Microglial activation and the inflammatory response in the central nervous system (CNS) play important roles in secondary damage after traumatic brain injury (TBI). Transcriptional activation of genes that limit secondary damage to the CNS are mediated by a cis-acting element called the antioxidant responsive element (ARE). ARE is known to associate with the transcription factor NF-E2-related factor 2 (Nrf2), a transcription factor that is associated with histone deacetylases (HDACs). This pathway, known as the Nrf2/ARE pathway, is a critical antioxidative factor pathway that regulates the balance of oxygen free radicals and the inflammatory response, and is also related to autophagic activities. Although valproic acid (VPA) is known to inhibit HDACs, it is unclear whether VPA plays a role in the microglia-mediated neuroinflammatory response after TBI via regulating oxidative stress and autophagy induced by the Nrf2/ARE signaling pathway. In this study, we demonstrate that microglial activation, oxidative stress, autophagy, and the Nrf2/ARE signaling pathway play essential roles in secondary injury following TBI. Treatment with VPA alleviated TBI-induced secondary brain injury, including neurological deficits, cerebral edema, and neuronal apoptosis. Moreover, VPA treatment upregulated the occurrence of autophagy and Nrf2/ARE pathway activity after TBI, and there was an increase in H3, H4 histone acetylation levels, accompanied by decreased transcriptional activity of the HDAC3 promoter in cortical lesions. These results suggest that VPA-mediated up-regulation of autophagy and antioxidative responses are likely due to increased activation of Nrf2/ARE pathway, through direct inhibition of HDAC3. This inhibition further reduces TBI-induced microglial activation and the subsequent inflammatory response, ultimately leading to neuroprotection.
Microglial activation and the inflammatory response in the central nervous system (CNS) play important roles in secondary damage after traumatic brain injury (TBI). Transcriptional activation of genes that limit secondary damage to the CNS are mediated by a cis-acting element called the antioxidant responsive element (ARE). ARE is known to associate with the transcription factor NF-E2-related factor 2 (Nrf2), a transcription factor that is associated with histone deacetylases (HDACs). This pathway, known as the Nrf2/ARE pathway, is a critical antioxidative factor pathway that regulates the balance of oxygen free radicals and the inflammatory response, and is also related to autophagic activities. Although valproic acid (VPA) is known to inhibit HDACs, it is unclear whether VPA plays a role in the microglia-mediated neuroinflammatory response after TBI via regulating oxidative stress and autophagy induced by the Nrf2/ARE signaling pathway. In this study, we demonstrate that microglial activation, oxidative stress, autophagy, and the Nrf2/ARE signaling pathway play essential roles in secondary injury following TBI. Treatment with VPA alleviated TBI-induced secondary brain injury, including neurological deficits, cerebral edema, and neuronal apoptosis. Moreover, VPA treatment upregulated the occurrence of autophagy and Nrf2/ARE pathway activity after TBI, and there was an increase in H3, H4 histone acetylation levels, accompanied by decreased transcriptional activity of the HDAC3 promoter in cortical lesions. These results suggest that VPA-mediated up-regulation of autophagy and antioxidative responses are likely due to increased activation of Nrf2/ARE pathway, through direct inhibition of HDAC3. This inhibition further reduces TBI-induced microglial activation and the subsequent inflammatory response, ultimately leading to neuroprotection.
Traumatic brain injury- (TBI) induced secondary injury is a complicated pathophysiological process that includes microglial activation, an inflammatory response, oxidative stress and abnormal mitochondrial activities, all of which promote caspase-dependent neuronal apoptosis that subsequently affects neurological function (McKee and Lukens, 2016; Hopp et al., 2017; Sinha et al., 2017). TBI-induced microglial activation and subsequent release of proinflammatory cytokines, including interleukin (IL), tumor necrosis factor (TNF), and interferon (INF), can cause direct neuronal apoptosis. In addition, these proinflammatory cytokines stimulate nitric oxide synthesis, which leads to increased blood–brain barrier permeability, brain edema, capillary dysfunction, and promotes neuronal apoptosis (Guadagno et al., 2015; Corrigan et al., 2016). Inhibition of TBI-induced microglial activation and central neuroinflammatory responses has been demonstrated to improve neurological function following TBI (Chen et al., 2017; Kumar et al., 2017).Microglial activation, and the subsequent neuroinflammatory response, are reported to be associated with decreased mitochondrial membrane potential. Damaged mitochondria release excess reactive oxygen species (ROS) after TBI, which lead to lipid peroxidation and cytotoxicity resulting in further oxidative stress and mitochondrial dysfunction (Fischer et al., 2012; Roth et al., 2014; Ding et al., 2015). Damaged membrane permeability in mitochondria, and mitochondrial apoptosis-associated proteins, promote caspase-dependent neuronal apoptosis (Gao et al., 2017). In response, oxidative stress-induced autophagy selectively degrades oxidized substances and damages organelles to reduce oxidative injury, maintains normal mitochondrial function and balances the intracellular microenvironment (Levine and Kroemer, 2008; Lin et al., 2016; Szatmári-Tóth et al., 2016). Enhancing autophagy after TBI may weaken the expressions of neuronal apoptosis-related downstream molecules, including cleaved caspase-3, Bcl-2, and Bax, resulting in the dissociation of the Bcl-2/Beclin-1 complexes (Tang et al., 2017). Therefore, identifying neuroprotective mechanisms that are involved in autophagy-mediated neuronal survival, particularly the interaction between microglial activation and autophagy, may provide novel therapeutic strategies for TBI (Lin et al., 2016; Vlahakis et al., 2017).The transcription factor NF-E2-related factor 2 (Nrf2) is an important antioxidative regulator that balances oxygen free radicals and the inflammatory response in cells (Sandberg et al., 2014). Under inflammatory and oxidative stress conditions, elevated ROS can enhance Keap1 oxidation causing release of Nrf2. After translocation to the nucleus, Nrf2 binds to the antioxidant response element (ARE) initiating expression of antioxidative genes such as heme oxygenase-1 (HO-1), superoxide dismutases (SODs), NAD(P)H:quinone oxidoreductase 1 (NQO1), uridine 5′diphospho-glucuronosyl transferase enzymes (UGTs), glutathione cysteine ligase (GCL) and glutathione reductase (GR) to scavenge excessive ROS (Cha et al., 2016; Xue et al., 2016; Wasik et al., 2017). SODs catalyze the dismutation of O2− to form O2 and H2O2, which can then be converted to H2O. GCL and GR regulate the generation and metabolism of glutathione (GSH), which is a crucial antioxidant to maintain cellular redox status (Zhang et al., 2016). Studies have shown that the Nrf2/ARE signaling pathway as well as autophagy are involved in oxidative stress (Lastres-Becker et al., 2014; Pajares et al., 2016). Furthermore, both the Nrf2/ARE signaling pathway and autophagy are closely related and are interdependent (Lastres-Becker et al., 2014). Nrf2 can regulate autophagy formation, further promoting its protective effects (Zhang R. et al., 2017). Inhibition of the Nrf2/ARE signaling pathway reduces autophagy, and is thus associated with pathogenic processes (Lastres-Becker et al., 2014; Jang et al., 2016; Pajares et al., 2016; Zhang R. et al., 2017).Valproic acid (VPA) is widely used for the treatment of epilepsy. It exerts its therapeutic benefits through multiple mechanisms, including enhancement of antioxidative stress and GABAergic activity, depolarization induced by N-methyl-D-aspartic acid (NMDA) receptors and/or inhibition of voltage-gated sodium and calcium channels (Chen et al., 2014; Wilson et al., 2014). Recent studies showed that VPA is a class 1/II histone deacetylase inhibitor (HDCAi) and inhibits HDCAs function (Chen et al., 2014; Wilson et al., 2014). Acetylated histone proteins exert their neuroprotective effects by reducing inflammation and inhibiting neuronal cell death (Zou and Crews, 2014; Wang et al., 2015; Bai et al., 2017), which improves neurological functions in many neurological diseases such as cerebral ischemia (Suda et al., 2015) and spinal cord injury (Chu et al., 2015). Studies from Nikolian et al. (2017, 2018) have shown that treatment with VPA can upregulate the expression of genes involved in cell survival and proliferation, and improves neurological function in preclinical models of TBI. However, the role of VPA in TBI, and whether treatment with VPA can improve antioxidative effects following TBI, still needs further research.Nrf2 expression levels are related to histone deacetylase (HDAC) enzymatic activity and the levels of histone acetylation. Nrf2 can be acetylated within its p300/CBP augments promoter-specific DNA binding. This acetylation increases its DNA-binding capacity and downstream transcriptional regulation. Histone deacetylase inhibitors, which leads to hyperacetylation of chromatin proteins and alterations in gene expression, have been recognized as potentially useful therapeutic targets for a number of human disorders, including central nervous system (CNS) diseases (Sun et al., 2009; Zhang et al., 2016). Studies from Rajendran et al. (2015) demonstrated that the Nrf2 expression levels are related to HDAC enzymatic activity and the levels of histone acetylation, suggesting that expression of HDAC may be associated with oxidative stress. Based on these observations, we hypothesized that VPA, a class 1/II histone deacetylase inhibitor, regulates oxidative stress and autophagy controlled by the Nrf2/ARE signaling pathway via inhibition of HDAC enzymatic acitivity. Subsquently, this regulation would decrease the microglial activation-induced inflammatory response after TBI and thus promote neuronal survival.
Materials and Methods
Animals
All protocols were approved by the animal care committee at Fujian Medical University (Fuzhou, China). Adult male Sprague-Dawley rats weighing between 220 g and 250 g were purchased from the Fujian Medical University Laboratory Animal Center (Fujian, China). Rats were raised in a controlled environment, at a temperature range between 23 ± 2°C on a 12:12-h light/dark cycle with free access to food and water.
Experimental Model and Drug Administration
All rats were randomly assigned into sham, TBI and TBI+VPA groups, respectively. After TBI, animals were further divided into three subgroups (n = 36): 1 day, 3 and 7 days. TBI models were produced as previously described (Chen et al., 2017). Briefly, the rats were anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/kg sodium pentobarbital). The scalp was then opened at 2 mm posterior to the right coronal suture and 2 mm from the midline. A 5-mm hole was drilled through the skull, although the dura mater was left intact. A 30-g hammer was dropped from a height of 20 cm to induce craniocerebral injury (impact force = 600 g/cm). The bone hole was sealed with wax and the scalp was sutured. Rats in the sham group underwent this surgical procedure without the hammer drop. Approximately 30 min after TBI, the TBI+VPA group was administrated VPA (300 mg/kg; intraperitoneally; Sigma, St. Louis, MO, USA) once per day for three consecutive days (Penas et al., 2011; Chu et al., 2015). Specifically, 3-Methyladenine (3-MA) is a phosphatidylinositol 3 kinase (PI3K) inhibitor which can specifically block autophagosome formation during autophagy and is widely used in mechanism studies as a specific autophagy inhibitor (Jin et al., 2016; Lin et al., 2016). Rats were intraperitoneally injected with 3-MA (5 mg/kg, diluted in dimethylsulfoxide) 1 h after VPA once per day for three consecutive days (Jin et al., 2016; Lin et al., 2016). The remainder of the groups were injected with an equal dose of dimethylsulfoxide as a control.
Assessment of Neurological Injury
Modified neurological severity scores (mNSS; Zhang et al., 2013) were used to evaluate motor (muscle state, abnormal movement), sensory (visual, tactile and proprioceptive), and reflex tests. Evaluation was done 1 day, 3 and 7 days after TBI by researchers who were blinded to the experiments. Table 1 shows a set of the mNSS. The mNSS test was graded on a scale of 0–18, where a total score of 18 points indicated severe neurological deficits and a score of 0 indicated normal performance; 13–18 points indicated severe injury; 7–12 indicated mean-moderate injury; and 1–6 indicated mild injury.
Table 1
Modified neurological severity score points.
Points
Motor tests
Raising rat by tail
3
Flexion of forelmb
1
Flexion of hindlim
1
Head moved >10° to vertical axis within 30 s
1
Placing rat on floor (normal = 0; maximum = 3)
3
Normal walk
0
Inability to walk straight
1
Circling toward paretic side
2
Falls down to paretic side
3
Sensory tests
2
Placing test ( visual and tactile test)
1
Proprioceptive test (deep sensation, pushing paw against table edge to stimulate limb muscles)
1
Beam balance tests (normal = 0; maximum = 6)
6
Balances with steady posture
0
Grasps side of beam
1
Hugs beam and 1 limb falls down from beam
2
Hugs beam and 2 limbs fall down from beam, or spins on beam (>60 s)
3
Attempts to balance on beam but falls off (>40 s)
4
Attempts to balance on beam but falls off (>20 s)
5
Falls off; no attempt to balance or hang on to beam (<20 s)
6
Reflex absence and abnormal movements
4
Pinna reflex ( head shake when auditory meatus is touched)
1
Corneal reflex ( eye blink when cornea is lightly touched with cotton)
1
Startle reflex ( motor response to a brief noise from snapping aclipboard paper)
1
Seizures, myoclonus, myodystony
1
Maximum points
18
One point is awarded for inability to perform the tasks or for lack of a tested reflex: 13–18, severe injury; 7–12, moderate injury; 1–6, mild injury.
Modified neurological severity score points.One point is awarded for inability to perform the tasks or for lack of a tested reflex: 13–18, severe injury; 7–12, moderate injury; 1–6, mild injury.
Measurement of Brain Water Content
Brain water content was calculated using the wet weight-dry weight method (Chen et al., 2017). After evaluation of neurological injury, rats were sacrificed by decapitation and brains were harvested immediately. The cerebral cortex (2 mm around craniotomy; 200 ± 20 mg) was sampled and both blood and cerebrospinal fluid were removed with filter paper before wrapping the sample in preweighed aluminum foil. After wet weight was measured using a digital scale, samples were placed in an oven to dry for 24 h at 100°C. Dry weight was then measured for each sample. Brain water content was found using the formula: % = 100% × (wet weight − dry weight)/dry weight.
Immunohistochemical Staining
The cortical tissue in the lesioned areas were fixed in formaldehyde and embedded in paraffin. The tissue blocks were sectioned at a thickness of 3 μm. After de-paraffinization with dimethyl benzene and dehydration in a series of graded alcoholsolutions, the antigen was obtained via the citric acid buffer/microwave method. The sections were blocked with goat serum and incubated overnight with primary antibodies against HDAC3 (1:100; Cell Signaling Technology, Danvers, MA, USA), Iba-1 (1:200; Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) and GFAP (1:200; Abcam, Cambridge, UK). Following washings, slices were incubated with secondary antibodies for an additional 1 h at room temperature. A pathologist who was blinded to the experiments randomly selected five regions of interest (ROI) under a high magnification optical microscope (400×; Leica, Wetzlar, Germany) to observe positively staining cells surrounding injury areas. Evaluation of sections was undertaken by assessing the intensity of staining (five grades; Zhang et al., 2016) where: 0 indicated no detectable positive cells; 1 indicated very low density of positive cells; 2 indicated a moderate density of positive cells; 3 indicated a higher, but not maximal density of positive cells; and 4 indicated the maximal density of positive cells. A mean of five ROIs were used for statistical analysis.
Immunofluorescent Staining
After antigen obtainment, the 4 μm-thick slices were incubated with antibodies against Nrf2 (1:200; Cell Signaling Technology), NeuN (1:100; Boster Biotech, Wuhan, China), LC3 (1:100; Cell Signaling Technology) and HDAC3 (1:100; Cell Signaling Technology) overnight at 4°C. Following washing, they were then incubated with secondary antibodies for an additional 1 h at room temperature. The cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI). A pathologist who is blind to experiments randomly selected five ROI under a high magnification optical microscope (400×; Leica) to observe the positive staining cells surrounding injury areas. Five random ROIs were selected for quantification and the mean was used for the statistical analysis.
TUNEL Staining
Apoptotic cells were detected via a TUNEL assay kit (Roche, Indianapolis, IN, USA), in accordance with the manufacturer’s instructions. Cortical tissue from the lesioned areas were incubated overnight at 4°C with an anti-neuronal nuclei antibody (1:100; Boster Biotech). The samples were washed three times with phosphate-buffered saline (PBS) and then incubated with the TUNEL reaction mixture for 1 h at 37°C. A double-blind approach was used for quantification. Five randomly selected areas that surrounded the injury site were used to count the TUNEL-positive neurons under high magnification (400×) on a ZEISS HB050 inverted fluorescence microscope.
Enzyme-Linked Immunosorbent Assay (ELISA)
Inflammatory factors in brain tissue were detected using Enzyme-linked immunosorbent assay (ELISA) kits for TNF-α, IL-6, and IL-1β according to the manufacturer’s instructions (all from KeyGEN Biotech, Nanjing, China). Measured OD values were converted into a concentration value.
Western Blot Analysis
The cortical tissue (30 mg) surrounding the lesioned areas were lysed in lysis buffer (Santa Cruz Biotechnology), and the total protein levels were quantified. A total of 25 μg protein was separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane that were blocked in 10% skimmed milk at room temperature for 2 h. The solution was incubated at 4°C overnight with primary antibodies against H3, H4, acetyl-H3, acetyl-H4, acetyl-Nrf2 (Cell Signaling Technology), cleaved caspase-3, LC3, Beclin, ATG-3 and ATG-7 (Cell Signaling Technology), Bax, ROS and GFAP (Abcam), Iba-1, Nrf2, HO-1, NQO1 and UGT1A1 (Santa Cruz Biotechnology Inc.), followed by incubation with appropriate secondary antibodies. Immunoblots were visualized using the Millipore ECL Western Blotting Detection System (Millipore, Billerica, MA, USA). Gray value analysis was conducted with the UN-Scan-It 6.1 software (Silk Scientific Inc., Orem, UT, USA). Expression levels were normalized against β-actin (1:5000, Boster Biotech) or Lamin B1 (1:3000, Cell Signaling Technology).
Nrf-2 Protein Nuclear Translocation Analysis
Tissue samples were subjected to subcellular fractionation using cytoplasmic and nuclear protein extraction kits (KeyGEN Biotech, KGP150, Nanjing, China), which utilized hypotonic lysis buffer (20 mM HEPES [pH 7.4], 2 mM EGTA, 2 mM MgCl2) to extract the cytosolic protein and hypertonic lysis buffer (20 mM Tris–HCl, pH 7.6, 100 mM NaCl, 20 mM KCl, 1.5 mM MgCl2, 0.5% Nonidet P-40 and protease inhibitors) to extract the nuclear protein. The Nrf-2 protein levels from the lysates was determined separately via western blot by stripping the PVDF membranes and re-probing with LaminB1 (1:3000, Cell Signaling Technology) as the nuclear control protein and β-actin (1:5000, Boster Biotech) as the cytosolic control.
Activity Assay
2′,7′-Dichlorodihydrofluorescein diacetate assay was applied to detect the ROS concentrations in lesioned cortices according to the manufacturer’s instruction (Yeasen Biotech Co., Ltd., Nanjing, China). Fluorescence signals were detected using a fluorescence microplate system (Enspire 2300, PerkinElmer, Norwalk, CT, USA) with a wavelength of 498 nm. In addition, SOD (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) and GSH (Nanjing Jiancheng Bioengineering Institute) were measured with respective assay kits according to the manufacturer’s instructions. Nuclear proteins were isolated and protein concentrations were quantified using the Bicinchoninic acid assay. HDAC activity was measured by colorimetric a HDAC assay kit (BioVision, Mountain View, CA, USA) at a wavelenght of 405 nm according to the manufacturer’s instructions.
Chromatin Immunoprecipitation (ChIP) Assay
Cortical tissue (30 mg) from lesion areas were sampled and placed into 10 ml PBS and formaldehyde was added to make a final solution of 1%. Samples were gently shaken for 20 min at room temperature and then 2.5 M glycine was added to make the final concentration of 0.125 M. After gentle shaking for 10 min at 4°C, samples were spun at 100 g for 5 min at 4°C. Supernatants were discarded, and pellets were suspended in 2 ml ice cold PBS for lysation. The lysate was sonicated to cut DNA into 300–800 bp and the resulting chromatin supernatant was divided equally into two samples; 1 μg anti-Nrf2 antibody or IgG control (Millipore) was added and shaken overnight at 4°C. The protein/DNA complex was reverse cross-linked with free DNA, washed, and 20 μl 5 M NaCl was used to mix the precipitate and the complex was cross-linked overnight at 65°C. A DNA gel extraction kit (OMEGA D2500-01, Omega Bio-tek, Norcross, CA, USA) was use to extract DNA and samples were amplified for 30 cycles using following program: 94°C for 3 min, 94°C for 30 s, 60°C for 30 s, 72°C for 20 s. Primers for the ChIP assay were designed using Premier 5 software: BTE-foward: TCTACTGTGTCCTCATTCACGTC; BTE-forward: GACAGGCTCCGGACCACTCCG; BTE-reverse: ACTTGCGTTCACACACGCGTA; Neg.ctrl.-forward: CAGGCAACCTGTTGGCAGGTGGG; Neg.ctrl.-reverse: CTGGCCAGCTCTGCCGCTCAGCT.
Primary Microglia Culture
Primary microglia were prepared from the cerebral cortex of Sprague-Dawley rat neonates (1–3 days postnatal) using the shaking method as previously described (Yan et al., 2013). Briefly, following the removal of the leptomeninges, the neopallium was dissected out, and digested with 0.125% trypsin (Hyclone, Logan, UT, USA) for 10 min at 37°C in a water bath. Then, single cell suspensions were filtered through a sterile 70-mm pore size nylon mesh. Cells were seeded in poly-D-lysine-coated plates, and were incubated in DMEM/F12 cultured media (Hyclone) containing 10% fetal bovine serum and 1% antibiotics at 37°C in 5% CO2 and 95% humidity. Half of the medium was replaced every 3 days. The cultures were used on day 14. Stratification was considered to be reached when the microglial cells in the upper layer could be harvested. More than 90% of the cells were CD11b positive microglia, determined using cytofluorometric analysis. The CD11b positive microglia were then used for experimentation.
Luciferase Assay
To test whether Nrf2 regulates the HDAC3 promoter and initiates transcription, the NRF2 gene was cloned into an EGFP-N3 vector. Plasmids containing the Nrf2 insert were transfected into primary microglia for transient protein overexpression using Lipofectamine 2000 (Invitrogen Co., Carlsbad, CA, USA). In parallel, NRF2-siRNA was transfected into microglia to interfere with endogenous Nrf2 expression. The HDAC3 promoter was cloned into a dual luciferase vector, psiCHECK-2 (Promega, Madison, WI, USA), as well as predesigned mutation (MUT) and deletion (DEL) plasmids and 100 ng of each of these plasmids, respectively, was transfected into microglia. Subsequent luciferase activity was examined using the dual luciferases detection kit (Promega). The primers used are as the follows: HDAC3 promoter wt–up: CGGTTCCGGGCTGGTGGCTGCGGATACCGGT; HDAC3 promoter wt–dn: TACTAGACGTGAGGGCTAGACTGGTGGCCAA; HDAC3 promoter mut–up: GCACCTCCGAAACCACACTGGGTTCCCAAATGCCTACTCGCGTTGCGGGCCTGGGAC; HDAC3 promoter mut–dn: GTCCCAGGCCCGCAACGCGAGTAGGCATTTGGGAACC CAGTGTGGTTTCGGAGGTGC; HDAC3 promoter del–up: GCACCTCCGAAACCCTGGG TTCCCAAATGCCTACTCGCGTTGCGGGCCTGGGAC; HDAC3 promoter del–dn: GTCCCAGGCCCGCAACGCGAGTAGGCATTTGGGAACCCAGGGTTTCGGAGGTGC.
Statistical Analysis
SPSS v.18.0 software (SPSS Inc., Chicago, IL, USA) was used for the analysis. Results are presented as mean ± standard deviation. The differences between groups were evaluated with a one-way analysis of variance (ANOVA) and post hoc multiple comparisons were performed using Student-Newman-Keuls tests. Numerical data is presented as the absolute values and were compared with the χ2 test. p < 0.05 was considered as statistically significant.
Results
Neuroprotective Effects of VPA Treatment After TBI
Using mNSS to assess neurological functions in all groups, it was found that the sham and sham+VPA group had no significant changes before and after TBI (scored 1–3); the TBI group showed the highest levels of neurological deficits 1 day after TBI and showed a gradual improvement thereafter; the TBI+VPA group showed significantly better neurological functions 3 days after TBI compared to the TBI group (p < 0.05; Figure 1A).
Figure 1
Effects of valproic acid (VPA) treatment on neurological function, brain edema and neuronal apoptosis after traumatic brain injury (TBI). (A) VPA treatment improved neurological functions after TBI. (B) VPA treatment decreased brain water content 3 days after TBI (p < 0.05). (C) A schematic of a brain section after TBI. Areas in red refer to lesion sites and areas in blue refer to sample points. (D) VPA treatment significantly decreased the number of TUNEL-positive neurons after TBI (p < 0.05). (E) VPA treatment decreased the expressions of the apoptotic factors cleaved caspase-3 and Bax in lesioned cortices 3 days after TBI (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.
Effects of valproic acid (VPA) treatment on neurological function, brain edema and neuronal apoptosis after traumatic brain injury (TBI). (A) VPA treatment improved neurological functions after TBI. (B) VPA treatment decreased brain water content 3 days after TBI (p < 0.05). (C) A schematic of a brain section after TBI. Areas in red refer to lesion sites and areas in blue refer to sample points. (D) VPA treatment significantly decreased the number of TUNEL-positive neurons after TBI (p < 0.05). (E) VPA treatment decreased the expressions of the apoptotic factors cleaved caspase-3 and Bax in lesioned cortices 3 days after TBI (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.Brain water content is a critical indicator to evaluate prognosis after TBI (Genét et al., 2017). Compared with the sham and sham+VPA group, brain water content in the TBI group was significantly increased (p < 0.01). Three days after TBI, brain water content reached 83.4%; however, VPA treatment significantly decreased brain water content 3 days after TBI, compared to the TBI group (p < 0.05; Figure 1B).TUNEL staining data confirmed that the sham group and sham+VPA group had a very low apoptotic fraction of neurons 3 days after TBI. VPA treatment significantly decreased TUNEL-positive cells in the TBI+VPA group (p < 0.05; Figures 1C,D). Western blot also demonstrated that expression of apoptotic factors in the lesioned areas were increased in the TBI group after injury. Compared to the TBI group, the apoptotic factors, cleaved caspase-3 and Bax, were significantly decreased in the TBI+VPA group 3 days after TBI (p < 0.05; Figure 1E). These results indicate that VPA treatment has no significant effect on normal brain cortex, however, it does exert a neuroprotective effect in lesioned cortices after TBI.
VPA Inhibits HDAC3 Expression and Increases Histone Acetylation in Lesioned Cortices
Western blot analysis showed that VPA effectively increased acetylation levels of histone H3 and H4 after TBI (p < 0.05; Figures 2A,B). HDAC3 is a class I HDAC that has been shown to play an essential role in cerebral ischemic injury (Sillesen et al., 2016; Yang et al., 2016). However, its functions in TBI remain unclear. Immuohistochemical staining showed that VPA decreased expression levels of HDAC3 in lesioned cortices 3 days after TBI (p < 0.05; Figure 2C). Western blot analysis further demonstrated that expression levels of HDAC3 in the cytosol, nuclei and in total protein levels of cells from lesioned cortices were increased. In addition, compared with the TBI group, VPA effectively decreased HDAC3 expression in the nuclei and total protein of cells from lesioned cortices (p < 0.05), but not in cytosolic proteins (p > 0.05; Figure 2D). HDAC3 activity as measured with the Colorimetric HDAC Activity Assay kit, was similar to western blot results in that VPA inhibited TBI-induced HDAC3 activity (p < 0.05; Figure 2E). Using double immunofluorescence staining to detect co-expression of HDAC3 and NeuN, data showed that HDAC3 expression was increased in NeuN-positive cells 3 days after TBI compared to the sham group. After VPA treatment, HDAC3 expression was significantly decreased in NeuN-positive cells in lesioned areas (p < 0.05; Figure 3). These results indicate that VPA protects neurons against TBI-induced neuronal apoptosis through inhibition of HDAC3 expression and activation.
Figure 2
VPA treatment increases acetylation of histone proteins and inhibits HDCA3 expression in lesioned cortices. (A,B) VPA treatment effectively increased acetylation levels of histone H3 and H4 after TBI (p < 0.05). (C) HDAC3 immunoreactivity in the cortex was significantly decreased by VAP treatment 3 days after TBI (p < 0.05). (D) VPA treatment effectively decreased HDCA3 expression in the nuclei as well as in total protein 3 days after TBI, but not in the cytosolic fraction (p < 0.05). (E) VPA treatment inhibited HDCA3 activity after TBI (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.
Figure 3
VPA treatment inhibits HDCA3 expression in lesion cortices as well as neuronal apoptosis. TBI enhanced the expression of HDAC3 in neurons, which was significantly decreased by VPA treatment (p < 0.05). Arrows point to HDAC3-positive neurons. N = 6 in each group, scale bars = 50 μm.
VPA treatment increases acetylation of histone proteins and inhibits HDCA3 expression in lesioned cortices. (A,B) VPA treatment effectively increased acetylation levels of histone H3 and H4 after TBI (p < 0.05). (C) HDAC3 immunoreactivity in the cortex was significantly decreased by VAP treatment 3 days after TBI (p < 0.05). (D) VPA treatment effectively decreased HDCA3 expression in the nuclei as well as in total protein 3 days after TBI, but not in the cytosolic fraction (p < 0.05). (E) VPA treatment inhibited HDCA3 activity after TBI (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.VPA treatment inhibits HDCA3 expression in lesion cortices as well as neuronal apoptosis. TBI enhanced the expression of HDAC3 in neurons, which was significantly decreased by VPA treatment (p < 0.05). Arrows point to HDAC3-positive neurons. N = 6 in each group, scale bars = 50 μm.
VPA Inhibits Microglial-Mediated Inflammatory Responses in the CNS
Considering the important effects of microglial activation and the subsequent neuroinflammatory response in secondary damage after TBI (Chhor et al., 2016; Kumar et al., 2017), we further investigated the effects of VPA on microglial activation and expression of inflammatory factors 3 days after TBI. Both immunohistochemical staining and western blot analysis showed that activated microglial cells (Iba-1-positive) and astrocytes (GFAP-positive) were increased after TBI (p < 0.05). However, VPA treatment significantly inhibited microglial activation (p < 0.05), but not astrocyte activation (p > 0.05; Figures 4A,B). Expression levels of inflammatory factors (TNF-α, IL-1β and IL-6) were measured after TBI using an ELISA kit with results indicating that the TBI group had significantly higher expression levels of TNF-α, IL-1β and IL-6 compared to the sham group (p < 0.05). Furthermore, VPA treatment decreased TBI-induced enhancement of inflammatory factors (TNF-α, IL-1β and IL-6; p < 0.05; Figure 4C).
Figure 4
VPA treatment inhibits microglial activation and the subsequent inflammatory response in lesioned cortices 3 days after TBI. (A) The microglial marker, Iba-1, was significantly decreased by VPA treatment (p < 0.05), but had no effect on GFAP-positive astrocytes (p > 0.05). (B) VPA treatment decreased Iba-1 protein levels, but not GFAP protein levels. (C) VPA treatment significantly decreased TBI-induced enhancement of tumor necrosis factor (TNF)-α, IL-1β and IL-6 in lesioned cortices 3 days after TBI (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.
VPA treatment inhibits microglial activation and the subsequent inflammatory response in lesioned cortices 3 days after TBI. (A) The microglial marker, Iba-1, was significantly decreased by VPA treatment (p < 0.05), but had no effect on GFAP-positive astrocytes (p > 0.05). (B) VPA treatment decreased Iba-1 protein levels, but not GFAP protein levels. (C) VPA treatment significantly decreased TBI-induced enhancement of tumor necrosis factor (TNF)-α, IL-1β and IL-6 in lesioned cortices 3 days after TBI (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.
VPA Increases Antioxidative Factors Through Activation of the Nrf2/ARE Signaling Pathway
To address the effects of VPA on oxidative stress, ROS production as well as expression of factors related to the Nrf2/ARE signaling pathway were measured. Western blot and immunofluorescence staining were employed to detect Nrf2 in total protein, nuclear and cytosolic extracts, respectively. Data showed that compared to the TBI group, VPA treatment facilitated Nrf2 translocation to the nucleus and increased Nrf2 expression (Figures 5A,B). The activities of ROS, SOD and GSH were measured with respective assay kits. We found that the level of ROS increased approximately 3.8-fold in the TBI group compared to that in the sham group (p < 0.05). VPA treatment decreased ROS activity, while it significantly increased the levels of the antioxidant activities of SOD and GSH in lesioned cortices (p < 0.05; Figure 5C). In addition, VPA treatment significantly decreased the protein expression of ROS and increased acetylation levels of Nrf2 and Nrf2/ARE downstream antioxidative factors, including HO-1, NQO1 and UGT1A1 (Figure 5D). To further investigate the mechanism by which VPA regulates the Nrf2/ARE signaling pathway, a ChIP assay was utilized. The results indicated that Nrf2 had a high binding affinity within the basic transcription element (BTE) region of the HDAC3 promoter. This binding affinity was higher in the TBI+VPA group compared to the TBI group (p < 0.05). IgG antibody alone or the negative control showed no binding affinity (Figure 5E). To test whether Nrf2 interacted with the HDAC3 promoter, we predicted −662 to −648 in HDAC3 promoter region as the BTE site for Nrf2 using JASPAR software. Luciferase assay showed that luciferase activity was dramatically decreased in cells overexpressing Nrf2, while activity increased in cells transfected with Nrf2-siRNA. Mutation or deletion of the BTE had no effect on HDAC3 luciferase activity in either the overexpression or knockdown group (Figure 5F), suggesting VPA regulates Nrf2 expression through inhibition of HDAC3 expression.
Figure 5
VPA treatment inhibits HDCA3 expression and stimulates the Nrf2/ARE signaling pathway. (A) Expression of Nrf2 was increased after TBI. VPA treatment facilitated Nrf2 translocation into the nucleus and increased Nrf2 expression in lesioned cortices. (B) Representative photomicrographs of Nrf2 staining in the experimental groups. (C) The level of reactive oxygen species (ROS) elevated approximately 3.8-fold in TBI group as compared to that in the sham group (p < 0.05). VPA treatment decreased ROS activity, while significantly elevating the levels of the antioxidant activities of SOD and GSH in lesioned cortices (p < 0.05). (D) VPA treatment decreased ROS production and increased the acetylation levels of Nrf2 and Nrf2/ARE downstream antioxidative factors Heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO1) and UGT1A1 (p < 0.05). (E) The ChIP assay showed Nef2 had a high affinity with the BTE region within the HDCA3 promoter. The TBI group had a higher affinity than the sham group, but was statistically lower than the TBI+VPA group (p < 0.05). (F) The dual luciferase assay showed that binding of Nrf2 and the HDCA3 promoter decreased luciferase expression, while knockdown of Nrf2 increased luciferase expression. N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.
VPA treatment inhibits HDCA3 expression and stimulates the Nrf2/ARE signaling pathway. (A) Expression of Nrf2 was increased after TBI. VPA treatment facilitated Nrf2 translocation into the nucleus and increased Nrf2 expression in lesioned cortices. (B) Representative photomicrographs of Nrf2 staining in the experimental groups. (C) The level of reactive oxygen species (ROS) elevated approximately 3.8-fold in TBI group as compared to that in the sham group (p < 0.05). VPA treatment decreased ROS activity, while significantly elevating the levels of the antioxidant activities of SOD and GSH in lesioned cortices (p < 0.05). (D) VPA treatment decreased ROS production and increased the acetylation levels of Nrf2 and Nrf2/ARE downstream antioxidative factors Heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO1) and UGT1A1 (p < 0.05). (E) The ChIP assay showed Nef2 had a high affinity with the BTE region within the HDCA3 promoter. The TBI group had a higher affinity than the sham group, but was statistically lower than the TBI+VPA group (p < 0.05). (F) The dual luciferase assay showed that binding of Nrf2 and the HDCA3 promoter decreased luciferase expression, while knockdown of Nrf2 increased luciferase expression. N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, scale bars = 50 μm.
VPA Protects Neurons Via Enhancement of Autophagy in Lesioned Cortices
Numerous studies have shown that autophagy is involved in oxidative stress and that activation of the Nrf2/ARE signaling pathway is closely related to autophagy (Lastres-Becker et al., 2014; Jang et al., 2016; Pajares et al., 2016). Therefore, changes in autophagy activity after TBI were measured in each of the groups. Immunofluorescence staining and western blot analysis showed that compared to the TBI group, expression levels of the autophagic markers (LC3-II, Beclin, ATG-3 and ATG-7) were dramatically increased in the TBI+VPA group 1 day after TBI (p < 0.05; Figures 6A,B). The autophagic inhibitor, 3-MA, attenuated VPA-induced autophagy and inhibited both VPA-induced activation of the Nrf2/ARE signaling pathway and expression of the antioxidative factors HO-1, NQO1 and UGT1A1 (Figure 6C). To further elucidate VPE-mediated alterations in autophagy after TBI, we tested the effects of 3-MA on the inflammatory response as well as neurological functions following VPA treatment. The results indicated that 3-MA treatment reversed VPA-mediated inhibition of the inflammatory response and attenuated neuroprotective effects associated with VPA treatment (p < 0.05; Figures 6D–F).
Figure 6
VPA treatment enhances autophagy and provides neuroprotection after TBI. (A) TBI enhanced the expression of LC3 in neurons, which was significantly increased by VAP treatment. Arrows indicate LC3-positive neurons. (B) VPA treatment increased the expressions of autophagic markers (LC3-II, Beclin, ATG-3 and ATG-7), while 3-Methyladenine (3-MA) inhibited VPA-induced autophagy (p < 0.05). (C) 3-MA inhibited VPA-induced activation of the Nrf2/ARE signaling pathway as well as expression of antioxidative factors HO-1, NQO1 and UGT1A1 (p < 0.05). (D–F) 3-MA reversed VPA-mediated inhibition of the neuroinflammatory response and brain edema, and attenuated VPA-mediated neuroprotective effects (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, Scale bars = 50 μm.
VPA treatment enhances autophagy and provides neuroprotection after TBI. (A) TBI enhanced the expression of LC3 in neurons, which was significantly increased by VAP treatment. Arrows indicate LC3-positive neurons. (B) VPA treatment increased the expressions of autophagic markers (LC3-II, Beclin, ATG-3 and ATG-7), while 3-Methyladenine (3-MA) inhibited VPA-induced autophagy (p < 0.05). (C) 3-MA inhibited VPA-induced activation of the Nrf2/ARE signaling pathway as well as expression of antioxidative factors HO-1, NQO1 and UGT1A1 (p < 0.05). (D–F) 3-MA reversed VPA-mediated inhibition of the neuroinflammatory response and brain edema, and attenuated VPA-mediated neuroprotective effects (p < 0.05). N = 6 in each group. The values are expressed as mean ± standard deviation; *p < 0.05, **p < 0.01, Scale bars = 50 μm.
Discussion
Based on the established TBI model in rats from Feeney DM group, the current study demonstrated that VPA, a widely used anti-epileptic drug, reduced brain edema, improved neurological functions and decreased neuronal death after TBI, suggesting this drug has neuroprotective effects. These findings are in ageement with previous work from this lab (unpublished data), but the underlying mechanisms involved in the neuroprotective effects of VPA have until now been unclear. VPA, a known inhibitor of HDCAs, has multiple biological activities, including inhibition of HDCAs activity, acetylation of histones and facilitation of gene transcription (Chu et al., 2015; Ji et al., 2015; Wang et al., 2015). In the present study, we demonstrated that expression of HDAC3 was enhanced in lesioned cortices after TBI and expression levels were higher in neurons, suggesting a role for HDCA3 in secondary injury after TBI. VPA effectively decreased nuclear HDCA3 expression and activity after TBI, increased acetylation of histone H3 and H4, reduced expression of apoptotic factors (cleaved caspase-3 and Bax) and limited neuronal apoptosis. In addition, VPA reduced brain edema, and improved neurological function. Taken together, these results indicate that VPA has neuroprotective effects most likely via inhibition of HDCA3 expression and activity (Figure 7).
Figure 7
Schematic illustrating the possible mechanisms of neuroprotective effects of VPA after TBI. As illustrated, TBI-induced microglial activation initiates neuron-glia neuroinflammatory by producing a wide array of proinflammatory factors or mediators such as TNF, IL and INF. Under inflammatory conditions, elevated ROS can enhance Keap1 oxidation causing release of Nrf2. After translocation to the nucleus, Nrf2 binds to antioxidant response element (ARE) initiating expression of antioxidative genes. The expression and translocation of Nrf2 is related to histone deacetylase (HDAC) enzymatic activity and the levels of histone acetylation. VPA controls antioxidant levels and autophagy through regulation of the Nrf2/ARE signaling pathway by inhibiting both the expression and activity of HDAC3. This inhibition further reduces TBI-induced microglial activation and the subsequent inflammatory response, ultimately leading to neuroprotection.
Schematic illustrating the possible mechanisms of neuroprotective effects of VPA after TBI. As illustrated, TBI-induced microglial activation initiates neuron-glia neuroinflammatory by producing a wide array of proinflammatory factors or mediators such as TNF, IL and INF. Under inflammatory conditions, elevated ROS can enhance Keap1 oxidation causing release of Nrf2. After translocation to the nucleus, Nrf2 binds to antioxidant response element (ARE) initiating expression of antioxidative genes. The expression and translocation of Nrf2 is related to histone deacetylase (HDAC) enzymatic activity and the levels of histone acetylation. VPA controls antioxidant levels and autophagy through regulation of the Nrf2/ARE signaling pathway by inhibiting both the expression and activity of HDAC3. This inhibition further reduces TBI-induced microglial activation and the subsequent inflammatory response, ultimately leading to neuroprotection.Microglial activation and the subsequent neuroinflammatory response play important roles in secondary injury after TBI (Chen et al., 2017; Kumar et al., 2017). Excess proinflammatory factors stimulate oxidative stress, increase mitochondrial dysfunction, and promote mitochondrial caspase-dependent neuronal apoptosis (Gao et al., 2017). Our study showed that activation of microglia and expression of inflammatory factors (TNF-α, IL-1β and IL-6) were significantly enhanced in the brain after TBI, and were associated with elevated expression of pro-apoptotic factors. VPA treatment reduced HDCA3 expression in microglia within the lesion area, inhibited microglial activation, and decreased TBI-induced increases in inflammatory factors. These results indicate that VPA exerts its neuroprotective and anti-inflammatory effects via inhibition of HDCA3 expression and activity.The balance between oxidative stress and antioxidative factors is critical for neurodegeneration after TBI and is also related to the overall inflammatory response. ROS released by mitochondria after TBI are essential for the activation of the inflammatory response (Fischer et al., 2012; Roth et al., 2014). In response, oxidative stress-induced autophagy selectively degrades oxidized substances and damaged organelles to reduce oxidative injury, maintain normal mitochondrial function and balance the intracellular microenvironment (Levine and Kroemer, 2008; Lin et al., 2016; Szatmári-Tóth et al., 2016). Our previous study (Zhang L. et al., 2017) showed that the up-regulation of autophagy could attenuate TBI-induced oxidative stress and apoptosis, suggesting a protective role of autophagy after TBI. LC3, Beclin-1, ATG-3 and ATG-7 are important regulators of autophagy, and promote autophagic bubble formation, which is commonly used to test autophagy activity (He et al., 2015; Gao et al., 2017). Caspase-3 and Bax, important apoptotic regulators tested in this study, are also regulated by Beclin-1. Additionally, caspase-mediated cleavage of autophagy-related gene (ATG) and Beclin-1 can switch autophagy into apoptosis (Tang et al., 2017). In the current study, compared with the TBI group, VPA treatment enhanced LC3-positive neurons and the expression of all autophagic markers was dramatically increased, suggesting that VPA improves autophagy in neurons after TBI. These findings were consistent with the observation that VPA treatment reduced neuronal apoptosis following TBI. The PI3K inhibitor, 3-MA, can specifically block autophagosome formation in autophagy (Jin et al., 2016; Lin et al., 2016) and 3-MA administration inhibits VPA-induced activation of autophagy. Meanwhile, 3-MA reverses VPA-mediated inhibition of neuronal apoptosis and attenuates VPA-mediated neuroprotection, suggesting that autophagy plays a critical role in VPA-mediated neuroprotection after TBI.The Nrf2/ARE signaling pathway is an important regulatory pathway for the upregulation of antioxidative factors and initiates the expression of antioxidative genes such as HO-1, NQO1 and UGT, leading to regulation of oxygen free radicals and the inflammatory response (Bonay and Deramaudt, 2015; Cha et al., 2016; Xue et al., 2016; Wasik et al., 2017). Furthermore, both the Nrf2/ARE signaling pathway and autophagy are closely related and are interdependent (Lastres-Becker et al., 2014). Inhibition of the Nrf2/ARE signaling pathway reduces autophagy, and is thus associated with pathogenic processes (Lastres-Becker et al., 2014; Jang et al., 2016; Pajares et al., 2016). In our study, ROS production and the expression of antioxidative factors were significantly increased in the TBI group. VPA treatment decreased ROS production and enhanced the expression of antioxidative factors (i.e., SOD and GSH). VPA treatment also facilitated Nrf2 nuclear translocation and acetylation, suggesting that VPA can activate the Nrf2/ARE signaling pathway. Our results also showed that 3-MA reversed VPA-induced antioxidant enzyme expression by inhibiting Nrf2/ARE signaling. In addition, it was found that 3-MA reversed VPA-mediated inhibition of microglial activation and the subsequent inflammatory response, and attenuated VPA-mediated Nrf2/ARE activation and neuroprotection, suggesting the anti-inflammation and neuroprotective effects of VPA were Nrf2/ARE pathway and autophagy dependent.However, the mechanism of VPA-mediated Nrf2/ARE pathway still needs further clarification. Activation of the Nrf2/ARE pathway is closely related to HDAC enzymatic activity and levels of histone acetylation. Nrf2 acetylation increases its DNA-binding capacity and downstream transcriptional regulation. VPA is a class 1/II histone deacetylase inhibitor. We showed that VPA treatment effectively decreased nuclear HDCA3 expression and activity after TBI. Our western blot analysis further showed the presence of Nrf2 in acetyl-lysine immunoprecipitate fractions, confirming an increase in Nrf2 acetylation after VPA treatment, suggesting that VPA can activate the Nrf2/ARE signaling pathway through elevating Nrf2 acetylation. To further investigate the mechanism by which VPA regulates the Nrf2/ARE signaling pathway, ChIP and dual luciferase assays were used. Results from both the ChIP and dual luciferase assay demonstrated that Nrf2 binded to the HDCA3 promoter and inhibited transcriptional activity. VPA also enhanced the expression of Nrf2 through inhibition of HDCA3 expression, indicating that VPA may activate the Nrf2/ARE signaling pathway, which enhances cellular antioxidative ability through the inhibition of HDCA3 expression and activity. Overall, these results indicate that VPA regulates the Nrf2/ARE signaling pathway, which in turn attenuates oxidative stress levels as well the inflammatory response after TBI, most likely by inhibiting HDCA3 expression and enzymatic activity. Future studies involving Nrf2 knockout mice or HDAC3 siRNA are warranted to further investigate the mechanisms underlying VPA-mediated up-regulation of autophagy. This up-regulation is likely due to elevated Nrf2/ARE signaling through the inhibition of histone deacetylase. Meanwhile, additional in vitro experiments are also needed to confirm the direct effects of VPA on neuronal and microglial activation.
Conclusion
We have shown that microglial activation, oxidative stress, autophagy and the Nrf2/ARE signaling pathway play essential roles in secondary injury after TBI. We then focused our attention on the potential neuroprotective effects of VPA through inhibition of HDCAs activity. Treatment with VPA upregulated the expression of autophagy and Nrf2/ARE pathway after TBI, and there was an increased acetylation level of histone H3, H4 accompanied by decreased transcriptional activity of the HDAC3 promoter in lesioned cortices. In summary, VPA-mediated up-regulation of autophagy and antioxidative response is likely to be due to elevated Nrf2 translocation to the nucleus, acetylation and activity through direct inhibition of HDAC3. This inhibition further reduces TBI-induced microglial activation and the subsequent inflammatory response, ultimately leading to neuroprotection.
Author Contributions
XC: conception and design, writing of the manuscript. MZ, XL and ZF: supported several experiments, acquisition of data, analysis and interpretation of data. HG and YL: statistical analysis and revision of the manuscript. HW: technical support, obtained funding, conception and design, revision of the manuscript. XC, HW, MZ, XL, ZF, HG, YL and WH read and approved the final manuscript.
Conflict of Interest Statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Authors: Vahagn C Nikolian; Isabel S Dennahy; Gerald A Higgins; Aaron M Williams; Michael Weykamp; Patrick E Georgoff; Hassan Eidy; Mohamed H Ghandour; Panpan Chang; Hasan B Alam Journal: J Trauma Acute Care Surg Date: 2018-03 Impact factor: 3.313
Authors: Guohua Wang; Yejie Shi; Xiaoyan Jiang; Rehana K Leak; Xiaoming Hu; Yun Wu; Hongjian Pu; Wei-Wei Li; Bo Tang; Yun Wang; Yanqin Gao; Ping Zheng; Michael V L Bennett; Jun Chen Journal: Proc Natl Acad Sci U S A Date: 2015-02-17 Impact factor: 11.205
Authors: Isabel Lastres-Becker; Nadia G Innamorato; Tomasz Jaworski; Alberto Rábano; Sebastian Kügler; Fred Van Leuven; Antonio Cuadrado Journal: Brain Date: 2013-11-25 Impact factor: 13.501
Authors: Pavel N Lizhnyak; Pretal P Muldoon; Pallavi P Pilaka; John T Povlishock; Andrew K Ottens Journal: J Neurotrauma Date: 2019-07-31 Impact factor: 5.269