| Literature DB >> 29686506 |
Amir Majlesi1, Reza Kamali Kakhki2, Amir Sasan Mozaffari Nejad3, Rasoul Yousefi Mashouf2, Amir Roointan4, Malek Abazari5, Mohammad Yousef Alikhani2,6.
Abstract
Plasmid mediated quinolone resistance (PMQR) determinants have arisen as a significant concern in recent years. The aim of this study was screening of resistant-clinical isolates to fluoroquinolone antibiotics and detection of qnr and aac(6')-Ib-cr genes. For this purpose we collected 100 fluoroquinolone-resistant Enterobacteriaceae which were from 3 hospitals in Hamadan, west provinces of Iran, between October 2012 and June 2013. The all samples were identified by biochemical tests and confirmed by PCR method. Antimicrobial susceptibility to 14 antimicrobial agents including levofloxacin and ciprofloxacin were determined by disk diffusion methods and ciprofloxacin MIC was obtained by broth microdilution method as Clinical Laboratory Standards Institute (CLSI) recommendations. The isolates were screened for the presence of qnrA, qnrB, qnrS and aac(6')-Ib-cr genes using PCR assay. Among the screened isolates, 64 strains (64%) of Escherichia coli, 23 strains (23%) of Klebsiella pneumoniae, 13 strains (13%) of Proteus mirabilis were collected as quinolone-resistant isolates. out of 100 isolates, two (2%) were positive for qnrS, seventeen (17%) isolates were positive for qnrB and we did not find qnrA gene in any of the isolates. There were also 32 positive isolates for aac(6')-Ib-cr determinant. We described the prevalence of qnr and aac(6')-Ib-cr genes in fluoroquinolone-resistant Enterobacteriaceae in Hamadan city. The carriage rate of multidrug-resistant Enterobacteriaceae in healthy people in Hamadan City is extremely high. Moreover, genes encoding transferable quinolones, in particular aac(6')-Ib-cr, are highly prevalent in these strains.Entities:
Keywords: Antibiotic resistance; Enterobacteriaceae; Fluoroquinolone; Plasmid; Quinolone resistance
Year: 2016 PMID: 29686506 PMCID: PMC5910648 DOI: 10.1016/j.sjbs.2016.11.019
Source DB: PubMed Journal: Saudi J Biol Sci ISSN: 1319-562X Impact factor: 4.219
PCR primers used in this study.
| Primer | Primers | Size bp | References |
|---|---|---|---|
| CAGGTCGTCACGGTAACAAG | 512 bp | ||
| GTGGTTCAGTTTCAGCATGTAC | |||
| TTGCGATGCTCTATGAGTGGCTA | 482 bp | ||
| CTCGAATGCCTGGCGTGTTT | |||
| AGAGGATTTCTCACGCCAGG | 580 bp | ||
| TGCCAGGCACAGATCTTGAC | |||
| GGMATHGAAATTCGCCACTG | 264 bp | ||
| TTTGCYGYYCGCCAGTCGAA | |||
| GCAAGTTCATTGAACAGGGT | 428 bp | ||
Comparison of aac(6′)-Ib-cr-positive and aac(6′)-Ib-cr-negative isolates with antibiotics resistant.
| Total | |||||
|---|---|---|---|---|---|
| Negative No (%) | Positive No (%) | ||||
| Kanamycin | R | 45 (66.2) | 30 (93.8) | 75 (75) | 0.716 |
| I | 6 (8.8) | 0 (0) | 6 (6) | ||
| S | 17 (25) | 2 (6.3) | 19 (19) | ||
| Ciprofloxacin | R | 65 (95.6) | 32 (100) | 97 (97) | 0.079 |
| S | 3 (4.4) | 0 (0) | 3 (3) | ||
| Levofloxacin | R | 57 (83.8) | 28 (87.5) | 85 (85) | 0.573 |
| I | 4 (5.9) | 2 (6.3) | 6 (6) | ||
| S | 7 (10.3) | 2 (6.3) | 9 (9) | ||
The antibiotic resistance patterns of clinical isolates.
| Antibiotic | Resistance No (%) | Intermediate No (%) | Sensitive No (%) |
|---|---|---|---|
| Aztreonam | 84 (84) | 8 (8) | 8 (8) |
| Amikacin | 33 (33) | 11 (11) | 56 (56) |
| Ceftazidime | 89 (89) | 4 (4) | 7 (7) |
| Cefotaxime | 97 (97) | 1 (1) | 2 (2) |
| Ciprofloxacin | 97 (97) | 0 (0) | 3 (3) |
| Cefepime | 61 (61) | 21 (21) | 18 (18) |
| Doxycycline | 77 (77) | 11 (11) | 12 (12) |
| Kanamycin | 75 (75) | 6 (6) | 19 (19) |
| Trimethoprim-sulfamethoxazole | 90 (90) | 0 (0) | 10 (10) |
| Levofloxacin | 85 (85) | 6 (6) | 9 (9) |
| Imipenem | 0 (0) | 8 (8) | 92 (92) |
| Meropenem | 0 (0) | 0 (0) | 100 (100) |
| Ertapenem | 7 (7) | 11 (11) | 82 (82) |
Ciprofloxacin MIC of isolated bacteria.
| Break point | Resistance (⩾1 μg/ml) | Intermediate (0.12–0.5 μg/ml) | Sensitive (⩽0.06 μg/ml) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| MIC (μg/ml) | 1 | 2 | 4 | 8 | ⩾16 | 0.125 | 0.25 | 0.5 | ⩽0.06 |
| Isolates (no) | 0 | 2 | 0 | 0 | 89 | 0 | 3 | 6 | 0 |
| Total (%) | 91 | 9 | 0 | ||||||
Prevalence of qnr and aac(6′)-Ib-cr genes among Enterobacteriaceae spp.
| Genes | |||
|---|---|---|---|
| 13 (56.5) | 11 (17.2) | 8 (61.5) | |
| 0 (0) | 0 (0) | 0 (0) | |
| 11 (47.8) | 4 (6.25) | 2 (15.4) | |
| 1 (4.34) | 0 (0) | 1 (7.7) |