR(+) FABP5 siRNA(+) (one-way ANOVA, P = 0.167), ATPR(−) siRNA(−) vs ATPR(−) FABP5 siRNA(+) (one-way ANOVA, P = 0.258). For 72 h, ATPR(−) siRNA(−) vs ATPR(+) siRNA(−) (one-way ANOVA, P = 0.018), ATPR(−) siRNA(−) vs ATPR(−) FABP5 siRNA(+) (one-way ANOVA, P = 0.019), ATPR(+) siRNA(−) vs ATPR(+) FABP5 siRNA(+) (one-way ANOVA, P = 0.943), ATPR(+) siRNA(−) and ATPR(+) FABP5 siRNA(+) (one-way ANOVA, P = 0.998). “NS” is not significant.
MCF-7 cells were divided into siRNA(−), siRNA(+), and negative siRNA(+) groups. Each group was treated with ATPR (1 × 10−6 mol/L) for 24, 48, or 72 h and differences were observed in cell proliferation. The cell proliferation of the untreated group was significantly decreased for 72 h after gene silencing compared to that of the siRNA(−) group (one-way ANOVA, P = 0.019), whereas the inhibitory effect of ATPR on MCF-7 cell proliferation was not significantly altered by FABP5 silencing (one-way ANOVA, P = 0.943) (Figure 6B).
Effect of ATPR on MDA-MB-231 cell proliferation after FABP5 gene transfection
Previous studies showed that FABP5 was also expressed at a very low level in MDA-MB-231 cells, therefore plasmids were transfected into MDA-MB-231 cells to overexpress FABP5. The immunofluorescence results showed that after FABP5 plasmid transfection, FABP5 was stably expressed in MDA-MB-231 cells and its expression level was significantly increased (Figure 7A).
Figure 7
Effects of 4-amino-2-trifluoromethyl-phenyl retinate (ATPR) on the proliferation of MDA-MB-231 cells after overexpression of FABP5.
Notes: (A) Immunofluorescence staining of MDA-MB-231 cells confirms significant increase in FABP5 expression in MDA-MB-231 (FL+) group. Representative images shown at 200× objective. (B) A real-time cell analysis performed on transfected MDA-MB-231 cells that were untreated or treated with 0.5 or 50 µM ATPR. FL−: cells untreated with FABP5 transfection; FL+: cells treated with FABP5 transfection.
The RTCA system was used to determine the effect of FABP5 on MDA-MB-231 cell proliferation and the effect of FABP5 overexpression on the ATPR-mediated inhibition of cell proliferation. Previous research showed that retinoic acid (RA) not only had no effect on the inhibition of cell proliferation in cell lines overexpressing FABP5, but it even promoted proliferation.15 As shown in Figure 7B, FABP5 plasmid transfection had no effect on cell proliferation in the absence of ATPR. In the ATPR-treated groups, a low concentration (0.5 µM) promoted MDA-MB-231 (FL+) cell proliferation to some extent, but a high concentration (50 µM) still had a significant inhibitory effect on proliferation of MDA-MB-231 (FL+) cells. The results indicated that the inhibitory effect of ATPR on cell proliferation did not depend on FABP5 expression.
Effect of ATPR on MDA-MB-231 cell invasion and migration ability after FABP5 gene transfection
Finally, the correlation of FABP5 expression and the effect of ATPR on metastasis was explored. MDA-MB-231 cells were divided into a control group (FL-siRNA-), FABP5-silenced group (FL-siRNA+), and FABP5-overexpression group (FL+siRNA−). Boyden chamber assay (Figure 8A) and wound healing assay (Figure 8B) showed that compared to the control group, the number of invasive and migrating cells in the FABP5-silenced group was significantly decreased (P < 0.001), and the number of invasive and migrating cells in the FABP5-overexpression group was significantly increased (P < 0.001). These results showed that FABP5 expression in BC cells was closely related to cell invasion and migration. As shown in Figure 8C, MDA-MB-231 cells incubated with 8 µmol/L ATPR for 48 h had a significant decrease in FABP5 expression compared to cells not treated with ATPR. The results suggest that ATPR might inhibit invasion and migration of BC cells by decreasing FABP5 protein expression.
Figure 8
Effects of 4-amino-2-trifluoromethyl-phenyl retinate (ATPR) on the invasion and migration of MDA-MB-231 cells after silencing and overexpression of FABP5.
Notes: (A) Boyden chamber assay. MDA-MB-231 cells – with FABP5 silenced or overexpressed – were plated in the invasion chamber. After 20 h, cells remaining in the upper chamber were removed and cells that invaded through the Matrigel were fixed and stained using 0.5% crystal violet in methanol, ***P < 0.001 vs FL−/siRNA− group. (B) Wound healing assay. MDA-MB-231 cells – with FABP5 silenced or overexpressed – were subjected to a wound assay and monitored for 48 h. FL−: cells untreated with FABP5 transfection; FL+: cells treated with FABP5 transfection. (C) Immunofluorescence staining of FABP5 expression after treatment with ATPR (8 µmol/L) for 48 h (200×). One-way ANOVA, ***P < 0.001 vs the non-ATPR intervention group.
Discussion
BC is a major health issue among women. RA and other retinoids significantly inhibit BC proliferation by inducing cell differentiation.16,17 ATPR is a new, patented retinoid and our laboratory has shown that it can inhibit the proliferation of ER-positive MCF-7 BC cells, inducing their gradual differentiation toward normal cells and stalling the cell cycle in the G0 /G1 phase,13 thereby exerting a significant anti-BC effect. In the present study, we investigated the inhibitory effect of ATPR on the proliferation of BC cells of different genotypes to determine the mechanisms of action. We found that ATPR significantly inhibited the proliferation of four BC cell lines, ie, MCF-7, MDA-MB-231, MDA-MB-435, and MDA-MB-453, and had particularly strong effects on MCF-7 cells with relatively high expression of CRABP2 or FABP5. Taking advantage of the different regulatory effects of RA depending on the FABP5/CRABP2 ratio,8 mechanistic studies showed that ATPR have a stronger inhibitory effect on BC cells with higher CRABP2 expression than on cells with low or no CRABP2 expression. In BC cells with high FABP5 expression, the inhibitory effect of ATPR on invasion and migration was greater than that in cells with low or no FABP5 expression. These results indicate that ATPR has excellent inhibitory effects on BC, especially malignant BCs with high invasion and migration. With respect to the mechanism of action, the two proteins CRABP2 and FABP5 are potential independent factors that should be evaluated in further studies.The sensitivity of tumor cells to retinoid compounds is closely related to the CRABP2/FABP5 ratio; however, many studies have focused on CRABP2 or FABP5 alone.18–21 We found that CRABP2 was expressed in both BC and BBF tissues, whereas FABP5 expression was moderate to high in BC tissues and weak or negative in BBF tissues. These findings show that enhanced FABP5 expression may contribute to tumor development. At the cellular level, the inhibitory effect of ATPR on the proliferation of ER-positive MCF-7 cells was significantly higher than that in the three ER-negative BC cell lines. Even more interestingly, CRABP2 and FABP5 protein expression levels were significantly higher in MCF-7 cells than in the three ER-negative BC cell lines. These results suggest that the inhibitory effect of ATPR, a novel RA analog, on the proliferation of BC cells may be weakly correlated with the CRABP2/FABP5 ratio.CRABP2 expression is relatively high in MCF-7 cells and relatively low in MDA-MB-231 cells. Therefore, we constructed MCF-7 cells in which the CRABP2 gene was silenced and MDA-MB-231 cells overexpressing CRABP2 to study the relationship between ATPR inhibition of BC cell proliferation and CRABP2 expression. Our results showed that after inhibition of CRABP2 protein expression in MCF-7 cells, the inhibitory effect of ATPR on cell proliferation was significantly decreased, whereas ATPR sensitivity was increased after enhancement of CRABP2 protein expression in MDA-MB-231 cells. Accordingly, CRABP2 is an essential factor for the inhibitory effects of ATPR on BC cell proliferation. These results are supported by Fu et al,4 who found that demethylation of CRABP2 in medulloblastoma to increase CRABP2 expression, caused cells that were initially resistant to RA to become sensitive to RA.Reports have shown that the resistance of tumor cell lines to retinoid compounds is primarily due to relatively high expression of FABP5.22 In the MCF-7 cells with silenced FABP5 constructed in this study, the untreated group had significantly lower cell proliferation 72 h after gene silencing than the siRNA(−) group, indirectly confirming this result. However, the inhibitory effect of ATPR on MCF-7 cell proliferation was not affected by FABP5 silencing, showing that the ATPR-mediated inhibition of cell proliferation may be unrelated to FABP5 expression. In MDA-MB-231 cells overexpressing FABP5, the inhibitory effect of ATPR on cell proliferation was also not significantly related to transfection with the FABP5 plasmid. These experimental results indicate that FABP5 does not directly affect BC cell proliferation, and the inhibition of cell proliferation by ATPR in MCF-7 may be primarily due to the regulation of CRABP2.Given these findings, what role does FABP5 have in the effect of ATPR on breast cancer cells? Previous studies have shown that FABP5 expression is significantly higher in BC tissues than in normal breast tissues. The FABP5/PPARδ signaling pathway can induce BC cell proliferation, migration, and invasion by activation of EGFR.23,24 The positive expression rate of FABP5 is higher in non-small cell lung cancer (NSCLC) than in normal tissues, and its expression in NSCLC primary tumor tissues is related to the pathological type of tumor and metastasis. FABP5 expression increases with increasing tumor size, development of metastasis, and progression to later clinical stages.25 These results all show that studies of FABP5 should concentrate on tumor cell invasion and migration. In the present study, the results of the Boyden chamber assay and the cell scratch assay confirmed that FABP5 is directly correlated with BC cell invasion and migration. At the same time, we observed that ATPR can reduce FABP5 expression in BC cells, suggesting that ATPR exerts inhibitory effects on BC cell invasion and migration by decreasing FABP5 expression.In summary, the results of this study show that ATPR has significant inhibitory effects on BC cell proliferation, invasion, and migration. These effects may not be directly related to the CRABP2/FABP5 ratio. The ATPR-mediated inhibition of cell proliferation depends on the regulation of CRABP2, and the inhibition of invasion and migration is related to the downregulation of FABP5. These results show that CRABP2 and FABP5 serve as independent factors underlying the mechanism of action of ATPR, and deeper mechanistic studies are in progress.MCF-7 cells transduced with CRABP2-shRNA574 plasmids decrease the protein levels of CRABP2 compared with cells transduced with control NC. The expression of CRABP2 was detected by Western blot analysis after transduction with control NC and CRABP2-shRNA574. Data were presented as mean ± SD. **P<0.01 versus NC group.MDA-MB-231 cells transduced with CRABP2 plasmids increase the protein levels of CRABP2 compared with cells transduced with control NC. The expression of CRABP2 was detected by Western blot analysis after transduction with control NC and CRABP2. Data were presented as mean ± SD. **P<0.01 versus NC group.
Authors: Susan Fischer-Huchzermeyer; Anna Dombrowski; Christian Hagel; Victor F Mautner; Jens Schittenhelm; Anja Harder Journal: Am J Pathol Date: 2017-05-11 Impact factor: 4.307
Authors: Rebecca L Siegel; Kimberly D Miller; Stacey A Fedewa; Dennis J Ahnen; Reinier G S Meester; Afsaneh Barzi; Ahmedin Jemal Journal: CA Cancer J Clin Date: 2017-03-01 Impact factor: 508.702