Home at Last II: Gerbera hieracioides (Kunth) Zardini (Mutisieae, Asteraceae) is really a Chaptalia.

Gerbera hieracioides (Kunth) Zardini of the Gerbera-complex (Mutisieae, Asteraceae/Compositae) is distributed in Ecuador and Peru. This perennial herb was first named as Onoseris hieracioides Kunth and was later recognised as Trichocline hieracioides (Kunth) Ferreyra. Now it is generally treated as Gerbera hieracioides (Kunth) Zardini but it has never been included in any section of Gerbera. In this study, the position of Gerbera hieracioides is assessed based on morphology and a molecular phylogeny that includes G. hieracioides and 28 other species from the Gerbera-complex. Morphologically, G. hieracioides bears leaves with the adaxial epidermal surface without stomates but with soft thin trichomes, bracteate scapes, trimorphic capitula and inner ray florets with the corolla shorter than the style. These characters suggest that the species is most closely related to Chaptalia rather than to Gerbera or Trichocline. Furthermore, the phylogenetic results based on two nuclear (ITS and ETS) and two chloroplast (trnL-trnF and trnL-rpl32) sequences strongly support the placement of G. hieracioides nested within Chaptalia. As both morphological characters and the molecular phylogenetic results support the transfer of G. hieracioides to Chaptalia, this enigmatic taxon is recognised as Chaptalia hieracioides (Kunth) X.-D. Xu & W. Zheng.

Introduction

(Kunth) Zardini (, ) is a species belonging to the -complex ( L., Cass., Freyn, Benth., Vent., Cass., L. and Zardini). The species is distributed in Ecuador and Peru. This perennial herb was first named as Kunth in 1818. It was transferred to (Kunth) Ferreyra in 1944. In 1974, Zardini moved this species out of because it did not have the characters which were used to define that genus. The apex of achenes is truncate in but tapering or beaked in (Zardini 1974, Hansen 1990). Zardini (1974, 1975) moved it into because it had bracteate scapes, uniseriate ray florets, achenes rostrate at the apex and slender achene hairs. However, and were found to share the same traits such as achenes rostrate at the apex (Katinas 2004) and the transfer of to remained controversial (Hansen 2006).

currently contains about 32 species, which belong to six sections: the three African sections: (8 species), H.V.Hansen (1 species) and (Cass.) Sch.Bip. (6 species), the Aisan section (Less.) C. Jeffrey (7 species), the Madagascar section (Baill.) C. Jeffry (8 species) and section Less. (2 species, one of which is widespread from Asia, Africa and Australia: Hansen 1985a, 1985b, 1988, Johnson et al. 2014, Funk et al. 2016). However, Zardini (1974) did not include in any section of , she only compared it with two species in sect. (Hansen 1988): Bolus ex Adlam and Sch. Bip. Although has the trimorphic capitula similar to those of (Hansen 1985a) from Africa, it has bracteate scapes, suggesting that it is perhaps related to (Hansen 1988) from Asia. Furthermore, the SEM studies showed that the achene hairs of possess a significantly lower L/W ratio than that in either sect. or sect. of (Hansen 1990). Therefore, it was still difficult to place into an existing section (or a new section) of the genus .

is an Old World genus, whereas , and the enigmatic are New World groups (Nesom 2004b, 1995). Recently, phylogenetic analyses of the -complex based on molecular data showed that was placed between and (Baird et al. 2010, Funk et al. 2014, Pasini et al. 2016). This suggested to the authors that the New World may be a species of .

In this study, the authors seek to determine the correct generic placement of by sampling 28 congeneric species using both molecular (two nuclear and two chloroplast markers) and morphological data (leaf adaxial surface, scape and floral morphology).

Materials and methods

A total of 29 species from four genera (, , and ) of the complex and (outgroup) were sampled for PageBreakthis study. Most of the specimens were sampled from the United States National Herbarium (US) of the Smithsonian Institution (Tables 1, 2).

Table 1.

Voucher information and morphological characters of and the related species.

Species	Section	Locality	Voucher information	Adaxial leaf		Bracts on scape	Inner rays
				Stomata	Trichome
Gerbera viridifolia (DC.) Sch.Bip.	Lasiopus	Kenya	T.H. Trinder-Smith s.n. (US)	+	★	−	+
G. jamesonii Adlam	Lasiopus	Cultivar	V.A. Funk s.n. (US)	+	★	−	+
G. aurantiaca Sch.Bip.	Lasiopus	South Africa	Bayliss 2505 (US)	+	★	−	+
G. ambigua Sch.Bip.	Lasiopus	South Africa	M. Koekemoer 2097 (US)	+	★	−	+
G. piloselloides Cass.	Piloselloides	Swaziland	M. Koekemoer 2590 (US)	+	★	−	+
G. cordata Less.	Piloselloides	Madagascar	T.B. Croat 29083 (MO)	+	★	−	+
G. perrieri Humbert	Pseudoseris	Madagascar	L. Gautier 3110 (MO)	+	★	−	+
G. crocea Kuntze	Gerbera	South Africa	M. Koekemoer 2029 (US)	+	≈	+	−
G. wrightii Harv.	Gerbera	South Africa	P. Goldblatt 5287 (US)	+	≈	+	−
G. serrata Druce	Gerbera	South Africa	M. Koekemoer 2001 (PRE)	+	≈	+	−
G. gossypina Beauverd	Isanthus	India	W.N. Koelz 4828 (US)	−	−	+	−
G. maxima Beauverd	Isanthus	India	D.H. Nicolson 2755 (US)	−	−	+	−
G. delavayi Franch.	Isanthus	China	X. Xu 1102 (KMUST)	−	−	+	−
G. nivea Sch.Bip.	Isanthus	China	J.F. Rock 6430 (US)	−	−	+	−
G. henryi Dunn	Isanthus	China	W.B. Hemsley 1903 (US)	−	−	+	−
G. hieracioides (Kunth) Zardini	?	Ecuador	P.M. Peterson 9287 (US)	−	≈	+	+
G. hieracioides (Kunth) Zardini	?	Peru	R. Ferreyra 15362 (US)	−	≈	+	+
Chaptalia pringlei Greene	N	Mexico	Rzedowski 34853 (US)	−	≈	+	+
C. mandonii Burkart	N	Argentina	P.M. Simón 438 (US)	−	≈	+	+
C. meridensis S.F. Blake	N	Venezuela	L. Aristeguieta 2591 (US)	−	≈	+	+
Trichocline cineraria Hook. & Arn.	N	Argentina	A.R. Cuezzo 20mz398 (US)	+	≈	+	-
T. catharinensis Cabrera	N	Brazil	L.B. Smith 11376 (US)	+	≈	+	-

Notes: + designates those mentioned present; − designates those mentioned absent; ★ designates rigid, straight and upright trichomes present on the adaxial leaf surface; ≈ designates soft thin trichomes present on the adaxial leaf surface; N designates data not available.

Table 2.

Voucher information and GenBank accessions of and the related species.

Species	Locality	Voucher information	ITS	ETS	trnL–trnF	trnL–rpl32
Gerbera viridifolia (DC.) Sch. Bip.	South Africa	T.H. Trinder-Smith s.n. (US)	MG661696*	MG661588*	MG661639*	MG661670*
G. crocea Kuntze	South Africa	M. Koekemoer 2029 (US)	MG661709*	MG661606*	MG661645*	MG661683*
G. delavayi Franch.	China	X. Xu 1102 (KMUST)	MG661708*	MG661605*	MG661659*	MG661682*
G. henryi Dunn	China	X. Xu 1103 (KMUST)	MG661706*	MG661602*	MG661655*	MG661681*
G. nivea Sch. Bip.	China	Y.S. Chen 2674 (PE)	MG661703*	MG661598*	MG661648*	MG661678*
G. aurantiaca Sch.Bip.	South Africa	Bayliss 2505 (US)	MG661711*	MG661610*	MG661637*	MG661687*
G. ambigua Sch. Bip.	South Africa	M. Koekemoer 2097 (US)	MG661712*	MG661611*	MG661636*	MG661688*
G. jamesonii Adlam	Cultivar	T. Derby s.n. (US)	MG661704*	MG661599*	MG661638*	MG661679*
G. cordata Less.	South Africa	J. Wen 10067 (US)	N	MG661608*	MG661661*	MG661685*
G. piloselloides Cass.	Swaziland	M. Koekemoer 2590 (US)	MG661701*	MG661592*	MG661650*	MG661675*
G. wrightii Harv.	South Africa	P. Goldblatt 5287 (US)	MG661695*	MG661587*	MG661642*	N
G. serrata Druce	South Africa	M. Koekemoer 2001 (PRE)	MG661697*	MG661590*	MG661656*	MG661671*
G. hieracioides (Kunth) Zardini	Ecuador	P.M. Peterson 9287 (US)	MG661705*	MG661601*	MG661657*	MG661680*
G. hieracioides (Kunth) Zardini	Peru	J. Campos 5255 (US)	N	MG661600*	N	N
Amblysperma scapigera Benth.	Australia	A. Morrison s.n. (US)	MG661713*	MG661612*	N	MG661689*
Adenocaulon chilense Less.	Chile	G.L. Sobel 2558 (US)	MG661714*	N	N	MG661690*
Gerbera maxima Beauverd	India	F. Kingdom 18199 (NY)	KX349402	N	KX349371	N
G. gossypina Beauverd	India	W. Koelz 4294 (US)	GU126777	N	N	GU126755
Adenocaulon chilense Less.	Argentina	J.M. Bonifacino 3997 (LP)	KX349359	N	KX349360	N
Chaptalia nutans (L.) Polák	Argentina	P.M. Simon 477 (US)	GU126772	N	N	GU126751
C. pringlei Greene	Mexico	G. Nesom 4405 (US)	GU126773	N	N	N
C. runcinata Kuntze	Argentina	P.M. Simon 415 (US)	GU126774	N	N	GU126752
C. chapadensis D.J.N. Hind	Argentina	Roque & al. 2188 (ALCB)	KF989508	N	KF989614	N
C. similis R.E. Fr.	Argentina	P.M. Simon 711 (US)	GU126775	N	N	GU126753
C. tomentosa Vent.	USA	V.A. Funk 12303 (US)	GU126776	N	N	GU126754
C. piloselloides (Vahl) Baker	Brazil	E. Pasini 1021 (ICN)	KX349357	N	KX349358	KX349403
Trichocline auriculata Hieron	Argentina	H. Simón & J.M. Bonifacino 633 (US)	KX349386	N	KX349387	N
T. catharinensis Cabrera	Brazil	E. Pasini 915 (ICN)	KX349388	N	KX349389	KX349411
T. caulescens Phil.	Chile	V.A. Funk & al. 13055 (US)	KX349390	N	KX349391	KX349406
T. cineraria Hook. & Arn.	Argentina	E. Pasini & F. Torchelsen 1027 (ICN)	KX349392	N	KX349393	KX349407
T. plicata Hook. & Arn.	Argentina	E. Pasini & F. Torchelsen 1023 (ICN)	KX349396	N	KX349397	KX349409
T. reptans (Wedd.) Hieron	Argentina	E. Pasini & F. Torchelsen 1025 (ICN)	KX349398	N	KX349399	KX349410

Notes: * designates the new sequences from this study; N designates data not available.

Adaxial leaf epidermal morphology. Lamina (0.5–1.0 cm2) were placed with the adaxial side exposed on carbon tape over stubs for the scanning electron microscopy (SEM), without soaking the material in different solutions prior to SEM. The stubs bearing leaves were treated with gold-palladium to 16.6 μm thickness and were examined under a Philips XL-30 scanning electron microscope at the SEM Lab of the National Museum of Natural History (NMNH). The 22 samples were subsequently observed and photographed under SEM. Images of the leaves were captured using the proprietary software associated with the Philips SEM. Images of at least 15 different areas of the adaxial leaf surface were captured.

Floret morphology. The florets and scapes of 20 herbarium specimens were examined in the United States National Herbarium, Smithsonian Institution, using an optical microscope.

DNA extraction, amplification and sequencing. The molecular work was performed in the Laboratory of Analytical Biology (LAB) of NMNH (Smithsonian Institution). DNAs of 16 samples (15 species, including two samples of ) were extracted using the AutoGen. Herbarium leaf samples, along with 1.0 and 2.3 mm diameter beads, were dipped in liquid nitrogen then immediately shaken for 30 seconds at 18000 rpm. About 500 ml of CTAB was added to the tubes, vortexed and incubated overnight (500 rpm at 45 °C). Then 300 µl of the supernatant was transferred to an AutoGen plate. AutoGen was run according to the manufacturer’s default settings (AutoGen, Inc., Holliston, MA, USA).

Four markers including two nuclear ribosomal (ITS and ETS) and two chloroplast intergenic spacers (trnL–trnF and trnL–rpl32) were amplified. The ITS primers were designed by Downie and Katz-Downie (1996) and White et al. (1990), ETS primers by Baldwin and Markos (1998), trnL–trnF primers by Taberlet et al. (1991) and trnL–rpl32 spacer primers by Timme et al. (2007) (Table 3). The PCR reaction mixture had a total volume of 25 µl, comprising 14.05 µl nuclease free water, 2.5 µl 10× buffer, 2 µl dNTPs, 1.25 µl MgCl2, 1 µl of both forward and reverse primers, 0.5 µl BSA, 0.2 µl Taq DNA polymerase and 2.5 µl of template DNA. The amplified products were purified with ExoSapIT enzyme with activation at 37 °C and deactivation at 95 °C. 4 µl of the purified product and same primers (1 µl, 1 µM) were cycle-sequenced in a mixture containing 0.8 µl Big Dye (Applied Biosystems, Foster City, USA) and 2.0 µl 5× Big Dye buffer and 4.2 µl water.

Table 3.

Primers and amplification protocols for all markers.

Marker	Primers and sequences 5′–3′	PCR protocol: initial pre-heating; DNA denaturation; primer annealing; DNA extension; final extension
ITS	ITS5A: GGAAGGAGAAGTCGTAACAAGGITS4: TCCTCCGCTTATTGATATGC	95 °C 1 min; 54 °C 1 min; 72 °C 1 min; 72 °C 10 min; 40 cycles
ETS	18s-ETS: ACTTACACATGCATGGCTTAATCTETS-Hel-1: GCTCTTTGCTTGCGCAACAACT	94 °C 0:30 min; 60 °C 0:40 min; 72 °C 1:20 min; 72 °C 5 min; 30 cycles
trnL–trnF	trnL-Fc: CGAAATCGGTAGACGCTACGtrnL-Ff: ATTTGAACTGGTGACACGAG	94 °C 1 min; 53 °C 1 min; 72 °C 2 min; 72 °C 10 min; 35 cycles
trnL–rpl32	trnL: TACCGATTTCACCATAGCGGrpl32: AGGAAAGGATATTGGGCGG	95 °C 3 min; 51 °C 40 s; 72 °C 1:20 min; 72 °C 5 min; 40 cycles

The cycle sequencing programme was 30 cycles of 95 °C for 30 s, 50 °C for 30 s and 60 °C for 4 min. The resultant product was sephadex filtered and sequenced through an ABI 3730 automated sequencer (Applied Biosystems, Foster City, USA). The PCR reactions were performed in a Veriti PCR Thermal Cycler. The amplification protocols for all markers are summarised in Table 3. Sequences were aligned by using MAFFT (Katoh and Standley 2013) using Geneious 10.0.9. (Biomatters Ltd., Auckland, New Zealand) and checked manually. A total of 57 newly generated sequences from the 16 samples were deposited in GenBank (Table 2).

A total of 37 sequences of 16 species were retrieved from NCBI for the related taxa within the tribe (Table 2). Phylogenetic relationships were inferred based on the concatenated ITS+ETS+trnL–rpl32+trnL–trnF data with MrBayes v. 3.2.2 (Ronquist et al. 2012) by using the substitution model of GTR based on the best-fitting model determined using jModelTest 2.1.6 (Posada 2008), the chain length of 10,000,000, rate variation of gamma, gamma categories of 4, heated chains of 4, heated chain temp. of 0.2, subsampling freq. of 200 and burn-in length of 100,000. Tracer v. 1.5 (Rambaut and Drummond 2009) was used to confirm that the effective sample size (ESS) for all relevant parameters was > 200. After discarding the trees as burn-in, a 50 % majority-rule consensus tree and posterior probabilities (PP) for node support were calculated using the remaining trees.

Results

Adaxial leaf epidermal morphology. The results of the SEM work (Table 1) showed that the two tested samples of have no stomates but have soft, thin and appressed trichomes on the adaxial leaf surface (Figure 1G). These adaxial leaf morphological traits differ from the species: (1) they are different from sections sampled [sect. (4 species), sect. (2 species) and sect. (1 species)] which have stomates and stiff, straight, upright trichomes. Figure 1 has images of one sample for each section: (Fig. 1A), (Fig. 1B) and (Fig. 1D), respectively. (2) they are different from the members of which have stomates and soft, thin and appressed trichomes. Three species from South Africa were examined and represented by (Fig. 1C). (3) they are different from the Asian which have no stomates and no trichomes based on this study of five species of sect. that were examined in the study and are represented by (Fig. 1E): the authors’ observations agree with Lin et al. (2008) for the Asian species . Additionally, the morphological traits of differ significantly from those of the species, which have many stomates with guard cells sunken on the leaf surface, illustrated by (Fig. 1H). However, the two tested samples share the same adaxial leaf epidermal characters such as soft, thin and appressed trichomes, epidermal cell shape and striations and absence of stomates, with the three examined species, as represented by (Fig. 1F). Therefore, based on the adaxial leaf epidermal morphology, is most closely related to rather than to or .

Figure 1.

Adaxial leaf epidermal surface morphology of and the related species. A (sect. ) B (sect. ) C (sect. ) D (sect. ) E (sect. ) F G H . Arrows point to the soft thin trichomes. Scale bar=50 μm.

Scape and floret morphology. The results (Table 1) showed that the two examined samples of have bracteate scapes and trimorphic capitula which have the inner rays with corollae shorter than the styles (Fig. 2G, H). The above morphological traits also differ from those of the species: (1) , sect. and sect. have ebracteate scapes and trimorphic capitula and the inner rays have corollae as long as the styles or longer. (Fig. 2A) and PageBreakPageBreak (Fig. 2B) belong to sect. and (Fig. 2C) for sect. . (2) they are different from and sect. , which have bracteate scapes but dimorphic capitula without inner rays of florets. Three South African species and five Asian species were examined and are illustrated by (Fig. 2D), (Fig. 2E) and (Fig. 2F). The two tested samples share the traits of bracteate scapes and trimorphic capitula which have inner rays with corollae shorter than the styles with the three tested species, represented by (Fig. 2I) and (Fig. 2J). Therefore, based on the scape and floret morphology, should be best considered as a species of rather than .

Figure 2.

Scape and floret morphology of and the related species. A (sect. ) B (sect. ) C (sect. ) D (sect. ) E (sect. ) F (sect. ) G (Ecuador) H (Peru) I J . The arrows mark the styles of inner ray florets.

Phylogenetic analysis. The MrBayes analysis of the combined nuclear markers and two plastid genes showed four clades of the sampled species of the -complex, all with a strong biogeographic signal (Fig. 3): (1) the African and Australian species of the complex (African species are sister to the Australian ), (2) the American genus and the South American , (3) the Asian species and (4) the South American genus . However, there is no well-supported resolution amongst the first three clades mentioned above, so no conclusions can be made about the monophyly of at this time.

Figure 3.

Phylogeny of and the related species. The phylogeny is based on the MrBayes analysis of the combined ITS and ETS, trnL–trnF and trnL–rpl32 markers. The posterior probabilities support values are shown next to branches.

Both samples of were nested within the clade. is sister to ; then the clade is sister to the other species with strong support (posterior probability of 1.00). Therefore, the molecular data also support the placement of in .

Discussion

The molecular phylogeny of the -complex showed that did not group with (Fig. 3) but was nested inside . Furthermore, the leaf adaxial epidermis of has no stomates, while that of usually has many stomates (Fig. 1). In addition, Katinas (2004) presented a key to distinguish the genera of the -complex and and were found to share the same trait of achenes rostrate at the apex but this is not found in .

The confusion about the placement of is no doubt the result of the morphology falling between that of and . A good case concerning this point is the inner ray florets of the trimorphic capitula: has a corolla as long as the style or longer and the staminodes are present, whereas has the corolla shorter than the style and without staminodes (Katinas 2004). As for , the inner ray florets have moderately reduced stamens (Fig. 2G, H) which are different from both and species. Although the stamen morphology of is not identical to , their moderately reduced corollae (Fig. 2G, H) are similar to those of rather than those of , according to Katinas (2004). Furthermore, the characters of leaf adaxial epidermis of including the lack of stomates and the presence of soft thin trichomes, as well as bracteate scapes and cell shape and striations, all suggest that the species is closest to PageBreak. Additionally, Hansen (1990) stated that the achene hairs of are sub-inflated with a lower L/W-ratio than that of . Therefore, the morphological data support the transfer of to that was consistent with the molecular phylogeny (Fig. 3) based on both nuclear ITS and ETS and chloroplast trnL–trnF and trnL–rpl32. This transfer is in agreement with the geographic distribution (Fig. 3), because is from South America and all the other species are from the New World (Nesom 2004b, 1995).

is a New World genus and contains about 70 species in the Americas (Funk et al. 2016). Although there are partial regional treatments, there is no comprehensive monograph of the genus (e.g. Burkart 1944, Cabrera and Nesom 2003, Nesom 2004a, b). Hansen (2006) argued that the most significant problem of the -complex is the lack of a revisionary treatment of and argued for further studies to test whether is monophyletic. In the molecular analysis (Fig. 3), the nine samples (including ) grouped into two well-supported clades. This result indicates that seems to be monophyletic when is included. is typically characterised by differentiated and reduced rays (Hansen 1990): the inner ray florets with corolla strongly reduced, filiform (irregularly tubular, ligulate or bilabiate), shorter than the style and without staminodes (Katinas 2004). The inner ray florets of with moderately reduced corollae and stamens suggest that the inner ray florets of trimorphic capitula may be a key morphological character for the further revisionary treatment of .

As for , this study showed that it falls into two distinct clades, one from Africa which is the sister group of the Australian genus and the other contains all the Asian (Fig. 3). However, the two clades are in a trichotomy with the clade. It is clear that, based on the sampling, the Asian taxa may be best separated out into a separate genus then is the sister genus of African . If the two clades of form a single clade, then will most likely be nested within that clade. The decision must wait for ongoing studies using additional data. However, it is clear that should be considered within .

Taxonomic treatment

(Kunth) X.-D.Xu & W.Zheng comb. nov.

urn:lsid:ipni.org:names:60476046-2

Basionym:

Hieron., Bot. Jahrb. Syst. 21: 368. 1895. [according to IPNI]

(Kunth) Ferreyra, J. Arnold Arbor. 25: 394. 1944, comb. illeg. non Baker (1884).

(Kunth) Zardini, Bol. Soc. Argent. Bot. 16(1–2): 105. 1974.

(as ‘beckeri’) H.Rob., Phytologia 65(1): 47. 1988.

Conclusions

The placement of within is strongly supported by both the molecular sequence data (two nuclear markers ITS and ETS and two chloroplast markers trnL–trnF and trnL–rpl32) and the morphology of the scape, capitula and the leaf adaxial epidermal surface. Therefore, has been transferred to and it is recognised as (Kunth) X.-D. Xu et W. Zheng.