Literature DB >> 29693138

miR‑378a‑3p exerts tumor suppressive function on the tumorigenesis of esophageal squamous cell carcinoma by targeting Rab10.

Naixin Ding1, Xiujin Sun1, Tingting Wang1, Lei Huang1, Jing Wen1, Yiqin Zhou1.   

Abstract

Esophageal squamous cell carcinoma (ESCC) is a life‑threatening cancer with increasing incidence worldwide. MicroRNAs (miRs) have been reported to be involved in the progression of various types of cancer. In previous studies, the expression of miR‑378a‑3p was shown to be reduced in ESCC tissues. However, the mechanism underlying the effect of miR‑378a‑3p in ESCC remains to be elucidated. By employing a reverse transcription‑quantitative polymerase chain reaction, miR‑378a‑3p expression was tested in ESCC tissues and cell lines. In addition, the effects of miR‑378a‑3p on cell viability, proliferation, apoptosis, migration and invasion were studied using an MTT assay, an EdU assay, flow cytometry analysis, wound healing analysis and a Transwell assay. In the present study, the level of miR‑378a‑3p was significantly downregulated in ESCC clinical tissues and cell lines (EC109 and KYSE150). In addition, the overexpression of miR‑378a‑3p suppressed the viability, proliferation, migration and invasion of the ESCC cells. The upregulated expression of miR‑378a‑3p also increased the expression levels of B‑cell lymphoma 2‑associated X protein and caspase‑3, and decreased the expression levels of matrix metalloproteinase (MMP)‑2 and MMP‑9, which attenuated ESCC tumorigenesis. Furthermore, Rab10 was confirmed to be a direct target gene of miR‑378a‑3p, and was negatively affected by miR‑378a‑3p. The silencing of Rab10 revealed antitumor effects in ESCC cell lines, and the expression of miR‑378a‑3p was negatively correlated with that of Rab10 in ESCC. Collectively, miR‑378a‑3p may act as a tumor‑suppressor in ESCC cells through negatively regulating Rab10.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29693138      PMCID: PMC5979826          DOI: 10.3892/ijmm.2018.3639

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Esophageal carcinoma (EC) is one of the common life-threatening types of cancer with a poor prognosis (1). It was estimated that 442,000 new cases were diagnosed and 440,000 patients succumbed to EC-associated mortality worldwide in 2014 (2). EC can be divided into two major histological types, including esophageal adenocarcinoma and esophageal squamous cell carcinoma (ESCC). ESCC is the main type of esophageal cancer in Asia, particularly in East Asia (3). Despite advances in diagnosis and therapy, the five-year overall survival rate of patients with ESCC remains <20% (4). Therefore, it is essential to identify novel biomarkers and therapeutic targets for ESCC. MicroRNAs (miRNAs) are small, non-coding RNAs, which regulate the expression of target genes at the transcriptional level through binding its 3′-untranslated region (3′-UTR). miRNAs have been considered as critical regulators of various biological and pathological processes, including cell proliferation, development, metabolism and metastasis (5,6). In addition, evidence has shown that miRNAs have been used for diagnosis, prognosis and other clinical purposes in cancer (7). For example, miR-30d-5p was recognized as a promising biomarker for the early screening of high-risk groups and early diagnosis in lung cancer (8). It was also suggested that miR-125a-5p may be key in the development of Kawasaki disease (9). In addition, the aberrant expression of miRNAs has been closely associated with cancer, suggesting that they may act as novel oncogenes or tumor suppressor genes. It has been shown that the demethylation of miR-495 can suppress cell proliferation and migration, and promote breast cancer cell apoptosis by targeting signal transducer and activator of transcription-3 (10). The expression of miR-21 is also increased in gastric cancer, thereby having a pro-oncogenic effect by inhibiting normal cell cycle, and miR-107 suppresses ESCC carcinogenesis through directly targeting cell division cycle 42 (11,12). miR-378a, previously known as miR-378, has two mature strands, including miR-378a-3p and miR-378a-5p, originating from the peroxisome proliferator-activated receptor γ coactivator 1-β gene (13). It has been reported that miR-378a is involved in multiple biological processes. For example, miR-378a is involved in metabolic pathways, and has been shown to be involved in the angiogenic network in tumors (13,14). It has also been reported that miR-378a-3p suppresses the nuclear respiratory factor-1 transcription factor, which is an important regulator of cell growth (15). miR-378a-3p is considered to be a molecular switch regulating the Warburg effect in breast cancer (16). Rab10 is a mammalian homolog of Sec4p, which has also been associated with several of the membrane transport pathways mediated by exocyst proteins (17). Rab10, a member of the RAS oncogene family, has been shown to be involved in the insulin-stimulated translocation of glucose transporter type 4 in adipocytes (18). A previous study demonstrated that Rab10 regulates the transport of Toll-like receptor 4, which is vital for innate immune responses (19). In addition, it was reported that the expression of Rab10 was upregulated in liver cancer tissue samples (20). In a previous study, the expression of miR-378a-3p was significantly decreased in chemotherapy-resistant esophageal cancer cell lines (21). However, the mechanisms underlying the effect of miR-378a-3p in the tumorigenesis of ESCC remain to be elucidated. Therefore, it is necessary to examine the potential molecular mechanisms of miR-378a-3p in the pathogenesis of ESCC. In the present study, it was found that the expression of miR-378a-3p was significantly decreased in ESCC tissues and cell lines. In addition, miR-378a-3p inhibited ESCC cell proliferation, invasion and metastasis. Rab10 was considered to be a target gene of miR-378a-3p, which reversed the antitumor effect of miR-378a-3p in the ESCC cells.

Materials and methods

Clinical ESCC tissue collection

Clinical ESCC tumor tissues and paired adjacent normal tissues were obtained from Jiangsu Cancer Hospital (Jiangsu, China) between March 2015 and March 2017. The age range of patients was between 55 and 78 years, and the ratio of men to women was 12:18. All the tissues were collected during surgical procedures and stored in liquid nitrogen or at -80°C for future use. Written informed consent was obtained from all the patients and the study received approval from the Ethics Committee of Jiangsu Cancer Hospital.

Cell lines, cell culture and cell transfection

Two esophageal cancer cell lines (EC109 and KYSE150) and a human esophageal epithelial cell line (HET-1A) were purchased from the Chinese Academy of Sciences (Shanghai, China). All the cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 U/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2. The Rab10 small interfering RNAs (siRNAs), the control siRNA, miR-378a-3p mimics, miR-378a-3p inhibitors and the corresponding negative control (NC) were purchased from GenePharma Company (Shanghai, China). siRNA target sequences were as follows: Rab10 siRNA, 5′-GGG GTA ATG CAG AAG TGA T-3′ and control siRNA, 5′-GCA TCA TGA TAG TGT ATG A-3′. The cells were seeded at 3×105 cells per well in a 6-well plate and transfected with either Rab10 siRNA, the control siRNA, the miR-378a-3p mimics, the miR-378a-3p inhibitors, or the corresponding NC at a final concentration of 50 nM using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocols.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was isolated and extracted with TRIzol reagent (Invitrogen, USA) and miRNA was extracted using an miRNeasy kit (Qiagen GmbH, Hilden, Germany). The complementary DNA was generated from RNA using a Prime Script RT kit (Takara Biotechnology Co., Ltd., Dalian, China). The expression levels of miR-378-3a-3p and Rab10 were determined using an ABI 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the SYBR-Green PCR kit consisting of a final volume of 20 µl, containing 2 µl cDNA, 10 µl SYBR-Green Mix, 4 µl primer mix and 4 µl ddH2O (Takara Biotechnology Co., Ltd.). The levels of miR-378a-3p and Rab10 were normalized to those of U6 and β-actin, respectively. The primer pairs used in the present study are listed in Table I. Thermocycling conditions were as follows: 95°C for 5 min followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec, then a melting curve analysis from 60 to 95°C every 0.2°C for 1.5 min was obtained. The transcript amount was normalized to U6 and β-actin and quantified using the 2−ΔΔCq method (22).
Table I

Primers used for reverse transcription-quantitative polymerase chain reaction analysis.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
miR-378a-3p CTCAACTGGTGTCGTGGAGTGGGACTGGACTTGGAGTC
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
Rab10GAGTTGGCCGTAGTGAGAGGAGGTCGTACGTCTTCTTCGC
β-actinCCGTTGCCCTGAGGCTCTTT CCTTCTGCATCCTGTCAGCAA

miR, microRNA.

MTT assay

Cell viability was measured using an MTT assay kit (Sigma; EMD Millipore, Billerica, MA, USA). The EC109 and KYSE150 cells were seeded at approximately 5×103 cells per well. Following cultivation for 24, 48 and 72 h, the cells were incubated with 10 µl MTT solution (5 mg/ml) for 4 h at 37°C. The absorbance of each well was measured using a microplate spectrophotometer (Thermo Fisher Scientific, Inc.) at 490 nm.

EdU assay

The cells were seeded at ~1×104 cells per well. Following cultivation for 24 h, 20 µM EdU was added to the culture medium for 8 h at 37°C. The cultured cells were then fixed with 4% paraformaldehyde for 20 min. Triton X-100 (0.2%) was used to permeabilize the nuclear membrane, and PBS containing 10% goat serum (Gibco; Thermo Fisher Scientific, Inc.) was utilized for blocking for 1 h at room temperature. Finally, the cells were then stained using a Cell-Light™ EdU Apollo®488 In Vitro imaging kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol and images were obtained using a fluorescence microscope (Nikon Corporation, Tokyo Japan).

Cell apoptosis and cell cycle analysis

For cell apoptosis analysis, an Annexin V Apoptosis Detection kit I (BD Biosciences, Franklin Lakes, NJ, USA) was used. The transfected ESCC cells (EC109 and KYSE150) were cultured in a 6-well plate. Following transfection for 48 h, the cells were digested with trypsin and washed twice in cold PBS. Subsequently, the cells were processed following the manufacturer's protocols. Finally, apoptosis was assessed using flow cytometry (FACScan; BD Biosciences). For cell cycle analysis, a Cell Cycle kit (BD Biosciences) was used. The cells were harvested and washed twice in PBS following transfection for 48 h. Following fixing and propidium iodide (PI) staining, cell cycle was analyzed by flow cytometry (FACScan; BD Biosciences).

Cell migration and invasion assay

To perform a wound healing assay, 1×106 ESCC cells were seeded into 6-well plates, cultured overnight and transfected with the miR-378a-3p mimics, inhibitors or their corresponding NC for 48 h. A sterile plastic tip was used to scratch the cell layer on reaching confluence. Following replacement of media with serum-free medium for up to 48 h, images of the width of the scratch gap were captured at three time points (0, 24 and 48 h). Transwell chambers (Corning, Incorporated, Corning, NY, USA) were used for the invasion assay. The transfected cells (1×105) were cultured in RPMI-1640 medium in the upper chamber containing a Matrigel-coated membrane (BD Biosciences). Following incubation, the cells were stained with 0.1% crystal violet for 30 min. The numbers of invaded cells were counted from five different fields for each chamber under a light microscope (Nikon Corporation).

Luciferase reporter assay

The 3′-UTRs of Rab10 predicted to interact with miR-378a-3p were amplified from genomic DNA and cloned downstream of the stop codon in a PGL3-control vector (Promega Corporation, Madison, WI, USA). The construct was designated as wild-type (WT) 3′-UTR. The mutated 3′-UTR was amplified by PCR with the WT 3′-UTR as the template using the site-directed mutagenesis kit (Takara Biotechnology Co., Ltd.). The pRL-TK vector (Promega Corporation) was used as an internal control reporter. The cells were harvested 48 h following co-transfection of miRNA with the reporter vector and assayed using a dual luciferase assay (Promega Corporation) according to the manufacturer's protocol.

Western blot analysis

For western blot analysis, protein samples were extracted from the cells or tissues with Protein Extraction Reagent (Pierce; Thermo Fisher Scientific, Inc.). The concentrations of proteins were determined using the BCA Quantification kit (Beyotime Institute of Biotechnology, Beijing, China) for subsequent sodium dodecyl sulfate-poly-acrylamide gel electrophoresis (SDS-PAGE). The proteins (20 µg) were separated by SDS-PAGE (10%) and transferred onto a PVDF membrane. The membrane was blocked using 5% non-fat milk at 25°C for 1 h, and then incubated with primary antibodies overnight at 4°C. The antibodies used were as follows: Anti-human GAPDH antibody (cat no. ab9485; 1:5,000, Abcam, Cambridge, UK), anti-human B-cell lymphoma (Bcl-2) antibody (cat. no. ab196495; 1:2,000, Abcam), anti-human Bcl-2-associated X protein (Bax) antibody (cat. no. ab32503; 1:2,000, Abcam), anti-human caspase-3 antibody (cat. no. ab13847; 1:2,000, Abcam), anti-human caspase-9 antibody (cat. no. ab202068, 1:2,000, Abcam), anti-human MMP-2 antibody (cat. no. ab37150; 1:2,000, Abcam), anti-human MMP-9 antibody (cat. no. ab73734; 1:2,000, Abcam,). Then, the membrane was incubated with anti-goat HRP-conjugated antibody (cat. no. AR1017; 1:5,000, Boster Systems, Inc., Pleasanton, CA, USA) at 25°C for 2 h. GAPDH was used as a loading control.

Target gene prediction

Targetscan (http://www.targetscan.org) was used to predict the targets of miR-378a-3p.

Statistical analysis

SPSS Statistics version 21.0 (IBM SPSS, Armonk, NY, USA) was used to analyze the data. All data are shown as the mean ± standard deviation. Student's t-test and one-way analysis of variance were applied to analyze statistical significance. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-378a-3p levels are significantly decreased in ESCC tissues and cell lines

The levels of miR-378a-3p in clinical samples of 30 cases of ESCC were first examined using RT-qPCR analysis. The expression of miR-378a-3p was significantly reduced in the ESCC tissues, compared with that in the paired adjacent normal tissues (Fig. 1A). Furthermore, the level of miR-378a-3p was analyzed in two ESCC cell lines (EC109 and KYSE150) and a normal esophageal epithelial cell line (HET-1A). Compared with the HET-1A cell line, it was found that the expression of miR-378a-3p was downregulated in the ESCC cell lines (Fig. 1B).
Figure 1

Expression of miR-378a-3p in ESCC tissues and cells. (A) Expression of miR-378a-3p in ESCC tissues of 30 cases and paired normal tissues was examined by RT-qPCR analysis. (B) Expression of miR-378a-3p in ESCC cell lines (EC109 and KYSE150) and a human esophageal epithelial cell was examined by RT-qPCR analysis. For each experiment, n=3 (**P<0.01, vs. control). miR, microRNA; ESCC, esophageal squamous cell carcinoma; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

miR-378a-3p inhibits the proliferation of ESCC cells

To determine the potential role of miR-378a-3p in ESCC proliferation, miR-378a-3p mimics or inhibitors were transfected into cells to upregulate or downregulate the expression of miR-378a-3p in two ESCC cell lines (EC109 and KYSE150), and the transfection efficiency was determined using RT-qPCR analysis. The expression of miR-378a-3p was markedly increased in the cells transfected with miR-378a-3p mimics, and markedly decreased in the ESCC cells transfected with miR-378a-3p inhibitors (Fig. 2A). An MTT assay was performed to examine cell viability. The results demonstrated that the overexpression of miR-378a-3p significantly decreased cell viability, whereas the knockout of miR-378a-3p promoted cell viability in the EC109 and KYSE150 cell lines (Fig. 2B). In addition, the results of the EdU experiment demonstrated that the overexpression of miR-378a-3p significantly decreased cell growth (P<0.01), whereas the knockout of miR-378a-3p promoted cell growth in the EC109 and KYSE150 cell lines (Fig. 2C).
Figure 2

miR-378a-3p inhibits ESCC cell lines proliferation. (A) Transfection efficiency in EC109 and KYSE150 cells transfected with miR-378a-3p mimics or inhibitors were analyzed by reverse transcription-quantitative polymerase chain reaction analysis. (B) EC109 and KYSE150 cells transfected with miR-378a-3p mimics or miR-378a-3p inhibitors were examined using an MTT assay. (C) EdU assays were performed to evaluate cell proliferation (magnification, ×200). For each experiment, n=3 (**P<0.01, vs. control). miR, microRNA; ESCC, esophageal squamous cell carcinoma; NC, negative control.

miR-378a-3p induces ESCC cell apoptosis

To examine the possible function of miR-378a-3p in apoptosis, flow cytometry was performed with the ESCC cells. Compared with the control, upregulation of the expression of miR-378a-3p increased the apoptotic rate of the EC109 and KYSE150 cells, and the cell apoptotic rate was markedly decreased following transfection with miR-378a-3p inhibitors (Fig. 3). The expression of apoptosis-related proteins, including Bcl-2, Bax, caspase-3 and caspase-9, were also analyzed. The results indicated that the overexpression of miR-378a-3p significantly upregulated the levels of Bax, caspase-3 and caspase-9, whereas the level of Bcl-2 was downregulated in the EC109 and KYSE150 cells, compared with levels in the control groups. The downregulated expression of miR-378a-3p negatively affected the expression of Bax, caspase-3 and caspase-9, but positively upregulated the expression of Bcl-2 (Fig. 4). Taken together, miR-378a was shown to promote the apoptosis of ESCC cells.
Figure 3

miR-378a-3p induces esophageal squamous cell carcinoma cell apoptosis. EC109 and KYSE150 cells transfected with miR-378a-3p mimics signifi-cantly increased cell apoptosis, compared with that in the control. For each experiment, n=3 (**P<0.01, vs. control). miR, microRNA; NC, negative control.

Figure 4

miR-378a-3p suppresses the expression of associated proteins. Expression levels of caspase-3, caspase-9, Bcl-2, Bax were analyzed in esophageal squamous cell carcinoma cell lines. For each experiment, n=3 (*P<0.05, vs. control). miR, microRNA; NC, negative control; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein.

miR-378a-3p induces cell cycle arrest in the G1 phase of ESCC cells

To further investigate the role of miR-378a-3p, the present study examined its effect on the cell cycle of EC109 and KYSE150 cells, which were transfected with miR-378a-3p mimics or inhibitors. The overexpression of miR-378a-3p increased the percentage of cells in the G0/G1 phase of the cell cycle, compared with the control, whereas the inhibition of miR-378a-3p reduced the percentage of cells in the G1 phase in the EC109 and KYSE150 cells (Fig. 5), suggesting that miR-378a-3p induced cell cycle arrest at the G1 phase in ESCC cells.
Figure 5

miR-378a-3p inhibits esophageal squamous cell carcinoma cell cycle. EC109 and KYSE150 cells transfected with miR-378a-3p mimics had a significantly higher percentage of cells in the G1 phase of the cell cycle compared with the control. For each experiment, n=3 (**P<0.01, vs. control). miR, microRNA; NC, negative control.

miR-378a-3p suppresses the migration and invasion of ESCC cells

In order to verify the potential role of miR-378a-3p in ESCC cell migration and invasion, which are critical in malignant tumor progression and metastasis, miR-378a-3p mimics or inhibitors were transfected into EC109 and KYSE150 cells, respectively. The wound healing assay indicated that the upregulation of miR-378a-3p decreased the migratory ability of the ESCC cells, whereas the downregulation of miR-378a-3p promoted cell migration (Fig. 6A). Furthermore, a Matrigel invasion assay was performed to measure the invasive ability of the ESCC cells. As shown in Fig. 6B, the invasion of ESCC cells was suppressed following transfection with miR-378a-3p mimics. To investigate the effect of miR-378a-3p on cell invasion, western blot analysis was adapted to analyze the expression of MMP-2 and MMP-9. With the upregulation of miR-378a-3p, the levels of MMP-2 and MMP-9 were markedly downregulated in the EC109 and KYSE150 cells, compared with those in the control. However, inhibition of the expression of miR-378a-3p promoted the levels of MMP-2 and MMP-9 (Fig. 7). Therefore, these findings indicated that miR-378a-3p negatively regulated the migration and invasion of ESCC cells.
Figure 6

miR-378a-3p suppresses esophageal squamous cell carcinoma cell migration and invasion. (A) Wound healing assays were used to determine cell migration ability. (B) Invasive abilities of cells were quantified by counting the number of cells that invaded the underside of the porous polycarbonate membrane in a Transwell invasion assay. Images were captured at ×200 magnification (*P<0.05, vs. control, **P<0.01, vs. control). miR, microRNA; NC, negative control.

Figure 7

miR-378a-3p suppresses the expression of MMP-2 and MMP-9. The expression levels of MMP-2 and MMP-9 were analyzed in the esophageal squamous cell carcinoma cell lines. For each experiment, n=3 (**P<0.01, vs. control). miR, microRNA; NC, negative control; MMP, matrix metalloproteinase.

Rab10 is a direct target downstream of miR-378a-3p

To examine the possible downstream regulators of miR-378a-3p, the direct targets of miR-378a-3p were analyzed using the TargetScan prediction programs. The software analysis suggested that Rab10 may be a potential candidate of miR-378a-3p (Fig. 8A). A dual luciferase reporter assay was then performed to identify whether Rab10 was a direct target gene of miR-378a-3p. Compared with the control, the luciferase activity of ESCC cells co-transfected with miR-378a-3p mimics and the 3′-UTR of Rab10 was decreased. However, when the binding site was mutated, the inhibition was attenuated (Fig. 8B). To further clarify their association, the levels of Rab10 were measured in the transfected EC109 and KYSE150 cells (Fig. 8C and D). The findings revealed that the overexpression of miR-378a-3p significantly decreased the mRNA and protein levels of Rab10, whereas inhibiting the expression of miR-378a-3p enhanced the expression of Rab10 in the EC109 and KYSE150 cells. Taken together, miR-378a-3p regulated the expression of Rab10 via binding to its 3′-UTR, and Rab10 was shown to be a direct target of miR-378a-3p.
Figure 8

Rab10 is a direct target of miR-378a-3p in the esophageal squamous cell carcinoma cells. (A) Prediction of the binding between miR-378a-3p and Rab10 using TargetScan software. (B) A dual-luciferase reporter assay was performed to verify the binding of miR-378a-3p with Rab10. (C) Reverse transcription-quantitative polymerase chain reaction and (D) western blot assays were performed to detect the levels of Rab10 in EC109 and KYSE150 cells treated with miR-378a-3p mimics and miR-378a-3p inhibitors. For each experiment, n=3 (*P<0.05, vs. control, **P<0.01, vs. control). miR, microRNA; NC, negative control; 3′UTR, 3′-untranslated region; WT, wild-type; MUT, mutated.

Downregulated Rab10 inhibits proliferation, invasion and migration in ESCC cell lines

To examine whether Rab10 was a substantial target of miR-378a-3p involved in the carcinogenesis of ESCC, loss-of-function assays were performed by silencing endogenous Rab10 in ESCC cells, and the silencing efficiency was detected through RT-qPCR and western blot analyses. A specific siRNA targeting Rab10 (siRab10) was then transfected into EC109 and KYSE150 cells to suppress the expression of Rab10 (Fig. 9A and B). As shown in Fig. 9C, the MTT assay showed that silencing Rab10 in the ESCC cells markedly reduced the viability of EC109 and KYSE150 cells. In addition, the knockdown of Rab10 suppressed ESCC cell migration and invasion (Fig. 10A and B). Furthermore, the expression levels of critical proteins involved in proliferation, migration and invasion were measured. The levels of caspase-3 and caspase-9 were enhanced by the knockdown of Rab10 in EC109 and KYSE150 cells, whereas those of MMP-2 and MMP-9 were significantly decreased in the cells transfected with siRab10 (Fig. 10C).
Figure 9

Downregulation of Rab10 inhibits ESCC cell line proliferation. (A) Reverse transcription-quantitative polymerase chain reaction and (B) western blot analyses were used to show the efficiency rate in ESCC cell with siRab10 transfection. (C) Cell proliferation rate was examined using MTT. ESCC, esophageal squamous cell carcinoma; NC, negative control; siRab10, small interfering RNA targeting Rab10.

Figure 10

Downregulation of Rab10 inhibits ESCC cell line invasion and migration. (A) Cell migration was analyzed in EC109 and KYSE150 cells using a wound healing assay (magnification, ×100). (B) Invasive ability of cells was quantified by counting the number of cells that invaded the underside of the porous polycarbonate membrane in a Transwell invasion assay (magnification, ×200). (C) Protein levels were assayed in ESCC cell lines. (D) Association between Rab10 and miR-378a-3p in ESCC tissues. For each experiment, n=3 (**P<0.01, vs. control). ESCC, esophageal squamous cell carcinoma; NC, negative control; siRab10, small interfering RNA targeting Rab10; MMP, matrix metalloproteinase.

In addition, the present study investigated the association between Rab10 and miR-378a-3p in ESCC tissues. As shown in Fig. 10D, the expression level of Rab10 was inversely correlated with that of miR-378a-3p. Taken together, these observations suggested that Rab10 acts as target gene of miR-378a-3p and is involved in regulating the proliferation, migration and invasion of ESCC cells.

Discussion

Numerous biological processes are involved in carcinogenesis, including cell proliferation, apoptosis, migration, invasion and EMT (23). Under the complicated physiological processes, vast regulatory networks of oncogenes and tumor-suppressor genes exist. miRNAs exert a marked effect, mainly through controlling the expression of target genes (24). Ectopic miRNA expression has been reported to be important in the initiation and progression of various types of cancer. Several previous studies have shown that the expression of miR-378a-3p is markedly decreased in various tumors. In a previous study, the level of miR-378a-3p was found to decline in rhabdomyosarcoma tissues and cell lines (25). The upregulated expression of miR-378a-3p markedly reduced the phosphorylation level of Akt and inhibited the expression of insulin-like growth factor 1 receptor in colorectal cancer cells. Nagalingam et al (26) showed that miR-378a-3p contributed to the development of cardiac fibrosis via decreasing the expression of transforming growth factor-β. miR-378a-3p was also found to suppress hepatic stellate cell activation through targeting Gli3 (26-27). In the present study, it was revealed that the expression of miR-378a-3p was significantly decreased in ESCC tissues and cell lines, compared with that in non-tumor tissues and a normal esophageal epithelia cell line, respectively. The effect of miR-378a on ESCC tumorigenesis and progression was also identified. As expected, the overexpression of miR-378a-3p markedly suppressed cell proliferation, promoted cell apoptosis and induced cell cycle arrest at the G0/G1 phase. In addition, the upregulated expression of miR-378a-3p significantly decreased the cell migration and invasion abilities, which are key factors in tumor metastasis. The findings suggested that miR-378a-3p functioned as a tumor suppressor in the progression of ESCC through regulating a variety of cellular physiological processes. Rab10 is a small protein with a GTP-binding domain and belongs to the Rab family of GTPases, which controls intercellular vesicle trafficking. As with other members of this family, Rab10 usually exists in two states, comprising an active GTP-binding state, localized in the cell membrane, and an inactive GDP-bound state located in the plasma, thus forming a cycle (28-29). The complicated cycle is realized by the GDP dissociation inhibitor, guanine nucleotide exchange factor and GTPase-activating protein. Rab10 is expressed in adipocytes and is required for the protein translocation of insulin-stimulated glucose transporter 4 (18). It was found that Rab10 induced EH domain binding protein-1 bridging between filamentous actin and tubular recycling endosomes (30). In addition, the phosphorylation of endogenous Rab10 has been applied to evaluate the activity of leucine-rich repeat kinase 2 kinase, which has a vital role in inherited Parkinson's disease. As a nuclear high mobility group box 1-binding protein, Rab10 is associated with protein translocation and secretion in colon cancer cells (31-32). Although previous studies have indicated that Rab10 is expressed at high levels in certain liver cancer tissues (20), its function and underlying molecular mechanisms in ESCC remain to be fully elucidated. In the present study, Rab10 was identified as a functional target of miR-378a-3p. The overexpression of miR-378a-3p attenuated the luciferase reporter activity by binding the wild-type 3′-UTR of Rab10. In addition, the upregulation of miR-378a-3p decreased the level of Rab10, whereas the knockdown of Rab10 markedly reduced ESCC cell proliferation, migration and invasion. Taken together, these data suggested that Rab10 acts as a critical downstream mediator of miR-378a-3p function in ESCC. In conclusion, the results of the present study indicated that the expression of miR-378a-3p was downregulated in clinical ESCC tissues and cells. miR-378a-3p mediated carcinogenesis by suppressing ESCC cell proliferation, invasion and migration. In addition, Rab10 was identified as a direct target of miR-378a-3p, and Rab10-silencing resulted in similar effects on the cells as observed following the overexpression of miR-378a-3p. Therefore, miR-378a-3p exerted its antitumor effect via repressing the progression of ESCC by targeting Rab10.
  32 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  The diverse functions of microRNAs in animal development and disease.

Authors:  Wigard P Kloosterman; Ronald H A Plasterk
Journal:  Dev Cell       Date:  2006-10       Impact factor: 12.270

Review 3.  Oesophageal cancer in 2014: Advances in curatively intended treatment.

Authors:  Jesper Lagergren
Journal:  Nat Rev Gastroenterol Hepatol       Date:  2014-12-02       Impact factor: 46.802

4.  miR-107 functions as a tumor suppressor in human esophageal squamous cell carcinoma and targets Cdc42.

Authors:  Priyanka Sharma; Neeru Saini; Rinu Sharma
Journal:  Oncol Rep       Date:  2017-04-03       Impact factor: 3.906

5.  Analysis of nuclear high mobility group box 1 (HMGB1)-binding proteins in colon cancer cells: clustering with proteins involved in secretion and extranuclear function.

Authors:  Hanna Lee; Nara Shin; Meiying Song; Un-Beom Kang; Jeonghun Yeom; Cheolju Lee; Yeong Hee Ahn; Jong Shin Yoo; Young-Ki Paik; Hoguen Kim
Journal:  J Proteome Res       Date:  2010-09-03       Impact factor: 4.466

6.  Differential expression profiles of microRNAs as potential biomarkers for the early diagnosis of lung cancer.

Authors:  Yanqiu Zhang; Jing Sui; Xian Shen; Chengyun Li; Wenzhuo Yao; Weiwei Hong; Hui Peng; Yuepu Pu; Lihong Yin; Geyu Liang
Journal:  Oncol Rep       Date:  2017-04-28       Impact factor: 3.906

7.  Insulin-stimulated GLUT4 protein translocation in adipocytes requires the Rab10 guanine nucleotide exchange factor Dennd4C.

Authors:  Hiroyuki Sano; Grantley R Peck; Arminja N Kettenbach; Scott A Gerber; Gustav E Lienhard
Journal:  J Biol Chem       Date:  2011-03-22       Impact factor: 5.157

8.  Global incidence of oesophageal cancer by histological subtype in 2012.

Authors:  Melina Arnold; Isabelle Soerjomataram; Jacques Ferlay; David Forman
Journal:  Gut       Date:  2014-10-15       Impact factor: 23.059

9.  miR-378a-3p modulates tamoxifen sensitivity in breast cancer MCF-7 cells through targeting GOLT1A.

Authors:  Kazuhiro Ikeda; Kuniko Horie-Inoue; Toshihide Ueno; Takashi Suzuki; Wataru Sato; Takashi Shigekawa; Akihiko Osaki; Toshiaki Saeki; Eugene Berezikov; Hiroyuki Mano; Satoshi Inoue
Journal:  Sci Rep       Date:  2015-08-10       Impact factor: 4.379

10.  Deep Sequencing the microRNA profile in rhabdomyosarcoma reveals down-regulation of miR-378 family members.

Authors:  Francesca Megiorni; Samantha Cialfi; Heather P McDowell; Armando Felsani; Simona Camero; Alessandro Guffanti; Barry Pizer; Anna Clerico; Alessandra De Grazia; Antonio Pizzuti; Anna Moles; Carlo Dominici
Journal:  BMC Cancer       Date:  2014-11-25       Impact factor: 4.430

View more
  15 in total

1.  Morphine modulates the expression of mu-opioid receptor exon 5-associated full-length C-terminal splice variants by upregulating miR-378a-3p.

Authors:  Zhigang Lu; Jin Xu; Qian Wang; Ying-Xian Pan
Journal:  FASEB J       Date:  2020-01-30       Impact factor: 5.191

2.  MiR-378a-3p Acts as a Tumor Suppressor in Colorectal Cancer Stem-Like Cells and Affects the Expression of MALAT1 and NEAT1 lncRNAs.

Authors:  Giorgia Castellani; Mariachiara Buccarelli; Valentina Lulli; Ramona Ilari; Gabriele De Luca; Francesca Pedini; Alessandra Boe; Nadia Felli; Mauro Biffoni; Emanuela Pilozzi; Giovanna Marziali; Lucia Ricci-Vitiani
Journal:  Front Oncol       Date:  2022-06-24       Impact factor: 5.738

3.  LINC00441 promotes cervical cancer progression by modulating miR-450b-5p/RAB10 axis.

Authors:  Haiyan Han; Qingchun Shao; Xuejie Liu
Journal:  Cancer Cell Int       Date:  2020-08-04       Impact factor: 5.722

4.  EPA significantly improves anti-EGFR targeted therapy by regulating miR-378 expression in colorectal cancer.

Authors:  Wen-Hui Weng; Wai-Hung Leung; Yeu Jye Pang; Li-Wei Kuo; Hsi-Hsien Hsu
Journal:  Oncol Lett       Date:  2018-09-05       Impact factor: 2.967

5.  LncRNA136131 suppresses apoptosis of renal tubular epithelial cells in acute kidney injury by targeting the miR-378a-3p/Rab10 axis.

Authors:  Zhifen Wu; Jian Pan; Jurong Yang; Dongshan Zhang
Journal:  Aging (Albany NY)       Date:  2022-04-28       Impact factor: 5.682

6.  Long Non-Coding RNA LINC00152 Regulates Cell Proliferation, Migration And Invasion In Esophageal Squamous Cell Carcinoma Via miR-107/Rab10 Axis.

Authors:  Zhigang Zhou; Fei Huang
Journal:  Onco Targets Ther       Date:  2019-10-17       Impact factor: 4.147

7.  Overexpression of LBX2 associated with tumor progression and poor prognosis in colorectal cancer.

Authors:  Xiaodong Huang; Yujie Yang; Chao Yang; Huali Li; Huangrong Cheng; Yongbin Zheng
Journal:  Oncol Lett       Date:  2020-03-27       Impact factor: 2.967

8.  Down-Regulation of miR-378d Increased Rab10 Expression to Help Clearance of Mycobacterium tuberculosis in Macrophages.

Authors:  Yifan Zhu; Yao Xiao; Delai Kong; Han Liu; Xi Chen; Yingyu Chen; Tingting Zhu; Yongchong Peng; Wenjun Zhai; Changmin Hu; Huanchun Chen; Si Zhu Suo Lang; Aizhen Guo; Jiaqiang Niu
Journal:  Front Cell Infect Microbiol       Date:  2020-03-17       Impact factor: 5.293

9.  LncRNA TUG1 Regulates Cell Viability and Death by Regulating miR-193a-5p/Rab10 Axis in Acute Myeloid Leukemia.

Authors:  Qun Li; Jianmin Wang
Journal:  Onco Targets Ther       Date:  2020-02-13       Impact factor: 4.147

10.  LINC00174 Facilitates Cell Proliferation, Cell Migration and Tumor Growth of Osteosarcoma via Regulating the TGF-β/SMAD Signaling Pathway and Upregulating SSH2 Expression.

Authors:  Changjun Zheng; Ronghang Li; Shuang Zheng; Hongjuan Fang; Meng Xu; Lei Zhong
Journal:  Front Mol Biosci       Date:  2021-06-17
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.