Literature DB >> 29721087

Resveratrol counteracts bone loss via mitofilin-mediated osteogenic improvement of mesenchymal stem cells in senescence-accelerated mice.

Ya-Jie Lv1,2, Yi Yang1,3, Bing-Dong Sui1,4, Cheng-Hu Hu1,4, Pan Zhao1,4, Li Liao1,4, Ji Chen1, Li-Qiang Zhang1,4, Tong-Tao Yang5, Shao-Feng Zhang3, Yan Jin1,4.   

Abstract

Rational: Senescence of mesenchymal stem cells (MSCs) and the related functional decline of osteogenesis have emerged as the critical pathogenesis of osteoporosis in aging. Resveratrol (RESV), a small molecular compound that safely mimics the effects of dietary restriction, has been well documented to extend lifespan in lower organisms and improve health in aging rodents. However, whether RESV promotes function of senescent stem cells in alleviating age-related phenotypes remains largely unknown. Here, we intend to investigate whether RESV counteracts senescence-associated bone loss via osteogenic improvement of MSCs and the underlying mechanism.
Methods: MSCs derived from bone marrow (BMMSCs) and the bone-specific, senescence-accelerated, osteoblastogenesis/osteogenesis-defective mice (the SAMP6 strain) were used as experimental models. In vivo application of RESV was performed at 100 mg/kg intraperitoneally once every other day for 2 months, and in vitro application of RESV was performed at 10 μM. Bone mass, bone formation rates and osteogenic differentiation of BMMSCs were primarily evaluated. Metabolic statuses of BMMSCs and the mitochondrial activity, transcription and morphology were also examined. Mitofilin expression was assessed at both mRNA and protein levels, and short hairpin RNA (shRNA)-based gene knockdown was applied for mechanistic experiments.
Results: Chronic intermittent application of RESV enhances bone formation and counteracts accelerated bone loss, with RESV improving osteogenic differentiation of senescent BMMSCs. Furthermore, in rescuing osteogenic decline under BMMSC senescence, RESV restores cellular metabolism through mitochondrial functional recovery via facilitating mitochondrial autonomous gene transcription. Molecularly, in alleviating senescence-associated mitochondrial disorders of BMMSCs, particularly the mitochondrial morphological alterations, RESV upregulates Mitofilin, also known as inner membrane protein of mitochondria (Immt) or Mic60, which is the core component of the mitochondrial contact site and cristae organizing system (MICOS). Moreover, Mitofilin is revealed to be indispensable for mitochondrial homeostasis and osteogenesis of BMMSCs, and that insufficiency of Mitofilin leads to BMMSC senescence and bone loss. More importantly, Mitofilin mediates resveratrol-induced mitochondrial and osteogenic improvements of BMMSCs in senescence.
Conclusion: Our findings uncover osteogenic functional improvements of senescent MSCs as critical impacts in anti-osteoporotic practice of RESV, and unravel Mitofilin as a novel mechanism mediating RESV promotion on mitochondrial function in stem cell senescence.

Entities:  

Keywords:  Mitofilin/IMMT/Mic60; mesenchymal stem cells; osteogenesis; osteoporosis; resveratrol; senescence-accelerated mice

Mesh:

Substances:

Year:  2018        PMID: 29721087      PMCID: PMC5928897          DOI: 10.7150/thno.23620

Source DB:  PubMed          Journal:  Theranostics        ISSN: 1838-7640            Impact factor:   11.600


Introduction

Stem cell senescence and functional decline have emerged among the core features of aging, underlying deficient regenerative potential and lost tissue homeostasis in various organs/systems 1-3. Among these, the best characterized include age-related disorders of the skeletal system, where adult mesenchymal stem cells (MSCs) reside and mediate senile osteoporosis, which is attributed to their senescence-associated dysfunction, particularly the impairment of osteogenesis 4, 5. Currently, the most promising anti-aging strategy is dietary restriction, the effects of which can be safely mimicked by small molecules, such as resveratrol (RESV) 6-8. Conclusively, RESV has been documented to extend lifespan in lower organisms 9-11 and improve health of aging rodents against multiple alterations 12-14. However, although a pioneering report in a genetic progeroid model documenting that RESV replenishes the adult stem cell pool in bone 15, whether RESV rejuvenates the function of senescent stem cells in alleviating age-related phenotypes remains largely unknown, potentially contributing to the controversial or conditional findings regarding RESV effects on longevity of mammals 12, 16, 17. Specifically, despite preliminary reports on RESV protecting bone mass in a variety of pathological conditions 18-20, whether RESV improves osteogenesis of senescent MSCs and counteracts senescence-associated bone loss are not understood. Therefore, functional evidence of RESV impacts on senescent stem cells/MSCs is of great demand to further determine its translational potential in aging. RESV, also known as 3,5,4'-trihydroxystilbene, is basically a natural polyphenolic compound found in red wine and is well known for its phytoestrogenic and antioxidant properties, not surprisingly being applied originally in estrogen-deficient and oxidative bone deteriorations 21-23. Molecularly, RESV was further discovered as an activator of the protein deacetylase sirtuin1 (Sirt1), which modulates aging under nutrient control by metabolic regulation via peroxisome proliferator-activated receptor gamma coactivator-1 (Pgc-1) 9, 24. Accordingly, RESV has been shown effective in increasing Pgc-1 activity by decreasing Pgc-1 acetylation depending on Sirt1 13. Together with its promotion of the activity of another critical metabolic regulatory factor, the adenosine 5'-monophosphate-activated protein kinase (Ampk), RESV improves mitochondrial function and preserves metabolic homeostasis in a variety of experimental models 12, 13, 25. Notably, mitochondrial metabolic failure is also acknowledged as a vital hallmark of aging 26-28, and mitochondrial functional status crucially determines functional fate decisions of stem cells, including osteogenesis and senescence of MSCs 27-30. Hence, it would be safe to assume protective effects of RESV against senescence-associated osteogenic defects of MSCs through mitochondrial improvements in senile osteoporosis. In this study, to evaluate effects of RESV on stem cell function in aging, according to the above information and based our previous work basis, we selected bone marrow-derived MSCs (BMMSCs) as a model and analyzed their osteogenesis in close relation to bone formation in osteoporosis development and treatment 31-33. The bone-specific, senescence/bone loss-accelerated mice (the SAMP6 strain) were accordingly chosen, which develop a low turnover senile osteopenia primarily attributed to a defective osteoblastogenesis/osteogenesis without an elevated bone resorption or systemic alterations, making them the ideal experimental model for this study 34-37. We aimed to investigate: (1) Whether RESV rescues senescence-associated osteogenic decline of BMMSCs in ameliorating the accelerated bone loss in SAMP6 mice; and (2) whether and how RESV improves mitochondrial metabolism in improving senescent BMMSC osteogenesis. As expected, we proved that chronic intermittent application of RESV enhances bone formation and alleviates osteopenia in SAMP6 mice, with RESV promoting osteogenic differentiation of senescent BMMSCs through restoring mitochondrial function and autonomous gene transcription. Furthermore, in ameliorating senescence-associated mitochondrial disorders of BMMSCs, particularly the mitochondrial morphological alterations, we surprisingly discovered non-canonically that RESV upregulates Mitofilin, also known as inner membrane protein of mitochondria (Immt) or Mic60, the core component of the mitochondrial contact site and cristae organizing system (MICOS, or mitochondrial inner membrane organizing system, MINOS) 38, 39. We further revealed that insufficiency of Mitofilin is detrimental for mitochondrial stability and osteogenesis of BMMSCs as well as the bone homeostasis, and that Mitofilin mediates resveratrol-induced mitochondrial and osteogenic improvements of BMMSCs in senescence. Collectively, our findings uncover osteogenic functional improvements of senescent MSCs as critical impacts in anti-osteoporotic practice of RESV, and unravel Mitofilin as a novel mechanism mediating RESV promotion on mitochondrial function in stem cell senescence.

Methods

Animals

Animal experiments were approved by Fourth Military Medical University and were performed following the Guidelines of Intramural Animal Use and Care Committee of Fourth Military Medical University. For the bone-specific senescence-accelerated mouse model and its control 34, 37, female senescence-accelerated mice-prone 6 (SAMP6) and senescence-accelerated mice-resistant 1 (SAMR1) strains at 4-6 month of age (weight, 20-22 g) were used, which were AKR/J background and were obtained from our colony provided by the Council for SAM Research of Kyoto University, Japan. According to previous works by us and others, SAMP6 mice at this age develop accelerated bone loss with senescence-associated osteogenic decline of BMMSCs, while SAMR1 mice demonstrate normal phenotypes 32, 40. In detail, for in vivo experiments of RESV and shImmt treatments, mice received interventions started at 4 months of age and were sacrificed after a 2-month experimental period. Alternatively, for ex vivo experiments on BMMSCs, 4 month-old mice were sacrificed for bone marrow sampling. For BMMSCs from the natural aging model, female C3H mice 22 months old were used for bone marrow sampling with the 4-month-old young control. The mice were maintained with good ventilation and a 12 h light/dark cycle, and were kept with feeding and drinking ad libitum before being sacrificed.

Isolation and culture of BMMSCs

Isolation and culture of murine BMMSCs were according to our previous protocol 41, 42. Briefly, bone marrow cells were sampled from the hindlimbs of mice and were seeded for incubation overnight at 37 ℃ in a humidified atmosphere of 5% CO2. The non-adherent cells were then removed by rinsing with PBS, while the adherent cells were cultured with alpha-minimum essential medium supplemented with 20% fetal bovine serum, 2 mM L-glutamine, 100 U/mL penicillin, and 100 g/mL streptomycin (all from Invitrogen, USA) at 37 ℃ in a humidified atmosphere of 5% CO2. The media were changed every 2 days, and primary MSC colonies were passaged with 0.25% trypsin. The passaged BMMSCs were then seeded into culture plates for further experimental tests.

RESV preparation and in vivo experimental designs

RESV used in this study was purchased from Sigma-Aldrich (Sigma-Aldrich, USA) 8. For in vivo treatments, RESV was firstly dissolved in dimethyl sulfoxide (DMSO) 43 at 200 mg/mL, and was then diluted with saline to 10 mg/mL (containing 5% DMSO). For in vitro treatments, RESV was firstly dissolved in DMSO 43 at 1 M, and was then diluted with media to 1 mM (containing 0.1% DMSO). In vitro working solution was set at 10 μM according to previous dose-determining papers on osteogenic promotion in young MSCs 44-46. Equal amount of DMSO was applied into culture media as the control at a final concentration of 0.001%. RESV for in vivo application was injected at 100 mg/kg intraperitoneally via the right lower quadrant of the abdominal area with mice in a head-down position, once every other day for 2 months. Control groups were injected intraperitoneally with an equal amount of 5% DMSO in saline solvent. The dosage was chosen based on previous documents and our preliminary tests below the potential highest dose not to induce obvious systemic alterations, and reports applying this dosage to affect stem cell activity in response to chemical injury in vivo 47, 48. The application route was selected considering the better control of applied dose by intraperitoneal injection over feeding for a proof-of-concept study (instead of a preclinical study), and the reported efficacy of mitochondrial intervention by intraperitoneal injection of RESV 49. The experimental duration was determined given the time needed for chronic changes of bone mass by bone remodeling according to our observations 50. The method of chronic intermittent application every other day was based on previous reports on feeding-based RESV delaying age-related deterioration in mice 16. As the recipients of RESV administration, littermate SAMR1 and SAMP6 mice were randomly allocated into 8 groups, i.e., 4 groups of each strain: (1) the SAMR1 4-month control group (n = 5), (2) the SAMR1 6-month control group (n = 5), (3) the SAMR1+DMSO group (started at 4 months old and sacrificed at 6 months old) (n = 4), and (4) the SAMR1+RESV group (started at 4 months old and sacrificed at 6 months old) (n = 4), (5) the SAMP6 4-month control group (n = 5), (6) the SAMP6 6-month control group (n = 5), (7) the SAMP6+DMSO group (started at 4 months old and sacrificed at 6 months old) (n = 4), and (8) the SAMP6+RESV group (started at 4 months old and sacrificed at 6 months old) (n = 5).

Lentivirus-based gene knockdown experiments

Lentiviral vector construction and transfection were performed according to a previous protocol 31, 51. Mouse Immt (Mitofilin) was amplified by polymerase chain reaction from genomic DNA with targeting sequences for short hairpin RNA (shRNA) as denoted below. Forward: 5'- CCGGCCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGGTTTTTG -3'; Reverse: 5'- AATTCAAAAACCGTCCTTACACTGCTATCATCTCGAGATGATAGCAGTGTAAGGACGG -3'. The PCR product was digested with restriction enzymes AgeI and EcoRI, inserted into the pLKO.1 vector (Invitrogen, USA), and verified by Sanger sequencing. Negative control (NC) was performed with a lentiviral construct containing a scrambled sequence. The lentivirus constructs were then produced by co-transfecting 293T cells with a transfer vector and two packaging vectors, psPAX2 and pMD2.G. After transfection for 48 h, media containing virus were collected and the virus was purified by centrifugation at 500 rcf for 10 min followed by filtering through 0.45 μm polyethersulfone low protein-binding filters. For in vitro experiments, 1st-passaged BMMSCs plated in 6-well plates were transfected with constructs for either NC or shRNA for Immt (shImmt) (titer > 5×105 IFU/mL) and 10 μg/mL polybrene (Sigma-Aldrich, USA) for 48 h. Transfected BMMSCs were then evaluated for function and the expression of Immt was examined at both mRNA and protein levels as described below. For in vivo experiments, intra-femoral bone marrow injection of lentiviral constructs was performed following published procedure 52. Littermate SAMR1 mice (n = 3) were used, and the left femora were designed for NC injection while the right femora for shImmt. Briefly, mice were anesthetized with 1% pentobarbital sodium (5 μL/g body weight) and the hairs around the knee joint were shaved off. The joint was inflexed and a sterile scalpel blade was used to make a small deep incision along one side of the knee joint. The kneecap was then exposed by sterile forceps without damaging any blood vessels. A needle of a 1 mL syringe was used to gently drill a hole through the groove of the kneecap in the femur about 0.5 cm deep. 20 μL lentiviral suspension (2×106 IFU/μL) containing either NC or shImmt was injected through the hole gently with a Hamilton syringe (Hamilton, Bonaduz, Switzerland). After removing the needle, the hole was immediately closed with bone wax using a sterile scalpel blade. Finally, the surgical area was washed with PBS and the wound was closed with an appropriate suture.

Micro-computed tomography (micro-CT) analysis

Trabecular bone mass evaluation by micro-CT analysis was performed based on our previous reports 41, 42, 53. Briefly, at sacrifice, the left femora were removed, fixed overnight in 4% paraformaldehyde, and prepared into 1 mm blocks with the distal metaphysis included. The specimens were then scanned at a resolution of 8 μm, a voltage of 80 kV, and a current of 80 μA by a desktop micro-CT system (eXplore Locus SP; GE Healthcare, USA). After image reconstruction, quantification was performed at a region-of-interest in the distal metaphysis, from 0.3 mm to 0.8 mm away from the epiphysis. Data were analyzed using parameters of bone volume over tissue volume (BV/TV) and bone mineral density (BMD) with the Micview V2.1.2 software 54.

Calcein labeling assay

For bone histomorphometric analysis on bone formation rates, double-time calcein labeling was performed according to previous studies 53, 55. At 16 days and 2 days prior to sacrifice, mice received intraperitoneal injections of 20 mg/kg calcein (Sigma-Aldrich, USA) dissolved at 2 mg/mL in PBS supplemented with 1 mg/mL NaHCO3 (Sigma-Aldrich, USA). Calcein was injected at 10 μL/g each time away from light via the right lower quadrant of the abdominal area with mice in a head-down position. At sacrifice, the right femora were isolated, fixed in 80% ethanol, embedded in methyl methacrylate, and sagittally sectioned into 30 μm slices using a hard tissue slicing machine (SP1600; Leica, Germany) away from light. Cortical endosteum surfaces were evaluated by a fluorescence microscope (STP6000; Leica, Germany) with an excitation wavelength of 488 nm. Quantification was performed using the parameters of mineral apposition rate (MAR) and bone formation rate (BFR) by the ImageJ 1.47 software and the related calculation 56.

Functional evaluation of BMMSCs

For osteogenic differentiation analysis 57, BMMSCs at the 1st passage in 6-well plates were induced in normal culture media supplemented with 100 μg/mL ascorbic acid (MP Biomedicals, USA), 2 mM β-glycerophosphate (Sigma-Aldrich, USA) and 10 nM dexamethasone (Sigma-Aldrich, USA). The media were changed every 3 days. After induction for 7 days, alkaline phosphotase (ALP) staining was performed using the BCIP/NBT ALP color development kit (Beyotime, China) and the quantification was determined with the ImageJ 1.47 software based on grey values, while ALP activity was determined using the ALP (AKP/ALP) detection kit (BioVision, USA) 55. After induction for 14 days, alizarin red staining was performed to determine the mineralization status. Quantitative parameters of number of mineralized nodules and the percentage of mineralized area were determined with the ImageJ 1.47 software 32. To determine cell senescence, senescence-associated beta-galactosidase (SA-β-gal) activity was evaluated in the 1st-passaged BMMSCs in 12-well plates using the SA-β-gal Staining Kit (Beyotime, China), according to the manufacturer's instructions. The percentage of SA-β-gal positive cells was determined using the ImageJ 1.47 software 32. For the colony-forming assay, after treatment with ACK lysis buffer (Lonza, Basel, Switzerland) to remove red blood cells, murine primary bone marrow cells were plated in 5 cm culture dishes at a density of 1×105 cells/cm2 and cultured in normal media. The formation of colonies was evaluated after 14 days of culture after fixation with 4% paraformaldehyde for 30 min and stained with crystal violet for 5 min 43. For proliferation analysis, BMMSCs at the 1st passage were plated at 2×103 cells/well in 96-well plates. Cell viability at indicated time points was determined by incubation with 20 μL 5 mg/mL methyl thiazolyl tetrazolium (MTT) (MP Biomedicals, USA) for 4 h. The precipitates were extracted with 180 μL DMSO and the absorbance was measured at 490 nm 58. Cell cycle analysis was performed after obtaining single cell suspensions of 1st-passaged BMMSCs, and the cells were fixed in ice-cold 75% ethanol at 4 ℃ overnight, washed twice with PBS, and stained with 100 mg/mL propidium iodide (Sigma-Aldrich, USA) at 4 ℃ for 30 min at dark. The stained BMMSCs were then subjected to cell cycle analysis using a flow cytometer (CytoFLEX; Beckman Coulter, USA) and the percentages of cells in the S-phase were determined with the CXP 2.1 software 59.

Metabolic analysis

The ratio of adenosine triphosphate (ATP) over adenosine diphosphate (ADP) was measured according to recent papers using the ADP/ATP Ratio Assay Kit (Abcam, UK) following the manufacturer's instructions 60. BMMSCs were evaluated at 48 h post to RESV or DMSO treatments and shImmt or NC transfection. ATP and ADP levels were determined by measuring luminescence in the absence or presence of ADP-converting enzyme using a luminometer (Tecan, Switzerland) and the ATP/ADP ratio was then calculated. Total intracellular reactive oxygen species (ROS) contents of BMMSCs was measured using the fluorescent probe 2',7'-dichlorofluorescin diacetate (DCFDA) 31. Briefly, 25 mM DCFDA was added to BMMSCs at 48 h post RESV or DMSO treatments and shImmt or NC transfection, and was incubated for an additional 30 min at 37 ℃. After washing with PBS twice to eliminate the unlabeled DCFDA, BMMSCs were examined under a fluorescence microscope (Olympus, Japan) with excitation at 488 nm. For quantification of ROS, BMMSCs were then digested and measured using the flow cytometer (CytoFLEX; Beckman Coulter, USA) with the CXP 2.1 software. Mitochondrial membrane potential (Ψm) of BMMSCs was measured using the fluorescent probe Rhodamine 123 61. Briefly, 0.4 M Rhodamine 123 was added to BMMSCs at 48 h post RESV or DMSO treatments and shImmt or NC transfection, and was incubated for 15 min at 37 ℃. After washing with PBS twice, BMMSCs were examined under a fluorescence microscope (Olympus, Japan) and the fluorescence signal was measured using the Synergy™ H1 Hybrid Multi-Mode Reader (BioTek, USA) at 490/535 nm. The transmembrane distribution of the Rhodamine 123 is proportional to the strength of Ψm. Mitochondrial oxidative phosphorylation (OXPHOS) activity was measured using Mito-ID® O2 Extracellular Sensor Kit (Enzo Life Sciences, USA) according to the manufacturer's protocol, in which oxygen consumption is detected based on a fluorescent probe 62. Briefly, 10 μL probe was added to BMMSCs at 48 h post RESV or DMSO treatments, and was read immediately using the Synergy™ H1 Hybrid Multi-Mode Reader (BioTek, USA) at 380/650 nm kinetically for 90 minutes, at an interval of 1 minute. The mean value of fluorescence intensity of 3 wells/group was determined for the oxygen consumption curves.

Transmission electron microscopy (TEM) analysis

TEM observation of BMMSC mitochondria was performed accordingly at 48 h post RESV or DMSO treatments and shImmt or NC transfection 63. Briefly, 1×106 BMMSCs were digested, washed with PBS 3 times and fixed by 1% osmic acid at 4 ℃ for 2 h. After dehydration in ethanol, embedding in resin and solidifying, ultrathin sections at 70 nm were obtained using an ultramicrotome (CM3050; Leica, Germany). The slices were then stained with 3% uranyl acetate and citric acid, and were viewed by a transmission electron microscope (JEM-1230; JEOL, Japan). Mitochondrial parameters were quantified by measuring the mitochondrial number and area in random cells using Adobe Photoshop software. The ratio of mitochondrial inner membrane (IM) over outer membrane (OM) (IM:OM ratio) was determined using ImageJ 1.47 software by tracing and quantitating the membrane profiles in transmission electron microscopy images, as stated 64.

Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

Total RNA was collected from the 1st-passaged BMMSCs during osteogenic induction or at 48 h post RESV or DMSO treatments and shImmt or NC transfection. RNA was extracted by adding Trizol Reagent (Takara, Japan) to the culture plates and was purified by phenol-chloroform extraction. cDNA synthesis and PCR procedures were performed as previously described 8, 32. The primer sequences of the mouse genes detected in this study are listed in the Supplementary material (Table ). Relative expression level of each gene was obtained by normalizing against β-actin abundance.

Immunoprecipitation (IP)

Pgc-1 acetylation was analyzed after IP of Pgc-1 by an acetyl-lysine (Ac-Lys) antibody (Cell Signaling, USA) according to previous methods 13, 24. Briefly, IP of Pgc-1 was performed in nuclear lysates from BMMSCs at 48 h post RESV or DMSO treatments. Nuclear extracts were incubated with a rabbit anti-Pgc-1 antibody (Santa Cruz Biotechnology, USA) or the control IgG at concentrations of 1:50 for 2 h on a rocking platform at 4 ℃. Protein A/G (Merke Millipore, USA) was then added and incubated at 4 ℃ overnight. The beads were treated with RIPA buffer and the protein was collected from the supernatant for western blot analysis, as described below.

Western blot analysis

Western blot was performed as previously described 8, 65. Total protein samples were collected from the 1st-passaged BMMSCs during osteogenic induction or at 48 h post RESV or DMSO treatments and shImmt or NC transfection. Cell lysates were prepared using the RIPA Buffer (Beyotime, China), and the protein was extracted by centrifuging at 13000 rcf for 15 min at 4 ℃. Protein samples were then loaded on sodium dodecyl sulfate-polyacrylamide gels, transferred to polyvinylidene fluoride membranes (Millipore, USA), and blocked with 5% bovine serum antigen (Sigma-Aldrich, USA) in PBS with 0.1% Tween for 2 h at room temperature. The membranes were incubated overnight at 4 ℃ with the following anti-mouse primary antibodies: for Alp, Pgc-1, runt-related transcription factor 2 (Runx2) (all from Santa Cruz Biotechnology, USA) at a concentration of 1:1000; for Immt (Mitofilin), osteocalcin (Ocn), p16INK4α, p21 (all from Abcam, USA) at a concentration of 1:1000; for p-Ampk, Ampk, acetylated p53 (Ac-p53), Ac-Lys (all from Cell Signaling, USA) at a concentration of 1:1000; and for β-actin (Abcam, USA) at a concentration of 1:4000. The membranes were then incubated with peroxidase-conjugated secondary antibodies (Boster, China) at a concentration of 1:40000 for 1 h at room temperature. The blotted bands were visualized using an enhanced chemiluminescence kit (Amersham Biosciences, USA) and a gel imaging system (5500; Tanon, China). The gray values of the bands were analyzed using the ImageJ 1.47 software.

Statistical analysis

Data are represented as the mean ± standard deviation (SD). Statistical significance was evaluated by two-tailed Student's t test for two-group comparison, or by one-way analysis of variation (ANOVA) followed by Newman-Keuls post-hoc tests for multiple comparisons in the GraphPad Prism 5.01 software. Values of P < 0.05 were considered statistically significant.

Results

RESV enhances bone formation and counteracts accelerated bone loss in SAMP6 mice

To investigate whether RESV improves osteogenesis of senescent MSCs in ameliorating osteoporosis, we applied the bone-specific, senescence-accelerated, osteoblastogenesis/osteogenesis-defective SAMP6 mice 34-37, together with the SAMR1 control. We confirmed that while 4-month-old SAMP6 mice demonstrated lower peak bone mass compared to age-matched SAMR1 mice, 6-month-old SAMP6 mice showed more severe bone loss, while SAMR1 mice maintained bone mass in the 2-month period (Figure ). These results verified the characteristics of accelerated bone loss in SAMP6 mice even at a relatively young age. We further discovered that the accelerated bone loss in SAMP6 mice was indeed attributed to a defective bone formation, which at least occurred at as early as 4 months of age and continued to 6 months of age (Figure ). Therefore, these experimental models are appropriate to be used in the current study. As a proof-of-concept study, we applied RESV intraperitoneally once every 2 days within the 2-month experimental period, and RESV effects on both SAMP6 and SAMR1 mice were evaluated to understand whether the potential impacts are senescence-dependent or not. Micro-CT data demonstrated that while RESV administered following this method was not effective in further promoting bone mass in SAMR1 mice, chronic intermittent application of RESV indeed significantly retarded the accelerated trabecular bone loss in SAMP6 mice (Figure ), as quantified by the indexes BV/TV (Figure ) and BMD (Figure ). Importantly, RESV-treated SAMP6 mice at 6 months of age demonstrated paralleled, or slightly higher but not significant, trabecular bone mass compared to the 4-month-old SAMP6 mice, resulting in still lower, but not significant, trabecular bone mass compared to age-matched RESV-treated SAMR1 mice (Figure ). Further analysis by calcein labeling illustrated that RESV ameliorated the impairment in bone formation of SAMP6 mice (Figure ), as shown by the MAR (Figure ) and BFR (Figure ) quantification. Also, the bone formation of SAMP6 mice after RESV treatments exhibited a still lower, but not significant, rate compared to age-matched RESV-treated SAMR1 mice, while RESV was not effective in further promoting bone formation in SAMR1 mice (Figure ). Collectively, these data suggested that RESV enhances bone formation and counteracts accelerated bone loss in SAMP6 mice.

RESV improves osteogenic differentiation of senescent BMMSCs

It has been recognized that BMMSCs are putatively responsible for postnatal bone homeostasis and regeneration 5, 66, and that osteogenic decline of BMMSCs is critical for osteoporosis with advanced age 4, 29. To directly evaluate osteogenic changes of BMMSCs upon RESV treatment, we isolated BMMSCs from 4-month-old SAMP6 and SAMR1 mice. As exhibited, BMMSCs from SAMP6 mice at this age already demonstrated the typical cell senescent phenotypes ex vivo, with a higher SA-β-gal positive cell percentage (Figure ), a weaker colony-forming capability, a lower cell percentage in the S-phase of the cell cycle (Figure ), and a decreased proliferation rate (Figure ). Importantly, these cells were dramatically defective in osteogenic differentiation, as quantified by less than half of the ALP activity (Figure ) and mineralization capability (Figure ) during osteogenic induction compared to their SAMR1 counterparts, underlying the impaired osteoblastogenesis in vivo. Notably, RESV treatments substantially rescued the osteogenic decline of BMMSCs from SAMP6 mice (Figure ), as confirmed also by it promoting the expression of osteogenic marker genes Runx2 and Ocn 67 at both mRNA (Figure ) and protein (Figure ) levels. RESV improvements on osteogenesis of senescent BMMSCs were further verified in naturally aged BMMSCs. As shown, BMMSCs derived from 22-month-old naturally aged mice also demonstrated an increased SA-β-gal positive percentage (Figure ) with a decreased proliferation rate (Figure ). Furthermore, the naturally aged BMMSCs were impaired in ALP activity (Figure ) and mineralization capability (Figure ) during osteogenic differentiation. Importantly, RESV treatments in vitro could remarkably rescue the osteogenic impairment (Figure ). Taken together, these data suggested that RESV improves osteogenic differentiation of senescent BMMSCs.

RESV ameliorates mitochondrial functional and transcriptional disorders in BMMSC senescence

In identifying the underlying reason for RESV protection against osteogenic decline of senescent BMMSCs, it should be noticed that metabolic compromise is proposed to be an important mechanism underlying senescence of stem cells including BMMSCs 28, 29, and that mitochondrial improvements serve as one of the most prominent RESV influences 13, 68. Accordingly, we evaluated the effects of RESV on the metabolic profiles of senescent BMMSCs and the related mitochondrial changes. As expected, we discovered that BMMSCs from SAMP6 mice demonstrated >50% reduction in ATP production versus ADP contents compared to those from SAMR1 mice, which could be rescued by RESV treatments (Figure ). Furthermore, SAMP6 BMMSCs also suffered from oxidative stress, as shown by DCFDA fluorescence (Figure ) and flow cytometric quantification (Figure ) confirming an increase in the total cellular ROS level. Notably, the oxidative stress of SAMP6 BMMSCs was also significantly ameliorated by RESV (Figure ). These metabolic changes of SAMP6 BMMSCs after RESV treatments could be attributed to mitochondrial contributions. As shown by Rhodamine 123 detection of mitochondrial membrane potential (Figure ) and its quantification (Figure ), BMMSCs derived from SAMP6 mice demonstrated impaired mitochondrial membrane potential, which was restored by RESV treatments. Importantly, RESV also restored the suppressed OXPHOS activity of senescent BMMSCs, as analyzed by the oxygen consumption in culture (Figure ), indicating mitochondrial functional improvements underlie the alleviation of metabolic disorders. To further examine whether the improved OXPHOS activity was due to recovery of impaired mitochondrial OXPHOS electron transport chain (ETC) complexes, considering that the complex subunits are encoded by either the nuclear genome or the mitochondrial DNA (mtDNA) 69, 70, we separately investigated expression levels of genes of these 2 categories to see whether RESV facilitated mitochondrial non-autonomous and/or autonomous recovery. Gene representatives encoding subunits of each of the 5 ETC complexes were selected for analysis accordingly 26. Results showed that despite downregulation of nuclear-encoded mitochondrial genes for complex I, II and ATP synthase in BMMSCs from SAMP6 mice, RESV was not effective in rescuing this decline (Figure ). Alternatively, RESV restored expression levels of most mtDNA-encoded genes in BMMSC senescence, leading to substantial recovery, particularly in complex I and III, but also in certain subunits of complex IV and ATP synthase (Figure and Figure ). These data collectively suggested that RESV ameliorates mitochondrial functional and transcriptional disorders in BMMSC senescence.

RESV upregulates Mitofilin in alleviating senescence-associated mitochondrial morphological alterations of BMMSCs

Next, we intended to figure out how RESV improved mitochondria in senescent BMMSCs. Currently, Ampk and Sirt1/Pgc-1 pathways are known to be primary targets mediating RESV direction of mitochondrial metabolism 12, 13. Nevertheless, unexpectedly, although RESV indeed stimulated Ampk and Pgc-1 activities in BMMSCs from SAMP6 mice, as demonstrated by increased Ampk phosphorylation (Figure ) and a decreased Pgc-1 acetylation (Figure ), effects of RESV between SAMR1 and SAMP6 BMMSCs were equally efficient, as shown by RESV induction of comparable changes of these signaling proteins in BMMSCs from SAMR1 mice (Figure ). Thus, while activation of Ampk and Pgc-1 pathways might still participate in RESV effects on BMMSCs, there were probably more specific mechanisms in the senescent situation, considering the profound alleviation of skeletal deficiency specifically in SAMP6 mice in vivo (Figure ). Correspondingly, Pgc-1 downstream transcripttional factors regulating mitochondrial metabolism 71 showed a different tendency in RESV-treated BMMSCs from SAMR1 and SAMP6 mice; in particular, they were not restored by RESV in BMMSC senescence (Figure ). These results indicated that RESV improves mitochondria in senescent BMMSCs potentially through non-canonical pathways. To elucidate how RESV restored mtDNA transcription and mitochondrial metabolism in SAMP6 BMMSCs, we decided to observe in detail the ultrastructural morphology of mitochondria, hoping to gather some information to help us decipher what changes occurred. Surprisingly, we found that, compared to BMMSCs from SAMR1 mice, BMMSCs from SAMP6 mice did not increase mitochondria quantity, but instead possessed larger and swollen mitochondria, with remarkably increased IM:OM ratio (Figure ). Interestingly, RESV treatments in SAMP6 BMMSCs rescued this altered mitochondrial morphology, indicating that the development and RESV-directed amelioration of mitochondrial compromise in BMMSC senescence were based on modulation of the morphological stability. Given the changes in relative area of mitochondrial IM versus OM, we next investigated outer membrane protein representatives (mainly mitochondrial dynamic regulators 72, 73) and inner membrane protein representatives (primarily modulators of organization of cristae where the OXPHOS ETC exists 74, 75) reported to regulate mitochondrial morphology. Data demonstrated that while RESV ameliorated expression decline of a fission-related gene encoding dynamin-related protein 1 (Drp1) in BMMSCs from SAMP6 mice, the mitochondrial outer membrane proteins were largely not influenced by RESV (Figure ). On the other hand, we discovered that mRNA expression of the Immt gene, which encodes the inner membrane protein Mitofilin/Mic60, the core component of MICOS 38, 39, was significantly downregulated in senescent BMMSCs and was restored by RESV application (Figure ). The promotion of Mitofilin by RESV in BMMSCs from SAMP6 mice was further confirmed at the protein expression level (Figure ). These data suggested that RESV upregulates Mitofilin in alleviating senescence-associated mitochondrial morphological alterations of BMMSCs. To further establish a rationale to investigate the roles of Mitofilin in mitochondrial and osteogenic function of BMMSCs in senescence, we examined whether Mitofilin participates in osteogenesis of BMMSCs and, more importantly, if it serves as a covariant factor in declined osteogenesis of SAMP6 BMMSCs. As analyzed by osteogenic induction, both mRNA and protein expression levels of the Immt gene (Mitofilin) gradually increased with advancing osteogenic time, while its expression in BMMSCs from SAMP6 mice was lower at each time point compared to BMMSCs from SAMR1 mice (Figure ), indicating a close relationship between Mitofilin and the osteogenic capability of BMMSCs in differentiation and in senescence-associated decline. Therefore, Mitofilin was selected afterwards for mechanistic experiments.

Mitofilin is required for mitochondrial homeostasis and osteogenesis of BMMSCs

The above clues prompted us to clarify the function of Mitofilin in modulating mitochondrial and osteogenic phenotypes of BMMSCs. Accordingly, we knocked down expression of the Immt gene using shRNA (Figure ). As expected, knockdown of Immt in BMMSCs from SAMR1 mice induced giant mitochondria (Figure ) with increased IM:OM ratio (Figure ) and average area (Figure ), but without changing the mitochondrial number (Figure ). Importantly, BMMSCs deficient for Mitofilin developed impaired mitochondrial membrane potential (Figure ) and cellular metabolic disorders involving increased total ROS (Figure ) but less ATP production (Figure ). Furthermore, Immt knockdown generally suppressed mtDNA transcripttion (Figure ), while the genes for nuclear-encoded mitochondrial complex subunits remained uninfluenced (Figure ). These results indicated that Mitofilin indeed regulates mitochondrial stability of BMMSCs via facilitating mitochondrial autonomous gene transcription. With regard to the functional phenotypes of BMMSCs after Immt knockdown, interestingly, we discovered that Mitofilin deficiency in BMMSCs from SAMR1 mice mimicked senescent phenotypes observed in BMMSCs from SAMP6 mice, including a dramatic increase in SA-β-gal-positive cell percentage (Figure ), a decrease of S-phase cell percentage (Figure ), and a declined proliferation rate (Figure ). Importantly, insufficiency of Mitofilin resulted in defective osteogenesis of BMMSCs from SAMR1 mice, as proved by weaker ALP activity, impaired mineralization capability and downregulated expression levels of osteogenic marker genes (Figure ). Furthermore, knockdown of Immt in vivo in the bone marrow space lead to osteoporosis in SAMR1 mice (Figure ). These data highlighted that Mitofilin is necessary for mitochondrial homeostasis and osteogenesis of BMMSCs.

Mitofilin mediates resveratrol-induced mitochondrial and osteogenic improvements of BMMSCs in senescence

Finally, we examined whether upregulation of Mitofilin mediated the protective effects of RESV against the mitochondrial and osteogenic compromise of senescent BMMSCs. As shown by the expression of mtDNA-encoded mitochondrial complex subunits, Immt knockdown remarkably inhibited RESV promotion on most complex I subunits (Figure ) and blocked positive effects of RESV on subunits of complex III (Figure 6B), IV (Figure ) and ATP synthase (Figure ). This general suppression of RESV facilitating mitochondrial autonomous gene transcription in Mitofilin deficiency resulted in blockade of RESV improvement of osteogenesis of senescent BMMSCs (Figure ), leading to maintenance of defective ALP activity (Figure ), mineralization capability (Figure ) and osteogenic marker gene expression (Figure ) in BMMSCs from SAMP6 mice. These findings collectively suggested that Mitofilin mediates resveratrol-induced mitochondrial and osteogenic improvements of BMMSCs in senescence.
Figure 6

Mitofilin mediates resveratrol-induced mitochondrial and osteogenic improvements of SAMP6 BMMSCs. (A-D) qRT-PCR analysis of mRNA expression levels of all 13 mtDNA-encoded mitochondrial complex subunits in complex I (A), complex III (B), complex IV (C) and ATP synthase (D) in BMMSCs. (E-G) Representative images of ALP and alizarin red staining (E) with quantification of ALP activity (F) and mineralization (G) in osteogenic differentiation of BMMSCs. Bars: 5 mm. (H, I) qRT-PCR analysis of mRNA expression (H) and western blot analysis of protein expression (I) levels of osteogenic marker genes in osteogenic differentiation of BMMSCs. BMMSCs from SAMP6 mice treated with resveratrol (10 μM) and the DMSO (0.001%) solvent control were transfected with either the shRNA for Immt (Mitofilin) or the negative control (a scrambled sequence, NC) by a lentiviral vector. n = 3 per group. Data represent mean ± SD. *P < 0.05; NS, not significant (P > 0.05). Data were analyzed using ANOVA followed by Newman-Keuls post-hoc tests.

Discussion

Bone aging brings about many degenerative skeletal diseases such as primary osteoporosis and osteoarthritis, and may also exert adverse effects on other systems such as the central nervous system, the hematopoietic and the related immune system, and the endocrinium 76-78. RESV, a small molecule compound that safely mimics the effects of dietary restriction, has been well documented to extend the lifespan of lower organisms 9-11 and improve the health of aging rodents 12-14. However, although it is a critical pathogenesis of osteoporosis in aging 4, 79, whether senescence-associated osteogenic functional decline of BMMSCs is rescued by RESV remains unknown. In the present study, using the bone-specific, senescence-accelerated, osteoblastogenesis/osteogenesis-defective SAMP6 mouse strain as an experimental model, we show that application of RESV in a chronic intermittent methodology specifically enhances bone formation and counteracts accelerated bone loss and, importantly, improves osteogenic differentiation of senescent BMMSCs. Furthermore, while we have proved that the protective effects of RESV against osteogenic decline in BMMSC senescence are through restoring cellular metabolism through mitochondrial functional recovery and autonomous gene transcription, we unexpectedly discovered a non-canonical molecular target, the MICOS core component Mitofilin/Immt/ Mic60 38, 39, that RESV uses as the key mediator of its influences on mitochondrial morphological and functional homeostasis and osteogenesis in senescent BMMSCs. We have also revealed that Mitofilin is indispensable for mitochondrial stability and osteogenesis of BMMSCs in bone integrity. Taken together, our findings uncover osteogenic functional improvements of senescent MSCs as critical impacts in the anti-osteoporotic practice of RESV, and unravel Mitofilin as a novel mechanism mediating RESV promotion of mitochondrial function in stem cell senescence. Current understanding of RESV impacts on adult stem cells mainly comes from in vivo conditions of tissue injury and regeneration as well as in vitro situations of proliferation and induced differentiation. It has been reported that RESV ameliorates irradiative injury of hematopoietic stem cells (HSCs) 80, oxidative injury of neural stem cells (NSCs) 81 and chemical injury of spermatogonial stem cells (SSCs) 48, while RESV further promotes recovery of HSC populations from genetic defects 82 and facilitates endogenous myocardial regeneration of cardiac stem cells (CSCs) 83, 84. Furthermore, for the functional potential of stem cells, increasing evidence has highlighted effects of RESV to promote self-renewal 85-87 and multipotency 88-91 in vitro, particularly for osteogenic differentiation of MSCs derived from healthy individuals 44, 46, 92, 93. However, previous studies did not reach a consensus on RESV impacts on senescence of MSCs: some researchers claimed that RESV could protect adipose-derived MSCs from H2O2- and D-glucose-induced senescence and also attenuated senescence in long-term culture 94, while more reports documented only transient protective effects 95, dose- and duration-dependent positive or detrimental effects 45, and even accelerating effects of RESV on MSC senescence in serial passages 96. This controversy might be due to differences of the origin of MSCs or application method of RESV, but may further be attributed to the induced in vitro models that cannot replicate real in vivo senescence 97. To address this issue, we applied the SAMP6 mice and their BMMSCs in this study, the ex vivo findings of which reflect phenotypic changes in situ 32. Furthermore, we additionally confirmed positive effects of RESV on BMMSCs from natural aging mice. Together with Zhou and colleagues using a laminopathy-based progeroid model (the Zmpste24-/- mice) 15, we have added a dimension to this field showing that RESV indeed improves senescent stem cells. Moreover, while Zhou's group demonstrated RESV recovery of the MSC population in progeria 15, we further reveal that RESV rescues osteogenic functional decline of MSCs specifically in accelerated bone loss. Although we did not show general effects of RESV directly on senescence levels of MSCs and senescence-associated phenotypes of impaired cell viability and self-renew 98, misdirected differentiation toward adipocytes 99, or DNA damage 100 and altered secretion 101, the current findings, particularly on RESV improving osteogenesis and bone formation in osteoporosis, is of translational significance as RESV may be developed as a remedy for various skeletal diseases caused by defective osteoblastogenesis, such as glucocorticoid-induced bone loss 102 and osteogenesis imperfecta 103. Our findings open an avenue for future research on the application of RESV to rejuvenate stem cells in the natural aging process. The in vivo application of RESV has been extensively investigated in preclinical experimental models. Although most studies have conducted low-dose dietary RESV delivery to mimic caloric restriction and delay age-related deteriorations in rodents, this methodology does not increase the longevity of ad libitum-fed animals when started midlife, with no observations on stem cell rejuvenation 14, 16. Also, despite recent in vivo reports on low-dose dietary RESV promoting adipogenesis of adipose progenitors/stromal vascular cells, its implications in the aging process are unknown 104. As a proof-of-concept study, we here applied RESV in vivo intraperitoneally, considering the better control of applied dose by intraperitoneal injection over feeding, and the reported efficacy of mitochondrial intervention by intraperitoneal injection of RESV 49. The dosage was then selected at 100 mg/kg, which is according to reports applying this dosage to affect stem cell activity in response to chemical injury in vivo, and is based on previous documents below the potential highest dose not to induce obvious systemic alterations 47, 48. The experimental duration was determined given the time needed for chronic changes of bone mass by bone remodeling according to our observations 50, and the method of chronic intermittent application every other day was based on previous reports on feeding-based RESV retarding aging parameters in mice 16. Importantly, the high-dose intraperitoneal administration of RESV chronically intermittently in the 2-month period did not induce any obvious alterations of mice by our observation, which maintained good physiological conditions as the control mice, suggesting the safety of this experimental methodology. Thus, further translational researches may consider using this method for a stem-cell based rejuvenative strategy. Mitochondria are highly specialized and dynamic double-membrane organelles of bacterial origin that play crucial roles in multiple processes in eukaryotic cells, such as their fundamental function in energy production and metabolism 105, 106. Particularly, recent discoveries have suggested critical participation of mitochondria in the pluripotent maintenance and differentiation of stem cells 106, 107. Accordingly, while anaerobic glycolysis is required at the pluripotent state, a metabolic switch to mitochondrial OXPHOS is necessary for differentiation of stem cells 108, 109, including osteogenesis of MSCs 110, 111. Notably, mitochondrial dysfunction critically contributes to senescence of stem cells, in which OXPHOS metabolism suffers from impairments, leading to less energy production but increased oxidative stress 27, 112. In MSCs, this mitochondrial compromise results in declined self-renewal and misdirected differentiation, underlying age-related osteoporosis 31, 112, 113. Correspondingly, it has emergingly been noticed that function of stem cells can be revitalized by metabolic reprogramming under nutrient control 106. For example, a recent report has confirmed that a reduction of glucose by 10%-30% in culture conditions of BMMSCs significantly prevented replicative senescence with an accelerated osteogenic commitment due to higher activities of ETC, and more synthesis of ATP and antioxidants 114. Nevertheless, despite the discovery of dietary restriction mimetic reagents like RESV, metformin and rapamycin 7, 8, feasible pharmacological strategies to reprogram the mitochondrial metabolism of senescent stem cells are still lacking. Further complicating matters, certain anti-aging pharmacology may exert detrimental side effects, such as the well-known immunosuppression by rapamycin 115, 116, in spite of its efficacy to improve MSC function in vivo 117, 118. In this regard, RESV exhibits a particular advantage as it safely mimics wide-ranging positive effects of dietary restriction with easy administration but no adverse impacts on rodents even at very high concentrations, which indicates it is well-tolerated and non-toxic 47. Here, we further uncover that chronic intermittent application of RESV enhances bone formation and counteracts accelerated bone loss in vivo, providing an optimal solution to revitalize mitochondrial function and improve the function of stem cells in senescence. Additionally, it is noticeable that RESV failed to enhance bone formation in SAMR1 mice, which do not show mitochondrial defect, suggesting that the anabolic effects of RESV might be restricted to the senescent status. Further long-term in vivo experiments in aged mice are needed to clarify whether RESV impacts are restricted to the SAMP6 mouse strain, which might be strain-independent based on the in vitro osteogenic findings of BMMSCs in this study. In order to meet different metabolic needs in distinct situations, cells modulate mitochondrial function through biogenesis regulation as well as dynamic morphological changes 72, 119. Importantly, mitochondria are known as semi-autonomous organelles that possess their own genome of mtDNA, encoding 13 essential protein subunits of ETC complexes 120. Therefore, mitochondrial metabolism is regulated by the coordinated signals from the nuclear and mitochondrial genomes, the nuclear compartment of which include the mitochondrial transcription factor A (Tfam) and general biogenesis regulators like Pgc-1 and Ampk 71, 121, 122. With advanced age, nuclear-mitochondrial communication is disrupted under genetic or metabolic stresses, thus mediating loss of mitochondrial homeostasis through either the Pgc-1 or Ampk pathways to inhibit mitochondrial biogenesis, or a Pgc-1-independent pathway suppressing Tfam to induce deficiency of mitochondrial autonomous gene transcription, both of which are under common control of Sirt1 26, 27. Typically, as a Sirt1 activator, RESV improves mitochondrial function by activating Sirt1 and Ampk 12, 13, 25. Here, we surprisingly discover that RESV may selectively activate a non-canonical target in senescent stem cells, leading to rescue of mtDNA transcription, with the most substantially recovered OXPHOS genes (Nd1, Cytb, Atp6) being just the reported Tfam downstream-regulated subunits in aging 26. Although we did not rule out the contributions of the typical Pgc-1 and Ampk pathways, or investigate Tfam participations in mediating RESV impacts, the promoted mitochondrial autonomous gene transcription suggests a potential novel mechanism underlying RESV effects on senescent stem cells. How the decision for pathway selection was made and whether crosstalk exists remain to be elucidated, which might be attributed to distinctive characteristics of stem cells in senescence. As shown, this decision could be greatly influenced by cellular energetic states 26. Mitofilin/Immt/Mic60, originally identified as heart muscle protein (Hmp) 123 and named as formation of crista junction protein 1 (Fcj1) in yeast 124, is a nuclear-encoded mitochondrial inner membrane protein controlling mitochondrial morphology 64, 125. In detail, as the core component of MICOS 38, Mitofilin functions as a multifunctional regulator of mitochondrial architecture: on one hand, Mitofilin is required for shaping crista junctions to maintain the integrity of the mitochondrial inner membrane 124, 126; on the other hand, Mitofilin is also coupled to the outer membrane and promotes protein import into the mitochondrial intermembrane space 125, 127. Based on its vital role in establishing mitochondrial structure, Mitofilin is known to regulate a wide range of mitochondrial functions, including coordination with ETC to maintain OXPHOS 128, preservation of mitochondrial membrane potential and ROS production at physiological levels 64, keeping mtDNA transcription 129, facilitating fission and fusion dynamics 39, and regulating cytochrome c release during apoptosis 130. Consistent with our findings, Mitofilin deficiency is reported to result in giant mitochondria induced by a massive increase of large concentric stacks of cristae membranes, leading to impaired mitochondrial metabolism with reduced mtDNA transcription 39, 64, 129. In this study, we further reveal significant functions of Mitofilin in stem cell senescence and functional improvements, in that suppression of Mitofilin is enough to mimic a senescent phenotype in SAMR1 BMMSCs, and Mitofilin upregulation is indispensable for the positive effects of RESV on senescent BMMSCs from SAMP6 mice by modulating mitochondrial autonomous gene transcription. These findings highlight that the presence or absence of Mitofilin could be acting as a bottleneck on the downstream effects of RESV, at least in the SAM strains. Nevertheless, it is still not clear if the BMMSCs from SAMP6 and aged mice share the same mechanism in developing the senescent phenotypes, and whether RESV enhances osteogenic performance of BMMSCs from aged mice by targeting pathways other than Mitofilin, which require future functional studies. Mechanistically, Mitofilin regulates mtDNA via interacting with both mtDNA itself and the transcription factor Tfam, respectively promoting maintenance of mtDNA architecture and binding of Tfam to mtDNA promoters 39, 129. Additionally, RESV might still restore nuclear-mitochondrial communication in senescent stem cells, given that Mitofilin facilitates import of cytoplasmic protein involving Tfam into mitochondria 125, 131. Also, as the critical regulator controlling mitochondrial morphology, Mitofilin might also modulate effects of the canonical Pgc-1 and Ampk pathways through a similar bottleneck function, affecting nuclear-mitochondrial communication. The detailed mechanisms underlying RESV-promoted Mitofilin stimulating mtDNA transcription in senescent stem cells is worth exploring in future studies. In addition, how RESV upregulates Mitofilin expression should also be deciphered in future work, which might be attributed to activation of RESV by various signaling in MSCs, such as the Wnt/β-catenin and extracellular signal-regulated kinase (ERK) pathways 46, 86, 96. In summary, we reveal that RESV enhances bone formation and counteracts accelerated bone loss via Mitofilin-mediated mitochondrial and osteogenic improvement of senescent BMMSCs. Our findings uncover osteogenic functional improvements of senescent MSCs as critical impacts in anti-osteoporotic practice of RESV, and unravel Mitofilin as a novel mechanism mediating RESV promotion of mitochondrial function in stem cell senescence.
  131 in total

1.  Effect of prior treatment with resveratrol on density and structure of rat long bones under tail-suspension.

Authors:  Caroline Habold; Iman Momken; Ali Ouadi; Virgile Bekaert; David Brasse
Journal:  J Bone Miner Metab       Date:  2010-05-11       Impact factor: 2.626

Review 2.  When stem cells grow old: phenotypes and mechanisms of stem cell aging.

Authors:  Michael B Schultz; David A Sinclair
Journal:  Development       Date:  2016-01-01       Impact factor: 6.868

Review 3.  Linking functional decline of telomeres, mitochondria and stem cells during ageing.

Authors:  Ergün Sahin; Ronald A Depinho
Journal:  Nature       Date:  2010-03-25       Impact factor: 49.962

Review 4.  Mitochondrial metabolic failure in telomere attrition-provoked aging of bone marrow mesenchymal stem cells.

Authors:  Bingdong Sui; Chenghu Hu; Yan Jin
Journal:  Biogerontology       Date:  2015-09-22       Impact factor: 4.277

5.  Resveratrol increases bone mineral density and bone alkaline phosphatase in obese men: a randomized placebo-controlled trial.

Authors:  Marie Juul Ornstrup; Torben Harsløf; Thomas Nordstrøm Kjær; Bente Lomholt Langdahl; Steen Bønløkke Pedersen
Journal:  J Clin Endocrinol Metab       Date:  2014-12       Impact factor: 5.958

6.  Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan.

Authors:  Konrad T Howitz; Kevin J Bitterman; Haim Y Cohen; Dudley W Lamming; Siva Lavu; Jason G Wood; Robert E Zipkin; Phuong Chung; Anne Kisielewski; Li-Li Zhang; Brandy Scherer; David A Sinclair
Journal:  Nature       Date:  2003-08-24       Impact factor: 49.962

7.  Effects of dietary resveratrol on excess-iron-induced bone loss via antioxidative character.

Authors:  Lu Zhao; Yin Wang; Zejian Wang; Zheng Xu; Qiaoyan Zhang; Ming Yin
Journal:  J Nutr Biochem       Date:  2015-06-16       Impact factor: 6.048

8.  Suppression of Mic60 compromises mitochondrial transcription and oxidative phosphorylation.

Authors:  Rui-Feng Yang; Li-Hong Sun; Ran Zhang; Yuan Zhang; Yu-Xuan Luo; Wei Zheng; Zhu-Qin Zhang; Hou-Zao Chen; De-Pei Liu
Journal:  Sci Rep       Date:  2015-01-23       Impact factor: 4.379

9.  Resveratrol changes spermatogonial stem cells (SSCs) activity and ameliorates their loss in busulfan-induced infertile mouse.

Authors:  Chongyang Wu; Ying Zhang; Qiaoyan Shen; Zhe Zhou; Weishuai Liu; Jinlian Hua
Journal:  Oncotarget       Date:  2016-12-13

10.  Narciclasine attenuates diet-induced obesity by promoting oxidative metabolism in skeletal muscle.

Authors:  Sofi G Julien; Sun-Yee Kim; Reinhard Brunmeir; Joanna R Sinnakannu; Xiaojia Ge; Hongyu Li; Wei Ma; Jadegoud Yaligar; Bhanu Prakash Kn; Sendhil S Velan; Pia V Röder; Qiongyi Zhang; Choon Kiat Sim; Jingyi Wu; Marta Garcia-Miralles; Mahmoud A Pouladi; Wei Xie; Craig McFarlane; Weiping Han; Feng Xu
Journal:  PLoS Biol       Date:  2017-02-16       Impact factor: 8.029

View more
  24 in total

1.  Artificial Mitochondrial Transfer (AMT) for the Management of Age-related Musculoskeletal Degenerative Disorders: An Emerging Avenue for Bone and Cartilage Metabolism Regulation.

Authors:  Lynda Bourebaba; Katarzyna Kornicka-Garbowska; Larry Galuppo; Krzysztof Marycz
Journal:  Stem Cell Rev Rep       Date:  2022-03-01       Impact factor: 6.692

Review 2.  Mitochondrial inner membrane protein, Mic60/mitofilin in mammalian organ protection.

Authors:  Yansheng Feng; Ngonidzashe B Madungwe; Jean C Bopassa
Journal:  J Cell Physiol       Date:  2018-09-14       Impact factor: 6.384

3.  Resveratrol improves human umbilical cord-derived mesenchymal stem cells repair for cisplatin-induced acute kidney injury.

Authors:  Rongxue Zhang; Lei Yin; Bin Zhang; Hui Shi; Yaoxiang Sun; Cheng Ji; Jingyan Chen; Peipei Wu; Leilei Zhang; Wenrong Xu; Hui Qian
Journal:  Cell Death Dis       Date:  2018-09-20       Impact factor: 8.469

4.  MicroRNA-92b-5p modulates melatonin-mediated osteogenic differentiation of bone marrow mesenchymal stem cells by targeting ICAM-1.

Authors:  Yuan Li; Chao Feng; Manqi Gao; Mengyu Jin; Tianyi Liu; Ye Yuan; Gege Yan; Rui Gong; Yi Sun; Mingyu He; Yutuo Fu; Lai Zhang; Qi Huang; Fengzhi Ding; Wenya Ma; Zhenggang Bi; Chaoqian Xu; Natalia Sukhareva; Djibril Bamba; Russel Reiters; Fan Yang; Benzhi Cai; Lei Yang
Journal:  J Cell Mol Med       Date:  2019-07-14       Impact factor: 5.310

5.  The role of resveratrol in bone marrow-derived mesenchymal stem cells from patients with osteoporosis.

Authors:  Jing Li; Zhaoxu Xin; Mingjun Cai
Journal:  J Cell Biochem       Date:  2019-05-20       Impact factor: 4.429

Review 6.  Potential Role of Mic60/Mitofilin in Parkinson's Disease.

Authors:  Victor S Van Laar; P Anthony Otero; Teresa G Hastings; Sarah B Berman
Journal:  Front Neurosci       Date:  2019-01-25       Impact factor: 4.677

7.  CGRP Regulates the Age-Related Switch Between Osteoblast and Adipocyte Differentiation.

Authors:  Hang Li; Jian Qu; Haihong Zhu; Jiaojiao Wang; Hao He; Xinyan Xie; Ren Wu; Qiong Lu
Journal:  Front Cell Dev Biol       Date:  2021-05-26

8.  Calcium Supplement by Tetracycline guided amorphous Calcium Carbonate potentiates Osteoblast promotion for Synergetic Osteoporosis Therapy.

Authors:  Jianwei Wang; Shan Tao; Xiangyu Jin; Yanqing Song; Wentao Zhou; Haiya Lou; Rui Zhao; Cheng Wang; Fuqiang Hu; Hong Yuan
Journal:  Theranostics       Date:  2020-07-09       Impact factor: 11.556

Review 9.  Osteogenesis and aging: lessons from mesenchymal stem cells.

Authors:  Arantza Infante; Clara I Rodríguez
Journal:  Stem Cell Res Ther       Date:  2018-09-26       Impact factor: 6.832

10.  NDRG2 suppression as a molecular hallmark of photoreceptor-specific cell death in the mouse retina.

Authors:  Cheng-Biao Hu; Bing-Dong Sui; Bao-Ying Wang; Gao Li; Cheng-Hu Hu; Chen-Xi Zheng; Fang-Ying Du; Chun-Hui Zhu; Hong-Bo Li; Yan Feng; Yan Jin; Xiao-Rui Yu
Journal:  Cell Death Discov       Date:  2018-09-12
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.