| Literature DB >> 29731490 |
Burak Dik1, Gonca Sonmez2, Hatice Eser Faki1, Emre Bahcivan3.
Abstract
The aim of this study, was to determine the effect of sulfasalazine for different periods of time reduces disseminated intravascular coagulation, inflammation and organ damages by inhibiting the nuclear factor kappa beta pathway. The study was performed with 30 Wistar albino rats and the groups were established as Control group, LPS group; endotoxemia was induced with LPS, SL5 group: sulfasalazine (300 mg/kg, single dose daily) was administered for 5 days before the LPS-induced endotoxemia, and LS group: sulfasalazine (300 mg/kg, single dose) was administered similtenously with LPS. Hemogram, biochemical, cytokine (IL-1β, IL-6, IL-10, TNF-α) and acute phase proteins (HPT, SAA, PGE2) analyzes and oxidative status values were measured from blood samples at 3 and 6 h after the last applications in the all groups. The rats were euthanized at 6 h and mRNA levels of BCL2 and BAX genes were examined from liver and brain tissues. Sulfasalazine reduced the increased IL-1β, IL-6, TNF-α and PGE2 levels and significantly increased anti-inflammatory cytokine IL-10 levels. In addition, decreasing of ATIII level was prevented in the SL5 group, and decreasing of fibrinogen levels were prevented in the LS and SL5 groups within first 3 h. In LPS group, leukocyte and thrombocyte levels were decreased, however sulfasalazine application inhibited decreases of leukocyte levels in LS and SL5 groups. In addition, sulfasalazine inhibited the decrease of total antioxidant capacity and unchanged apoptosis in brain and liver. In conclusion, the use of sulfasalazine in different durations reduce the excessive inflammation of endotoxemia cases.Entities:
Keywords: antioxidant capacity; cytokine; endotoxemia; oxidative status; sulfasalazine
Mesh:
Substances:
Year: 2018 PMID: 29731490 PMCID: PMC6219878 DOI: 10.1538/expanim.18-0029
Source DB: PubMed Journal: Exp Anim ISSN: 0007-5124
Sequences of oligonucleotide primers and base pair
| Gen | Sequences of oligonucleotide primers (5′- 3′) | Base Pair | Annealing Temperature (°C) | Accession |
|---|---|---|---|---|
| BAX_F | GAGAGGTCTTCTTCCGTGTG | 133 | 58 | NM_017059.2 |
| BAX_R | ATCAGCTCGGGCACTTTAG | |||
| BCL2_F | TGGTACCTGCAGCTTCTTTC | 131 | 58.3 | NM_016993.1 |
| BCL2_R | ATCTCCAGTATCCCACTCGTAG | |||
| YWHAZ_F | TTGTAGGAGCCCGTAGGTCA | 243 | 59.1 | NM_013011.3 |
| YWHAZ_R | CCTCAGCCAAGTAGCGGTAG |
The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes on the cytokines and acute phase proteins in LPS-induced endotoxemic rats (mean ± SEM).
| Parameters | Sampling Time | Control | LS | LPS | SL5 |
|---|---|---|---|---|---|
| TNF-α (pg/L) | 3 h | 30.05 ± 30.1b | 166.78 ± 41.8b | 1,156.78 ± 361.1a | 1,045.85 ± 286.1a |
| 6 h | 51.42 ± 21.7b | 60.20 ± 24.0b | 178.33 ± 34.4a | 37.85 ± 14.9b | |
| IL-1β (pg/L) | 3 h | 0b | 35.77 ± 8.5b | 165.22 ± 48.1a | 59.69 ± 30.6b |
| 6 h | 0b | 135.85 ± 28.6ab | 303.41 ± 95.7a | 134.95 ± 41.3ab | |
| IL-6 (pg/L) | 3 h | 3.11 ± 1.5b | 63.16 ± 13.1b | 150.79 ± 44.5a | 27.16 ± 14.6b |
| 6 h | 9.46 ± 9.5b | 83.99 ± 32.4b | 298.04 ± 60.4a | 178.20 ± 111.8ab | |
| IL-10 (pg/L) | 3 h | 7.24 ± 2.6b | 454.89 ± 84.8a | 160.65 ± 29.9b | 386.64 ± 81.8a |
| 6 h | 10.43 ± 4.2b | 942.17 ± 209.3a | 529.56 ± 167.9a | 921.42 ± 218.6a | |
| HPT (ng/L) | 3 h | 2.81 ± 2.4a | 14.64 ± 5.0a | 32.39 ± 7.0a | 27.67 ± 14.5a |
| 6 h | 3.25 ± 1.8b | 27.86 ± 5.7a | 30.88 ± 8.1a | 22.72 ± 9.4ab | |
| SAA ( | 3 h | 6.68 ± 0.6b | 13.03 ± 0.3ab | 12.98 ± 0.2ab | 12.42 ± 0.5a |
| 6 h | 6.21 ± 1.5b | 12.93 ± 0.6a | 13.01 ± 0.5a | 11.52 ± 1.0a | |
| PGE2 (pg/L) | 3 h | 85.61 ± 6.0c | 108.92 ± 16.6bc | 197.53 ± 37.3a | 159.20 ± 10.6ab |
| 6 h | 63.35 ± 4.5a | 75.76 ± 10.8a | 97.99 ± 11.6a | 82.88 ± 13.9a |
LS: sulfasalazine + lipopolysacchride simultaneously, LPS: Lipopolysaccharide, SL5: Prophylactic sulfasalazine + lipopolysaccharide. TNF-α: Tumor necrosis-α, IL-1β: Interleukin-1β, IL-6: Interleukin-6, IL-10: Interleukin-10, HPT: Haptoglobuline, SAA: Serum Amyloid A, PGE2: Prostaglandin E2. a, b, c:Different letters in the same line are statistically different (P<0.05).
Fig. 1.The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes on TBARS concentrations in LPS-induced endotoxemic rats (mean ± SEM).
Fig. 2.The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes on Total Antioxidant Capacity (TAC) concentrations in LPS-induced endotoxemic rats (mean ± SEM).
The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes on the clotting factors in LPS-induced endotoxemic rats (mean ± SEM)
| Parameters | Sampling Time | Control | LS | LPS | SL5 |
|---|---|---|---|---|---|
| Antithrombin III (%) | 3 h | 129.5 ± 10.2a | 95.4 ± 3.0b | 116.3 ± 6.3ab | 125.0 ± 9.2a |
| 6 h | 112.3 ± 17.0a | 61.8 ± 4.5bc | 57.5 ± 1.4c | 77.6 ± 15.0bc | |
| Fibrinogen (mg/dL) | 3 h | 540.9 ± 57.1a | 517.9 ± 28.0a | 365.5 ± 54.9b | 557.0 ± 48.7a |
| 6 h | 174.0 ± 21.0a | 219.7 ± 27.7a | 149.7 ± 9.9a | 174.8 ± 30.6a |
LS: sulfasalazine + lipopolysacchride simultaneously, LPS: Lipopolysaccharide, SL5: Prophylactic sulfasalazine + lipopolysaccharide. a, b, c: Different letters in the same line are statistically different (P<0.05).
The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes on the biochemical parameters in LPS-induced endotoxemic rats (mean ± SEM)
| Parameters | Sampling Time | Control | LS | LPS | SL5 |
|---|---|---|---|---|---|
| ALB (g/dL) | 3 h | 2.72 ± 0.1a | 2.78 ± 0.1a | 2.88 ± 0.1a | 2.48 ± 0.3a |
| 6 h | 2.41 ± 0.1bc | 2.43 ± 0.0bc | 2.60 ± 0.1b | 2.02 ± 0.1d | |
| ALT (U/L) | 3 h | 94.4 ± 4.9a | 58.4 ± 12.0b | 78.4 ± 6.6ab | 29.2 ± 5.7c |
| 6 h | 91.6 ± 6.1ab | 131.2 ± 16.5a | 106.8 ± 15.4ab | 73.6 ± 11.9b | |
| AST (U/L) | 3 h | 221.6 ± 19.0a | 264.4 ± 28.0a | 149.2 ± 10.7b | 141.2 ± 28.7b |
| 6 h | 282.2 ± 35.25a | 351.2 ± 23.6a | 197.3 ± 20.5a | 301.6 ± 70.9a | |
| ALP (U/L) | 3 h | 195.4 ± 21.4b | 223.8 ± 21.2b | 322.4 ± 65.6ab | 412.8 ± 92.6a |
| 6 h | 166.2 ± 11.4c | 221.4 ± 18.2c | 287.0 ± 40.7ab | 351.6 ± 67.9a | |
| CREA (mg/dL) | 3 h | 0.49 ± 0.02a | 0.51 ± 0.03a | 0.53 ± 0.01a | 0.52 ± 0.03a |
| 6 h | 0.45 ± 0.0c | 0.62 ± 0.0ab | 0.51 ± 0.0bc | 0.66 ± 0.0a | |
| BUN (mg/dL) | 3 h | 41.8 ± 2.37c | 52.8 ± 4.64b | 74.0 ± 2.17a | 66.4 ± 4.54a |
| 6 h | 37.3 ± 1.2b | 90.2 ± 4.9a | 101.2 ± 18.5a | 104.2 ± 10.5a | |
| T-BIL (mg/dL) | 3 h | 0.11 ± 0.0b | 0.27 ± 0.0a | 0.18 ± 0.0ab | 0.28 ± 0.1a |
| 6 h | 0.10 ± 0.0b | 0.12 ± 0.0ab | 0.16 ± 0.0ab | 0.18 ± 0.0a | |
| T-Prot (g/dL) | 3 h | 5.85 ± 0.2a | 5.38 ± 0.3ab | 5.56 ± 0.3ab | 5.02 ± 0.1b |
| 6 h | 5.05 ± 0.1a | 4.76 ± 0.1a | 4.92 ± 0.1a | 4.82 ± 0.2a |
LS: sulfasalazine + lipopolysacchride simultaneously, LPS: Lipopolysaccharide, SL5: Prophylactic sulfasalazine + lipopolysaccharide. ALB: Albumin, ALT: Alanine aminotransferase, AST: Aspartate aminotransferase, ALP: Alkaline phosphatase, CREA: Creatinine, BUN: Blood urea nitrogen, T-BIL: Total Bilirubin, TP: Total protein. a, b, c: Different letters in the same line are statistically different (P<0.05).
The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes on the hematology parameters in LPS-induced endotoxemic rats (mean ± SEM)
| Parameters | Sampling Time | Control | LS | LPS | SL5 |
|---|---|---|---|---|---|
| WBC (×109/L) | 3 h | 8.81 ± 0.9a | 7.79 ± 1.9a | 2.39 ± 0.3b | 9.90 ± 1.5a |
| 6 h | 11.29 ± 0.7a | 6.52 ± 0.8b | 1.67 ± 0.4c | 7.36 ± 1.1b | |
| RBC (×1012/L) | 3 h | 7.87 ± 0.2a | 8.24 ± 0.3a | 7.56 ± 0.2a | 7.74 ± 0.5a |
| 6 h | 8.19 ± 0.2a | 8.87 ± 0.3a | 7.98 ± 0.4a | 8.92 ± 0.5a | |
| PLT (×109/L) | 3 h | 896 ± 61.0a | 281 ± 45.3b | 499 ± 98.7b | 425 ± 123.2b |
| 6 h | 628 ± 115.5a | 376 ± 96.87a | 339 ± 73.41a | 465 ± 131.9a | |
| HGB (g/dL) | 3 h | 14.74 ± 0.6a | 15.35 ± 0.5a | 13.92 ± 0.5a | 14.28 ± 0.9a |
| 6 h | 10.80 ± 0.5a | 11.78 ± 0.5a | 10.58 ± 0.4a | 11.92 ± 0.6a |
LS: sulfasalazine + lipopolysacchride simultaneously, LPS: Lipopolysaccharide, SL5: Prophylactic sulfasalazine + lipopolysaccharide. WBC: White blood cell, RBC: Red blood cell, PLT: Platelet, HGB: Hemoglobin. a, b: Different letters in the same line are statistically different (P<0.05).
Fig. 3.The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes in liver BAX and BCL-2 expressions in LPS-induced endotoxemic rats (mean ± SEM).
Fig. 4.The effects of sulfasalazine (300 mg/kg, I.P.) for prophylactic and therapeutic purposes in brain BAX and BCL-2 expressions in LPS-induced endotoxemic rats (mean ± SEM).