The Complete Mitochondrial Genome of the Plant Bug Lygus pratensis Linnaeus (Hemiptera: Miridae).

Lygus pratensis is a phytophagous pest responsible for yield losses in Bt alfalfa and other economic crops in Northwestern China. To better characterize Miridae at the genomic level, the complete mitochondrial (mt) genome of L. pratensis was sequenced and analyzed in this study. The mt genome was amplified via the polymerase chain reaction to generate overlapping fragments. These fragments were then sequenced, spliced, and analyzed to include the examination of nucleotide composition, codon usage, compositional biases, protein-coding genes (PCGs), and RNA secondary structures. Phylogenetic relationships between L. pratensis and other species in different Heteroptera families were also examined. The mt genome was found to be a typical circular genome with a length of 16,591 bp and a total AT content of 75.1%, encoded for 13 PCGs, 22 transfer RNAs (tRNAs), 2 ribosomal RNAs (lrRNA and srRNA), and a noncoding control region. The nucleotide composition of the entire mt genome was heavily biased toward A and T. All of the tRNAs were predicted to have classic clover leaf structures, but three of the tRNAs (tRNAAsn, tRNAHis, tRNAHis) were missing the TΨC loop. The control region (2,017 bp), which was found to be located between 12S and tRNAIle, contained three tandem repeat elements. Phylogenetic analyses showed that L. pratensis is closely related to the other three examined Lygus bugs, and that it is a sister group to Apolygus and Adelphocoris. This study confirms the usability of the mt genome in phylogenesis studies pertaining to the Lygus genus, within Miridae.

Miridae, which belongs to the order Hemiptera, is one of the most diverse families of insects and covers over 1,200 genera and 11,000 species (Cassis and Schuh 2012). Some of species have been associated with serious economic losses of Bt crops in developed and developing countries, alike, including the United States (Bauer et al. 2006), Australia (Fitt et al. 1994), Canada (May et al. 2003), and China (Guo et al. 2005, Wu and Guo 2005, Lu et al. 2008). Lygus pratensis Linnaeus, which is the most common species found in Northwestern China, is one of five species affecting Bt crops in China (Lu et al. 2010). In recent years, L. pratensis has adversely affected alfalfa and other economic crops, and hindered the expansion of the dairy industry in Northwestern China. At present, very few studies have reported on the ecology, phenology, or managements of this pest (Li et al. 2007b, Lu et al. 2010). Furthermore, no molecular markers have been used to investigate L. pratensis population genetics structure or evolutionary patterns, with this insight potentially facilitating forecasting and management protocols.

In insects, mitochondrial (mt) genomes have been extensively studied for marker discovery (Cameron 2014). The insect mt genome consists of a circular, double-stranded molecule that is approximately 14–20 kb and contains a highly conserved exon arrangement comprising 37 genes. The insect mitogenome commonly includes 13 protein-coding genes (PCGs), 22 transfer RNA genes (tRNAs), and 2 ribosomal RNA genes rRNAs, srRNA (12S), and lrRNA (16S) (Boore 1999, Taanman 1999, Cameron 2014). Additionally, the genome contains a major noncoding region known as the A+T-rich region that plays a role in the initiation of DNA replication and transcription (Clayton 1992, Wolstenholme 1992). In recent years, the numbers of complete insect mt genomes have increased. mt genomes are of interest due to their small size, rapid evolution, maternal inheritance, low rate or lack of recombination, and relatively conserved gene content and organization (Gissi et al. 2008, Timmermans et al. 2010). These genomes are widely used as a maternal molecular marker for taxonomy, molecular phylogenetics, population genetics, and phylogeography (Hwang et al. 2001, Ma et al. 2009, Chen et al. 2012). However, phylogenetic analysis based on the current taxon has been limited, thus potentially restricting the usefulness of an mtDNA genome based phylogenetic study (Zhao et al. 2015). Although researchers have conducted some phylogenetic research on Miridae, studies have mainly focused on morphological analyses, with little molecular evidence presented (Schuh et al. 2009).

At present, the L. pratensis mt genome has not been previously reported. Herein, the complete L. pratensis mitogenome was cloned, sequenced, identified, and analyzed. Moreover, gene annotations, mitogenomic structural analysis, nucleotide composition, codon usage, tRNA secondary structure, noncoding and control region. Analyses were also performed. The research presented herein will offer a foundation for examining L. pratensis molecular evolution and provide further insight into the phylogenetic relationships among Hemiptera species.

Materials and Methods

Specimen Collection

Adult L. pratensis species were collected from alfalfa fields in the Helin County Experimental Station at the Institute of Grassland Research (40°60′N, 111°80′E), Chinese Academy of Agricultural Science (Hohhut, Inner Mogolian Province, China) in May 2016. All of the samples were quickly preserved in 100% ethanol at −20°C until arrival at the Inner Mongolia Agricultural University (40°48′N, 111°42′E).

DNA Extraction, PCR Amplification, and Sequencing

Genomic DNA was extracted from eight adults using a DNeasy DNA Extraction kit (AiDeLai Biotech. Co. Ltd, Beijing, China) and mtDNA amplified via the polymerase chain reaction (PCR). Primers were designed to target generally conserved regions and amplified short fragments from 16s, 12s, cox1, atp6, cox3, nad4, cytB, and nad (Table 1). The PCR reaction was carried out with LA Taq polymerase (Takara, Japan) for 35 cycles at 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min/1 kb for the extension. The final MgCl2 concentration in the PCR reaction was 2.0 mmol/liter. The obtained amplicons were then purified, cloned into pMD18-T vectors (Takara Dalian Co., Ltd., Dalian, China), and sequenced.

Table 1.

Primers used for amplifying the complete mt genome

Fragment	Primer name	Nucleotide sequences (5′→3′)	Sequence size (bp)	Starting site–stop site
1	LLF1	ACTAAATCCGTAGAGATC	973	82–1055
	LLR1	CGAAAGTGTCACTATTGATG
2	LLF2	GAATAACAGAAAAGTTATC	1,069	891–1960
	LLR2	CGGTGATTCCCACCGATC
3	LLF3	CATAATGGAGCATCAGTAG	1,108	1796–2904
	LLR3	CAGTATATGAATGTTCAGC
4	LLF4	GATTACCCTGATAGATTC	1,300	2708–4008
	LLR4	ATGCTTGTTGCTGGGTCG
5	LLF5	CCCAATTTGATGAACAAC	1,171	3823–4994
	LLR5	TCCTTTAGGTGGTCATAG
6	LLF6	GATGACGAGATATCGTACG	1,051	4803–5854
	LLR6	GTTATTGTTAACTACATCC
7	LLF7	TTCTAATCTTCGATATCG	1,242	5670–6911
	LLR7	TACCTTATACATCTTCTTG
8	LLF8	CTCACAGTGAATATGACAG	970	6746–7716
	LLR8	TGCTGATTTCTTCAATGG
9	LLF9	TTCGGTTAGTCATAACAG	1,494	7470–8964
	LLR9	GAATGTAGATTAATTCCTAC
10	LLF10	TGCCATCAACATTGAAAG	1,261	8754–10015
	LLR10	GTAAGTCTTATCAATATCC
11	LLF11	CAAACCCTACTTACATCAG	1,297	9833–11130
	LLR11	AATTGATGCAATCATGGC
12	LLF12	GAATCAAGGATTATATAGG	1,322	10909–12231
	LLR12	TGCAACCATTTTCTGATGG
13	LLR13	AGTCTGAGCAACAGCACG	1,091	11950–13041
	LLF13	GATCTAACCTGCCCTATG
14	LLR14	GCTCTATAGGGTCTTCTCG	980	12842–13822
	LLF14	GTCGCTCCCAACATATGTTG
15	LLR15	CTGATACAAAAGGTAAGC	994	13515–14509
	LLF15	GTTTTATTCATGCATATGG
16	LLR16	GTATAACCGCAACTGCTGG	2,530	14328–1659181
	LLR16	CTAATAACAATAATGGTTC

Sequence Analysis, Annotation, and Secondary Structure Predictions

The sequencing data were assembled using BioEdit software as previously described (Hall 1999). Protein-coding regions were identified using ORF Finder on the NCBI website and PCG nucleotide sequences were translated based on invertebrate mtDNA sequences. Sequence alignment was carried out using ClustalX (Thompson et al. 1997). Composition skew analysis was performed to examine base composition, with asymmetry measured according to the formulas (AT skew = [A−T]/[A+T] and GC skew = [G−C]/[G+C]) (Perna and Kocher 1995). MEGA 6.0 was used to calculate base composition and codon usage.

Transfer RNA genes and their predicted secondary structures were identified using tRNAscan-SE (http://lowelab.ucsc.edu/tRNAscan-SE/), with a few of the tRNA genes identified by comparing sequence homologies with tRNAs from other published plant bugs. Two rRNA genes were identified by Blastn on the NCBI website and then validated by performing a homologous gene alignment against other plant bugs. Furthermore, the entire control region was examined for tandem repeats using the Tandem Repeats Finder program (Benson 1999).

Phylogenetic Analyses

Phylogenetic analyses were performed based on 14 complete representative bug mt genomes from GenBank, and 11 Miridae species as follows: Lygus hesperus (NC_024641), Lygus lineolaris (NC_021975), Lygus rugulipennis (KJ170898), L. pratensis (MF188255), Lygus lucorum (NC_023083), Adelphocoris fasciaticollis (KJ001714), Adelphocoris lineolatus (KJ020286), Adelphocoris nigritylus (KJ020287), Adelphocoris suturalis (KJ020288), Trigonotylus caelestialium (KJ170899), and Nesidiocoris tenuis (NC_022677). The remaining species belonged to the Anthocoridae, Reduviidae, and Nabidae families in Hemiptera and included Orius niger (NC_012429), Agriosphodrus dohrni (NC_015842), and Gorpis annulatus (NC_019595). DNA alignments were inferred based on sequences from all 14 of the PCGs and concatenated using ClustalX. Phylogenetic relationships were examined using the neighbor joining (NJ), maximum likelihood (ML), and Bayesian inference (BI) methods. An NJ tree was constructed using MEGA 5.0 with 1,000 bootstrap replicates. ML analysis was conducted using RAxML 7.0 (Stamatakis 2006), with an MtREV model for amino acid sequences used to optimize the topology. Node support was calculated by acquiring bootstrap values from heuristic searches of 1,000 resampled data sets, using the rapid bootstrap feature in RAxML (Stamatakis et al. 2008). BI analysis was carried out using MrBayes 3.2.2 (Ronquist and Huelsenbeck 2003), with two simultaneous runs of 1,500,000 generations conducted for the matrix, with each one sampled every 100 generations with a burn-in of 25%. Stationarity was considered to be reached when the average SD of split frequencies was below 0.01 (Huelsenbeck et al. 2001).

Results

Features of the L. pratensis mt Genome

The complete L. pratensis mt genome is 16,591 bp double-stranded circular molecule (Fig. 1), containing 37 genes (13 PCGs, 22 tRNAs, and 2 rRNAs) and a noncoding region (control region). Twenty-three of the genes were located on the majority strand (J strand, direction: F), while the remaining were on the minority strand (N strand, direction: R; Table 2). In the mitogenome, genes were observed to be overlapped, contiguous, or separated by a few nucleotides. Gene overlaps were observed at 11 gene junctions, with the longest overlap (14 bp) present between the termination of ATPase6 and the initiation of COIII. There were seven spacer sequences in the L. pratensis mitogenome, with the longest intergenic spacer sequence (7 bp) located between tRNA and ND1. The entire L. pratensis mt genome sequence was deposited in GenBank under accession number MF188255.

Fig. 1.

Structure of the Lygus pratensis mt genome. The color blocks contain tRNAs that are labeled according to IUPAC-IUB single-letter amino acid codes. Genes that are underlined undergo transcription from left to right, while those without underlines proceed from right to left.

Table 2.

Organization of the Lygus pratensis mt genome

Gene	Direction	Strand	Position (bp)	Anticodon	Size (bp)	Start codon	Stop codon	Intergenic nucleotide (bp)
tRNA-Ile (I)	F	J	1–65	GAT	65	–	–	0
tRNA-Gln (Q)	R	N	63–131	TTG	69	–	–	−3
tRNA-Met (M)	F	J	132–199	CAT	68	–	–	0
ND2	F	J	200–1,207	–	1,008	ATT	TAA	0
tRNA-Trp (W)	F	J	1,206–1,270	TCA	65	–	–	−2
tRNA-Cys (C)	R	N	1,262–1,325	GCA	63	–	–	−8
tRNA-Tyr (Y)	R	N	1,325–1,391	GTA	66	–	–	0
COI	F	J	1,392–2,925	–	1,534	ATG	T-	0
tRNA-Leu (L)	F	J	2,926–2,991	TAA	66	–	–	0
COII	F	J	2,992–3,672	–	681	ATC	TAA	0
tRNA-Lys (K)	F	J	3,673–3,743	CTT	70	–	–	0
tRNA-Asp (D)	F	J	3,745–3,810	GTC	65	–	–	2
ATPase8	F	J	3,809–3,971	–	162	ATT	TAG	0
ATPase6	F	J	3,965–4,648	–	684	ATG	TAA	−7
COIII	F	J	4,634–5,418	–	784	ATG	T-	−14
tRNA-Gly (G)	F	J	5,419–5,481	TCC	62	–	–	0
ND3	F	J	5,482–5,832	–	352	ATA	T-	0
tRNA-Ala (A)	F	J	5,834–5,895	TGC	62	–	–	1
tRNA-Arg (R)	F	J	5,899–5,965	TCG	67	–	–	3
tRNA-Asn (N)	F	J	5,964–6,028	GTT	65	–	–	−2
tRNA-Ser (S)	F	J	6,028–6,096	GCT	69	–	–	−1
tRNA-Glu (E)	F	J	6,096–6,159	TTC	64	–	–	−1
tRNA-Phe (F)	R	N	6,158–6,219	GAA	62	–	–	−2
ND5	R	N	6,220–7,918	–	1699	ATT	TAA	0
tRNA-His (H)	R	N	7,919–7,983	GTG	64	–	–	0
ND4	R	N	7,984–9,311	–	1,327	ATG	TAA	0
ND4L	R	N	9,303–9,608	–	306	ATT	TAA	−7
tRNA-Thr (T)	F	J	9,611–9,678	TGT	68	–	–	2
tRNA-Pro (P)	R	N	9,679–9,742	TGG	64	–	–	0
ND6	F	J	9,744–10,232	–	489	ATT	TAA	1
CytB	F	J	10,234–11,367	–	1134	ATG	TAA	1
tRNA-Ser (S)	F	J	11,368–11,433	TGA	67	–	–	−1
ND1	R	N	11,441–12,367	–	927	ATT	TAA	7
tRNA-Leu (L)	R	N	12,368–12,431	TAG	64	–	–	0
16S-rRNA (lrRNA)	R	N	12,432–13,681	–	1250	–	–	0
tRNA-Val (V)	R	N	13,682–13,750	TAC	69	–	–	0
12S-rRNA (srRNA)	R	N	13,751–14,575	–	824	–	–	0
Control region	–	–	14,576–16,591	–	2,017	–	–	0

Protein-Coding Genes

The PCGs (11,087 bp) comprised 66.83% of the whole mt genome. Thirteen of the genes were strictly initiated with an ATN start codon to include ATT (6), ATG (5), ATA (1), and ATC (1). The conventional stop codon TAN was also observed to include TAA (9), TAG (1). Furthermore, three of the PCGs (COI, COIII, and ND3) were terminated with a single T as the stop codon (Table 2).

Base Composition and Codon Usage

The nucleotide composition of the L. pratensis mt genome was heavily biased toward A (42.7%) and T (32.4%), while much lower levels were seen for G (10.3%) and C (14.6%). The mt genome had an overall high A+T content of 75.1% with content levels of 74.7% in PCGs, 77.5% in tRNA genes, 79.1% in rRNA genes, and 72.2% in the control region (Table 3). When performing skew statistics on the PCGs, it was clearly shown that PCGs on the J strand were TA-skewed, while the N strand was AT-skewed.

Table 3.

Lygus pratensis mt genome nucleotide composition and skew

Feature	%A	%C	T%	G%	A+T%	ATa skew	GCb skew	No. of nucleotide
Whole genome	42.7	14.6	32.4	10.3	75.1	0.14	−0.17	16591
PCGs	43.8	10.4	30.9	14.9	74.7	0.17	0.18	11087
PCGs (J)	39.2	15.2	33.8	11.8	73.0	0.07	−0.13	6828
PCGs (N)	43.6	7.0	22.4	12.5	66.0	0.32	0.28	4979
tRNA genes	41.3	10.1	36.2	12.4	77.5	0.07	0.10	1427
tRNA genes (J)	41.1	10.8	36.5	11.6	77.6	0.06	0.10	919
tRNA genes (N)	41.7	15.2	35.9	7.3	77.6	0.07	−0.35	521
rRNA genes	44.2	12.8	34.9	8.1	79.1	0.12	−0.22	2074
Control region	36.8	16.2	35.4	11.7	72.2	0.02	−0.16	2017

AT skew = (A−T)/(A+T).

GC skew = (G−C)/(G+C).

The nucleotide AT bias was also reflected in the codon usage. When analyzing the base composition of 13 PCGs, the relative synonymous codon usage (RSCU) values showed that at the third codon position, A or T appeared substantially more often than did G or C (Fig. 2). While the four most used codons included TTT (F), TTA (L), ATT (I), and ATA (I).

Fig. 2.

Relative synonymous codon usage (RSCU) within the Lygus pratensis mt genome.

tRNA and rRNA Genes

Within the L. pratensis mt genome, 22 tRNA genes were identified, with 21 identified using tRNAscan-SE and 1 by sequence comparison with other Hemipterans. All of the identified tRNAs had lengths between 62 bp (tRNA, tRNA, and tRNA) and 70 bp (tRNA; Table 2) and were predicted to have classic clover leaf structures. Furthermore, TΨC loops were found to be missing in tRNA, tRNA, and tRNA. Additionally, 22 unmatched base pairs were predicted within 11 of the tRNAs, with 20 of them being located in the AA arm (9 bp), the TΨC stem (3 bp), or DHU stem (8 bp). The remaining 2 unmatched base pairs included a U-U mismatch in the AA stem of tRNA, and a U-C mismatch in the AA stem of tRNA (Fig. 3).

Fig. 3.

Predicted tRNA secondary structures. Lines (-) indicate Watson–Crick base pairing, with unmatched base pairs indicated by red dots (●    ).

In addition to the identified tRNAs, two rRNAs were also identified. The lrRNA gene (1,250 bp) was found to be located between the tRNA and tRNA genes, while the srRNA gene (1,250 bp) was located between the tRNA gene and the control region. The AT content was 79.1% for these rRNA genes, with lrRNA having a content level of 79.8% and srRNA a level of 78.2%.

Noncoding and Overlapping Regions

The mt noncoding region was found to include short intergenic spacers and a long control region. The L. pratensis mitogenome harbors a total of 17 intergenic spacer sequences that vary from 1 to 7 bp in length and are distributed in seven regions. It also contains a long control region (2,017 bp) that is located between the 12S-rRNA and tRNA-Ile-Gln-Met gene cluster. The control region was found to have an AT content of 72.19%, with a positive AT skew and negative GC skew noted. Moreover, the complete control region contains three tandem repeats and includes a short 24 bp sequence tandemly repeated four times; a 25 bp sequence tandemly repeated three times, with a partial forth; and a 61 bp sequence tandemly repeated eight times (Fig. 4). For the overlapping sequences, a total of 48 bp were identified, throughout 11 regions and ranged in size from 1 to 14 bp (Table 2).

Fig. 4.

Lygus pratensis control region organization. The locations and copy numbers of tandem repeats are indicated with colored ovals, while the remaining sequences are depicted with gray rectangles.

Phylogenetic Analysis

Phylogenetic associations were examined among four Cimicomorpha families, with 14 mt genome sequences utilized. The NJ, ML, and BI analyses all basically generated the same tree topologies (Fig. 5). These findings showed that: 1) L. pratensis is clustered in the same clade as three of the Lygus species; 2) a sister relationship between A. lucorum and several Lygus species was highly supported; 3) among the 11 Miridae mtDNA sequences, 9 species formed a monophyletic; and 4) within Cimicomorpha, Miridae is a sister group to the Anthocoridae (O. niger), Reduviidae (A. dohrni), and Nabidae (G. annulatus) families.

Fig. 5.

Phylogenetic tree construction inferred from 14 PCGs from 11 Miridae species and 3 out-group Miridae. Numbers close to the nodes are bootstrap support values from the NJ analysis, ML analysis, and Bayesian posterior probability analyses. Miridae species ●; Anthocoridae species ●; Reduviidae species ●     ; Nabidae species ●     ; Lygus pratensis ●.

Discussion

In the present study, the complete L. pratensis mt genome (16,591 bp) was cloned, assembled, and analyzed. Similar to most insects, this mt genome contained the standard 13 PCGs, 22 tRNA genes, 2 rRNA genes, and a control region (Zhang et al. 2013). It also shares the same gene arrangement as most of the sequenced Heteroptera mt genomes (Song et al. 2016). Among the Lygus mitogenomes reported in GenBank, L. hesperus (17,747 bp) is the largest, while L. rugulipennis (15,819 bp) is the smallest. All of the identified PCGs have conventional start codons (ATN), and nine have conventional stop codons (TAN). However, three had stops with a single T, with this phenomenon of an incomplete termination codon found in some insects, and sometimes at high frequencies (Liao et al. 2010), and this is presumed to be generated by posttranscriptional polyadenylation (Lee et al. 2006, Cha et al. 2007).

The nucleotide composition showed an AT bias, similar to that seen in the metazoan mt genome, and it is similar to the common strand biases of other bug mtDNA. In the L. pratensis mitogenome, 13 PCGs showed higher TA and GC skews in the N strands than in the J strands, while the J strand tRNAs had a higher GC skew than the N strands. This observation is most likely attributed to asymmetrical mutational constraints during replication (Hassanin et al. 2005, Min and Hickey 2007). Furthermore, the nucleotide AT bias was also reflected in the high AT usage, within codons, with TTT (F), TTA (L), ATT (I), and ATA (I) being the most prevalent.

All of the tRNAs were predicted to form classic clover leaf structures. While the TΨC stem, TΨC loop, DHU stem, and DHU loop were often variable, the AA arms (7 bp), anticodon loops (7 bp), and anticodon stems (5 bp) were invariant. In other insects, some tRNAs have been reported to form DHU arms with one typical loop and deficient DHU stem (Li et al. 2007a, Song and Liang 2009), but herein, the L. pratensis DHU arms were predicted with complete DHU stems and loops. However, mismatched and aberrant loops do exist in some tRNAs (Song et al. 2013). As to whether the function of these abnormal tRNAs is affected, some researchers have proposed that a posttranscriptional RNA editing mechanism might maintain the function of these tRNA genes (Tomita et al. 2002).

Within the mt genome, rRNAs are highly conserved and evolve slowly. It is difficult to precisely determine the ends of rRNA genes, and herein, the ends were assumed to extend to the boundaries of adjacent genes (Boore 2006); however, for the srRNA gene, the 3′ end was determined by comparison with other reported Hemipteran mitogenomes. As is seen in other Miridae species (Wang et al. 2014a), the L. pratensis mitogenome was found to harbor two rRNA genes (lrRNA and srRNA), but further examination into their secondary structures is still required.

The noncoding region located between 12S and tRNA was annotated as the control region, which is involved in original replication and contains the presumed transcriptional initiation (Zhang et al. 1995). This is one of the most variable regions within the mt genome, and contains high rates of nucleotide substitution, insertion, and deletion, with some varied tandemly repeated elements also present at times. The control region is the largest noncoding region in the L. pratensis mt genome (2,017 bp), with the 5′ end adjoining the 12S rDNA and the 3′ end adjoining to tRNA. The varying size of the control region is due to repeat unit copy number variations (Zhang and Hewitt 1997, Wang et al. 2014b). At present, intragenus variations in mtDNA control region, sequences appear to be attributed to distinct structural and evolutionary characteristics, including variable size, conserved structural elements, and tandem repeat sequences. This has been observed in the ‘Adelphocoris’ and ‘Lygus’ genera within the Miridae (Wang et al. 2014a), as well as other true bugs in Hemiptera (Dai et al. 2012; Li et al. 2012, 2013; Song et al. 2013). It has also been suggested that the existence of tandem repeats might be due to replication slippage (Fumagalli et al. 1996). These findings suggest that the variable control region sizes and abundance of tandem repeat elements may be helpful for evolutionary and population genetics studies of this genus.

Phylogenetic analyses clearly revealed a close relationship between L. pratensis and three other Lygus bugs, and it was identified as a sister group to Apolygus and Adelphocoris. Moreover, Miridae was found to be a sister group to three other families within Cimicomorpha, but more taxonomic examination is still required. The findings presented herein are consistent with previous studies (Wang et al. 2014a, b), and contribute an additional mt genome sequence that can be utilized in Miridae genealogical classifications, and further shows why mtDNA is an ideal molecular marker for evolutionary and phylogenesis studies.

In conclusion, the present study confirmed the usability of mtDNA in a phylogenesis study of the Lygus genus, within Miridae.