Literature DB >> 29662260

Characterization of multidrug-resistant Acinetobacter ssp. strains isolated from medical intensive care units in Cali - Colombia.

Rómel Fabian Gómez1, Andres Castillo2, Mónica Chávez-Vivas3,4.   

Abstract

INTRODUCTION: The extensive use of antibiotics has led to the emergence of multi-resistant strains in some species of the genus Acinetobacter.
OBJECTIVE: To investigate the molecular characteristics of multidrug-resistant of Acinetobacter ssp. strains isolated from 52 patients collected between March 2009 and July 2010 in medical intensive care units in Cali - Colombia.
METHODS: The susceptibility to various classes of antibiotics was determined by disc diffusion method, and the determination of the genomic species was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and by sequencing of the 16s rDNA gene. Also, the genes of beta-lactamases as well as, integrases IntI1 and IntI2 were analyzed by PCR method.
RESULTS: The phenotypic identification showed that the isolates belong mainly to A. calcoaceticus- A. baumannii complex. All of them were multi-resistant to almost the whole antibiotics except to tigecycline and sulperazon, and they were grouped into five (I to V) different antibiotypes, being the antibiotype I the most common (50.0%). The percent of beta-lactamases detected was: blaTEM (17.3%), blaCTX-M (9.6%), blaVIM (21.2%), blaIMP (7.7%), blaOXA-58 (21.2%), and blaOXA-51 (21.2%). The phylogenetic tree analysis showed that the isolates were clustering to A. baumannii (74.1%), A. nosocomialis (11.1%) and A. calcoaceticus (7.4 %). Besides, the integron class 1 and class 2 were detected in 23.1% and 17.3% respectively.
CONCLUSION: The isolates were identified to species A. baumanii mainly, and they were multiresistant. The resistance to beta-lactams may be by for presence of beta-lactamases in the majority of the isolates.

Entities:  

Keywords:  16S Ribosomal RNA; Acinetobacter Infections; Healthcare Associated Infections; Multiple Drug Resistance

Mesh:

Substances:

Year:  2017        PMID: 29662260      PMCID: PMC5896725          DOI: 10.25100/cm.v48i4.2858

Source DB:  PubMed          Journal:  Colomb Med (Cali)        ISSN: 0120-8322


Introduction

Acinetobacter spp. is reported to be involved in hospital-acquired infections with increasing frequency . The extensive use of antimicrobial chemotherapy in clinical environments has contributed to the emergence and dissemination of nosocomial Acinetobacter spp infections . The species belonging to the A. calcoaceticus-A. baumannii complex (ACB complex) is mostly antibiotic-resistant Acinetobacter strains . This complex has been implicated as the cause of a broad spectrum of infectious diseases such as pneumonia, meningitis, bacteremia, urinary tract infections, and device-related infections, especially in intensive care units (ICUs), and high mortality rates were associated . Due to the organism's multidrug-resistant (MDR) phenotype, these infections are difficult to treat, which includes resistance to beta-lactams, aminoglycosides, fluoroquinolones, and carbapenems , . A significant nosocomial outbreak of MDR ACB complex in Colombia has occurred in the last years . Resistance to beta-lactam agents, including carbapenems in the ACB complex is due mainly to the production of the extended-spectrum beta-lactamases (ESBLs), but can also result from several other mechanisms including alterations in outer membrane proteins and penicillin binding proteins and increased activity of efflux pumps . ESBLs with carbapenemases, such as metallo-beta-lactamases (MBL) or oxacillinases, represent the most concern due to the chance of rapid dissemination . Whereas MBL found are of IMP and VIM types in A. baumannii , the oxacillinases present four main OXA subgroups are the chromosomally located intrinsic OXA-51-like; the acquired OXA-23-like; OXA-40-like; and OXA-58-like - . Most genes encoding these ESBLs are found on plasmids, or in the form of a gene cassette in an integron. Integrons are genetic elements that possess a particular recombination site, known as attI1, into which resistance genes can be inserted by site-specific recombination in the form of gene cassettes . Different integron classes have been described, and the classes 1, 2 and 3 have been associated with antibiotic resistance , . Dissemination of these antibiotic resistance integrons, which are unable to promote their mobilization, is mainly linked to transposons and plasmids. Different reports exist which have identified integrons as responsible for the presence and acquisition of antibiotic resistance A. baumannii have been published , . There is limited data on the global epidemiology of A. baumannii in our region. However, the distribution of class 2 integron is highly frequent in A. baumannii clinical isolates from Argentina, Chile, and Brazil , . The objectives of the present study were to analyze the phenotypic and molecular characteristics of ACB complex and antibiotic resistance in clinical isolates in a Colombian tertiary-care hospital. As well as determine the antimicrobials resistance profiles of the isolated strains. We also tested for the presence of MBL or ESBL producing Acinetobacter spp. To test the hypothesis that most genes encoding MBL or ESBL are found on gene cassettes of integrons, we have examined representative isolates for the presence of class 1 and class 2 integrons and the associated antimicrobial resistance genes by PCR. Knowledge on the epidemiology and molecular mechanisms of antimicrobial resistance in this important pathogen are essential to implement intervention strategies.

Material and Methods

A descriptive study was carried out and was endorsed by the ethics committee of the hospital.

Bacterial strains clinical samples

The study included 52 Acinetobacter ssp strains collected from clinical specimens, previously identified by the Vitek GNI card (bioMeriex Vitek Inc., Hazelwood, MO) that they grew on standard MacConkey agar at 37° C for 48 h, between March 2009 and July 2010 of a medical intensive care unit at Rafael Uribe Uribe University Hospital from Cali - Colombia. The clinical samples were obtained from: the nasal swabs, 24 (46.2%); wounds, 12 (26.1%); catheter tip, 6 (11.6%); the urinary tract, 6 (11.6%); and 4 (7.7%) blood. All of the samples were stored at −80° C in nutrient broth with 15% glycerol. From the 52 Acinetobacter spp clinical isolates strains, 24 (46.2%) were obtained.

Antimicrobial susceptibility testing

The susceptibility to various classes of antibiotics was determined by disc diffusion method on a Mueller-Hinton (MH) agar (Difco Laboratories, Detroit, MI, USA), by the Clinical and Laboratory Standard Institute (CLSI) guidelines . Both strains Acinetobacter baumannii (ATCC® 19606(tm)), and Escherichia coli (ATCC® 25922(tm)) were used as quality control strains. The antibiotic discs (Oxoid ®) tested were the follows: trimetroprim/sulfametoxazol (SXT, 23.75 μg/1.25 μg); ticarcillin/clavulanato (TIM, 75μg/10 μg); gentamicin (GEN, 10 μg); tobramycin (TOB, 10 μg); ciprofloxacin (CIP, 5 μg); ceftazidime (CAZ, 30 μg); cefepime (FEP, 30 μg); aztreonam (ATM, 30 μg); imipenem (IMP, 10 μg); meropenem (MEM, 10 μg); ampicillin/sulbactam (SAM, 10 μg/10 μg); amikacin (AMK, 10 μg); cefoprazone/sulbactam (sulperazona, SUL, 75 μg/30 μg); and tigecycline (TIG, 15 μg). According to Manchanda et al. , the MDR Acinetobacter spp have defined whether the isolates are resistant to three antibiotics different to ceftazidime, such as ciprofloxacin, gentamicin, and imipenem.

Identification of isolates of Acinetobacter spp: Amplified Ribosomal DNA Restriction Analysis (ARDRA)

The genomic species of Acinetobacter spp were determined by ARDRA, according to Vaneechoutte et al. . In brief, the DNA from an overnight culture in LB broth at 37° C was extracted using the "Easy-DNATM" kit (Invitrogen, life technologies ®) according to the manufacturer's instructions. After to electrophoresis, the gel was stained with ethidium bromide (1.5 μg/mL) and analyzed on a FOTO/Analyst(r) Investigator/FX Systems (FOTODYNE Incorporated). For each sample, the PCR reaction was performed for 16S rDNA amplification using the following primer pair: Acf5´-TGG CTC AGA TTG AAC GCT GGC GGC-3´ and Acr5´-TAC CTT GTT ACG ACT TCA CCC CA-3´. The PCR products were digested with the following enzymes: CfoI; Alu; Mbo; and MspI (Fermentas(tm)) and separated by polyacrylamide gel electrophoresis (PAGE 8.0%). The last restriction profiles were compared to strain library database (http://users.ugent.be/~mvaneech/ARDRA/Acinetobacter.html) to identify the species according to Dijkshoorn et al . The A. baumannii (ATCC® 19606(tm)) strain was used as controls.

Identification of clinical isolates of Acinetobacter spp by 16S rDNA PCR-sequencing

The 27 PCR products to 16S rDNA gene were purified using the High Pure PCR product Purification Kit Version 20 kit, according to company instruction (Roche Applied Science®) and then, each purified PCR products were direct sequencing by Sanger dideoxy method using an ABI 3730XL sequencer. The 16S rDNA sequences were aligned with 27 Acinetobacter reference sequences harbored in the GenBank-NCBI dataset. The phylogenetic tree was done using the MEGA software v.5 under Maximum Likelihood model with the Kimura-2-parameters, and Gamma distribution assuming invariable sites (K2+G+I). The robustness of phylogenetic tree was calculated by a bootstrap no parametric with 1,000 replicates , . A Staphylococcus aureus sequence was used as outgroup.

Detection of ESBL genes by PCR

ESBL genes, such as blaTEM; blaSHV; blaOXA; blaCTX-M; blaIMP; and blaVIM, were detected by PCR using the primers are listed in Table 1 - ). The PCR reaction final volume of 50 μl with 5-10 ng (genomic DNA) reaction buffer, 1 U of Taq polymerase (Bioline, London, United Kingdom), 200 µM each deoxynucleoside triphosphate, 1.5 or 2.5 mM MgCl2, 10 pmol of each primer. Thermocycler temperature was 94° C for 5 min; 94° C for 30 s by 35 cycles. To blaTEM, 52° C for 45 s; blaOXA-51 and blaOXA-58, 62° C for 1 min; blaCXT-M, 51° C for 45 s; blaVIM and blaIMP 51° C for 1 min; and 72° C for 60 s. The final step of 10 min at 72° C.
Table 1:

Primers used in the study

PrimerOligonucleotide sequences Size (bp)Reference
rDNA16S ACF-5'_TGGCTCAGATTGAACGCTGGCGGC_3'1,50018
R-5'_TACCTTGTTACGACTTCACCCCA_3'
blaTEMF-5´_ATGAGTATTCAACAT TTCCG_3´95623
R-5´_CTGACAGTTACCAATGCTTA_3´
bla VIMF-5´_AAAGTTATGCCGCACTCACC_3´86524
R-5´_TGCAACTTCATGTTATGCCG_3´
bla IMPF- 5´_ATGAGCAAGTTATCCTTATTC_3´74125
R- 5´_GCTGCAACGACTTGTTAG_3´
blaCTX-M-9F -5´_GTGACAAAGAGAGTGCAACGG_3´85626
R-5´_ATGATTCTCGCCGCTGAAGCC_3´
blaOXA-51F-5´_CGGAGAACGACTCCTCATTAAAAA_3´43127
R-5´_TTTAGCTCGTCGTATTGGACTTGA_3´
blaOXA-58F-5´_AAGTATTGGGGCTTGTGCTG_3´59928
R-5´_CCCCTCTGCGCTCTACATAC_3´
Int1F-5´_CAGTGGACATAAGCCTGTTC_3´16029
R-5'_CCCGAGGCATAGACTGTA_3´
Int2F-5´_TTGCGAGTATCCATAACCTG_3´28829
R-5´_TTACCTGCACTGGATTAAGC_3´
CSR-5´_GGCATCCAAGCAGCAAG_3´Variable29
F-5´_AAGCAGACTTGACCTGA_3´
hep35R-5´_TGCGGGTYAARGATBTKGATTT_3´49130
hep36F-5´_CARCACATGCGTRTARAT_3´

Detection of integrase genes by PCR

The integrase class 1 (intI) and 2 (intII) genes were amplified as previously described , . Amplification for each one was done in 50 µL volumes using 5-10 ng (genomic DNA) reaction buffer, 2 U of Taq polymerase (Bioline, London, United Kingdom), 200 µM each deoxynucleoside triphosphate, 2,0 mM MgCl2, 10 pmol of each primer. PCR conditions were as follows: a hot start at 94° C for 5 min; 94° C for 30 s by 35 cycles, 30 s at both 55° C; and a final step of 10 min at 72° C. The reaction mixture to the degenerate primers hep35 and hep36 were equivalents to the previous except for the concentration of each primer (2.0 µM), and for the PCR extension steps (72o C and 2 min).

Statistical analysis

The data were analyzed using Stata version 11.0 (Stata Corp, College Station, Tex). Categorical variables were analyzed using χ2 test. All tests were two-tailed with p <0.05 considered significant.

Results

Antibiotic susceptibility

Antibiotyping tested by disk diffusion method showed multi-resistance to a large range of antibiotics. Most isolates of Acinetobacter spp. were resistant to trimethoprim /sulfamethoxazole, gentamicin, amikacin, tobramycin, ticarcillin/clavulanic acid, cefepime, ceftazidime, and imipenem. They were resistance rates of 100% while presenting variable susceptibility to ciprofloxacin (51/52, 98.1%), levofloxacin (45/52, 86.5%), ampicillin-sulbactam (49/52, 94.2%) and meropenem (50/52, 96.2%). The antimicrobial agents to which Acinetobacter spp strains were most susceptible were tigecycline and sulperozone. In contrast, 21.2% (11/52) and 28.8% (15/52) of them were resistant to tigecycline and sulperozone, respectively. In addition, all isolates were resistant to at least three classes of antibiotics (imipenem o meropenem, amikacin o tobramycin and extended-spectrum cephalosporins.), hence meeting the criteria for multidrug resistance . Remarkable, from the isolates circulated in July and September 2009, 10 isolates (19.3%) were considered Pan Drug Resistant (PDR) according to with Falagas et al. , demonstrating resistance to all antibiotics tested in this study.

A common antibiotype in unrelated co-circulating strains

Depending upon their susceptibilities to 14 different antimicrobial drugs, the 52 isolates of ACB complex were grouped into five (I to V) different antibiotypes. Most the isolates belonging to antibiotype I (50.0%), with fewer isolates belonging to antibiotype IV (19.3%), antibiotype II (17.3%) and antibiotype V, with only 1.9% of all the isolates. Interestingly, the isolates belonging to antibiotype I were susceptible to tigecycline and sulperozone, and most clinically significant isolates were found in nasal swabs (57.7%), followed by wound and catheter tips (23.1% and 15.4%, respectively) (p <0.05) (Table 2). Twenty-five isolates were collected between June and November of 2009. Only one isolate was detected in May 2010.
Table 2

Antibiotypes of A. baumannii-calcoaceticus complex isolates by sample site, resistance and susceptibility profiles

Antibiotype Isolates n (%)Sample Site Resistance profile Susceptibility profile
Nt n (%)Bl n (%)Ct n (%)Wd n (%)Ur n (%)Us n (%)
I26 (50.0)15 (57.7)1 (3.8)4 (15.4)6 (23.1)-- AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEMTIG, SUL
II9 (17.3)6 (66.7)-2 (22.2)-1 (11.1)-AMK, GEN, TOB, CIP, SXT, TIC/AC, FEP, CAZ, IMPTIG, SUL/ LVX, SAM o MEM
III6 (11.5)1 (16.7)2 (33.3)-1 (16.7)2 (33.3)-AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEMTIG ó SUL
IV10(19.3)*2 (20.0)--5 (50.0)**1 (10.0)2 (20.0)AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEM, TIG, SUL-
V1 (1.9)-1 (100)----AMK, GEN, TOB, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEMTIG, SUL, CIP, LVX
Total52 (100)24 (46.2)4 (7.7)6 (11.5)12 (23.1)4 (7.7)2 (3.8)
The antibiotype IV significantly grouped the PDR (19.3%) isolates (p <0.05) and was detected more frequently in wound (50%; OR = 5.000; p= 0.025). This antibiotype was first detected in March of 2009 and appeared again in July, August, and November of the same year, as well in April, May, and June of 2010. As shown in Table 2, 27 isolates of A. baumannii (37.1%) exhibited five distinct antibiotypes. Twelve of the isolates (54.5%) were classified as having antibiotype I, two (9.1%) isolates to antibiotype III, and four (18.2%) isolates to antibiotype and one (5%) isolate to antibiotype V. Four strains of A. calcoaceticus revealed two distinct antibiotypes, and three strains of 13TU showed three different antibiotypes.

Identification of isolates of Acinetobacter spp

The genomic identification of 52 strains belonging to the ACB complex was performed using the ARDRA method and sequencing (Table 3, ).
Table 3

Distribution and molecular characterization of A. baumannii-calcoaceticus complex isolates.

CodeSample SiteAntibiotype Bla GenesIntegron
OXA-51TEMCTXM-9VIM-2IMP-1OXA-58
5790341Nasal trace1+
5793548Nasal trace1++ +
21262Urine2+
5701177Wound1++ +
1Wound 4+ ++
5793546Nasal trace1+ ++
5702062Nasal trace2+
5701373Wound1++ + +
5704225HWound4+ +
5717479Nasal trace1+
5718164Nasal trace2+ ++
21311Wound1+ +
5728549Wound3+ + +
21499Nasal trace1+ +
5730330Catheter tips1++ +
5748866Blood5+
5749428Nasal trace1+ + +
5761126Catheter tips1+ +
5750598U. secretion4+ +
5723185Nasal trace1+ +
2513Urine3+ ++ +
5759531Nasal trace4++ + +
209021(13TU)Nasal trace3 +
5725011 (13TU)Nasal trace2 + +
5717971 (13TU)Nasal trace1 + ++
Ab3 (A. calcoaceticus) Wound1 ++ +
5701789 (A. calcoaceticus) Nasal trace4 + +
5701372 (A. calcoaceticus) Nasal trace1
85.7%21.4%10.7%25.0%10.7%53.6%28.6%
Table 4

A. baumannii-calcoaceticus complex profiles obtained by amplified rRNA gene restriction analysis (ARDRA)

No.Genotype SequenceARDRA ProfileIsolatesEnzymes
CfoI AluI MboI MspI
1ABAB5704225H1111
2ABABAb196061111
3ABAB25131111
4ABAB57488661111
5ABAB57903411111
6ABAB57303301111
7ABABAb214991111
9ABABAb213111111
10 ABAB57285491111
11ABAB57174791111
12ABAB57935381111
13ABAB57611261111
14ABAB57020621111
16ABAB212621111
17ABABAb11113
18 ABAB57011771113
19 ABAB57595311113
20ABAB57505981113
2113TUAB2090211111
2213TUAB57250111111
2313 TUAB57179711113
24 UDAB57045811111
25 Calcoaceticus 13TU57013722113
26 Calcoaceticus 13TU57017892111
27 UD13TU57486232111
28AB3U57935462133
29UD3U57384062131
30UDUDNAC512241

The resistance profile were: Calcoaceticus=A. calcoaceticus (2 2 1 3); AB= A. baumannii (1 1 1 1 / 1 1 1 3); 3U= Acinetobacter 3U (2 1 3 3); A. haemolyticus (1 4 1 2); 13TU= Acinetobacter 13TU (2 1 1 1 / 2 1 1 3); UD= undefined

The resistance profile were: Calcoaceticus=A. calcoaceticus (2 2 1 3); AB= A. baumannii (1 1 1 1 / 1 1 1 3); 3U= Acinetobacter 3U (2 1 3 3); A. haemolyticus (1 4 1 2); 13TU= Acinetobacter 13TU (2 1 1 1 / 2 1 1 3); UD= undefined The results revealed that 23 (44.0%) isolates had the combined profile '1 1 1 2 3' or '1 1 1 2 1' for the several enzymes CfoI, AluI, MboI, RsaI, and MspI. According to the library of references profiles strains identified the organisms as species 2 (A. baumannii), three (5.8%) were A. nosocomialis (13TU), two were A. calcoaceticus, and two were A. pitti (genospecies 3). For the NCBI-BLAST analysis, 27 strains were queried using sequences of a 1,500 bp fragment of the 16S rDNA. This identification of all clinical isolates to the species level showed that all amplicons had sequence concordance of 61 to 99% . In Figure 1, shown the Acinetobacter genospecies phylogenetic tree by 16s rDNA sequencing analysis. From all isolates, 74.1% (20/27) were clustering with A. baumannii while A. nosocomialis constituted 11.1% (3/27) of the total. However, we find ambiguity between the two methods when defining the genospecies A. calcoaceticus, Acinetobacter 3U, Acinetobacter 13U as shown in Table 4.
Figure 1

Acinetobacter genospecies phylogenetic tree by 16s rDNA sequencing analysis. In total, 27 clinical isolates were compared with Acinetobacter 16s rDNA16 sequences reported in the GenBank-NCBI. The phylogenetic tree was done using the MEGA software v.5 under Maximum Likelihood model with the Kimura-2-parameters, and Gamma distribution assuming invariable sites (K2+G+I). The robustness of phylogenetic tree was calculated by a bootstrap no parametric with 1000 replicates.

Molecular characterization of ESBL genes

All ESBL-producing isolates in ACB complex were subjected to PCR experiments to detect the ESBL genes, including blaTEM, blaSHV, blaCTX-M, blaOXA-51, blaOXA-58, blaVIM, and blaIMP. Thirty-nine isolates (75.0%) carried several bla genes (up to two genes). PCR amplification of class A beta-lactamase genes revealed that 17.3% (9/52) of the isolates carried blaTEM-1 and five (9.6%) isolates contained blaCTXM-9, while blaOXA-58 was found significantly in all carbapenem-resistant A. baumannii strains (p <0.05). The blaTEM-1 gene was identified in four isolates of A. baumannii, and one isolate of A. calcoaceticus. The blaCTXM-9 gene was detected in two isolates of A. calcoaceticus, two isolates of A. baumannii, and one isolate of 13TU, the blaOXA-58 gene was detected in once an isolate of A. baumanni, two isolates of A. calcoaceticus, and one isolate of 13TU. All A. baumannii isolates were positive for blaOXA-51-like genes. PCR did not detect the blaOXA-23 and blaSHV genes. Among MBL-producing isolates in ACB complex, blaVIM-2 and blaIMP-1 were found in 21.2%, and 7.7% of isolates, respectively. In 30.0% of the A. baumannii strains were detected the blaVIM-2 gene, and all were obtained from nasal swabs.

Detection of integrons by PCR

PCR detection of the intI1, intI2, and integrase genes demonstrated the presence of integrons in Acinetobacter species isolated. PCR performed the determination of the size of any inserted gene cassette within the genome. Overall, PCR of the integrase gene resulted in a frequency of integron-positive isolates of 38.5% (20/52) with various insert sizes within the ACB complex, in according to with previous studies that have reported a high frequency of multiresistant gram-negative isolates containing integrons (13-15,25,30). Class 1 integrons were found in 23.1% (12/52) of the isolates of ACB complex. The length the amplicons of variable regions ranged between 0.75 to 2.5 kb; 0.75 kb (13.0%), 2.5 kb (5.0%) and (0.75 +2.5 kb) (7.0%). Further, PCR could be helpful to determine their gene cassette assortments. The most number of isolates with integrons belonging to antibiotype I and were found in nasal swabs and wounds. The intI2 gene of class 2 integrons were detected in 17.3% (9/52) of the isolates. The presence of class 2 integrons, in six isolates, which also contained a class 1 integron was statistically significant (p <0.05). Class 1 and 2 integrons were detected in two isolates belonging to antibiotype I and IV with blaTEM-1 and blaOXA genes. Additionally, isolates belonging to antibiotype II and III also contained integrons. In contrast, no integrin-positive isolates were found in antibiotype V. The integrons were found in 30.0% (7/23) isolates of A. baumannii. Class 1 integrons were detected in 26.1% (6/23) of the A. baumannii isolates, whereas only one A. baumannii strain contained a class 2 integron (Table 3). Integrons were detected in four (13.6%) A. baumannii isolates obtained from nasal swabs, two from (9.1%) from wounds, and one (4.5%) from urinary tracts, although the association was not statistically significant (p <0.05). Also, the integron-positive A. baumannii isolates contained blaTEM-1and blaVIM-2 genes.

Discussion

Nosocomial infections due to A. baumannii have been reported throughout the world , . However, there is little information about the epidemiological behavior of the isolates circulating within the city of Cali. In this regard, the availability of 52 nosocomial isolates has offered the opportunity to assess the susceptibility profiles, the determinants of resistance to antibiotics and their mechanisms of resistance. The majority of the isolates of the ACB complex were more frequent in nasal tracking (46.2%), and of these, 63.6% corresponds to A. baumannii in patients admitted to the ICU. This finding is significant because the nasal colonization in patients older than 65 years with pre-existing lung disease or any debilitating diseases especially in the ICU has a higher risk to develop a Health care-associated infections (HAIs) , . On the other hand, it concerns that all the 52 isolates were multidrug resistant to antibiotics, and tigecycline only sulperazona maintained the antimicrobial activity against the majority of the isolates evaluated (80.0%). Also, we identified PDR isolates (19.3%), with a statistically significant value (p <0.05), a result similar to the one reported by some authors in Brazil in the same years of this study, where we found isolates with this feature in 11.0% . In Colombia, the resistance reported in A. baumannii has increased in recent years. Specifically, in Bogotá between the years 2001 and 2008, there were isolated strains sensitive to carbapenems, quinolones, and next-generation cephalosporins and aminoglycosides in 30% of the cases . Also, Pinzon et al. for that same year, reported strains sensitive to carbapenems (35.8%); however, in 2012, the number of isolates with resistance to carbapenems had increased, still more than 90% . In 2009, the PAHO reported in countries of Latin America percentages of carbapenem resistance above 70%, and similar results in the behavior of the resistance to aminoglycosides, trimethoprim-sulfamethoxazole in several countries of Central and South America . The reports of the SENTRY in countries of Latin America, Europe, and the United States indicate that Acinetobacter spp. present high rates of resistance even to carbapenem. A multicenter study conducted by Higgins et al. in the year 2010 showed that 100% of the isolates of A. baumannii were resistant to imipenem, by the data obtained in this study for the same period. All of the isolated ACB complexes were multidrug resistant, including the isolates of A. baumannii, with percentages of carbapenem resistance more than 96%, which shows an increase in the resistance to antibiotics in the past few years. These findings are disturbing because the new antibacterial agents developed, such as doripenem, ceftobiprole, and ceftaroline, do not show activity against A. baumannii resistant to cephalosporins and carbapenems . Boo et al. , raise the possibility that a co-selection of isolates resistant to carbapenems occurs by the acquisition of carbapenemase OXA class D type. Our study showed that all isolates of A. baumannii presented the ability to hydrolyse broad-spectrum cephalosporins (ceftazidime and cefepime) and carbapenems (imipenem and meropenem). We detected the presence of beta-lactamase type OXA-51 and OXA-58, which would explain the resistance so marked to carbapenem, similarly reported by Gales et al . This study demonstrated the poor capacity of Acinetobacter species identification by the Vitek-2 GNI system. It highlights the need to regard such results as preliminary data. Accurate identification using molecular methods is not only important in the investigation of outbreaks caused by Acinetobacter species, but also is relevant in epidemiological studies such as this report. Our results are like the reports published in other geographic regions and coincide with the reports of Karageorgopoulos et al. , who found sensitivity to tigecycline lower than 90% of the isolates of Acinetobacter spp. They make it a potentially useful treatment option against highly resistant bacteria; however, few of these bacteria also present resistance to tigecycline. Within multiresistant isolates of the ACB complex and those of A. baumannii, bla (TEM-1, CTX-9, OXA-58, IMP-1 and VIM-2) was detected. Although the presence of the beta-lactamase TEM-1 is reported as one of the leading causes of resistance to beta-lactamic antibiotics in the A. baumannii isolates, in this study, only 22.7 % of the isolates were carriers of the gene blaTEM-1. In recent years the trend has changed; the increase in the resistance to carbapenems is mainly due to the presence of metallo beta-lactamases and class D type carbapenemase OXA, whose overexpression is regulated by the presence of upstream insertion elements, such as ISAba1 . In this study, 38.5% of the isolates of ACB complex and 50.0% of A. baumannii presented beta-lactamases type OXA-58. Despite that, some reports have suggested that genes of OXA type beta-lactamases are transported in integrons , , our results showed that 82% of the isolates of the ACB complex and A. baumannii that contained these genes type did not show related to integrons. These results are consistent with those reported by Poirel et al. , who said that these genes are not usually found in the form of gene cassettes and, according to the same author, these genes are carried on plasmids or are associated with a process of homologous recombination. The presence of integrons (class 1 and 2) in 40% of the isolates was statistically significant; both classes of integrons have been described between the members of the genus Acinetobacter isolated in both clinical and environmental settings . It is reported that the epidemic strains of A. baumannii tend to contain a greater number of integrons that are non-epidemic, and affirms that the use of antibiotics has a high impact on the development of the diversity and maintenance of these strains in the ICU . The class 1 integron presents multiple cassettes, which confers resistance towards several antibiotics, as a distinctive phenotypic stamp on the isolates of A. baumanni - , , which would explain the multidrug resistance detected in isolates of the ACB complex and A. baumannii. The integration of these elements in the bacterial chromosome can affect the expression of genes such as blaOXA-51, which encodes an Amp c, b, and the chromosomal carbapenemase. In this study, all 22 isolates of A. baumannii showed resistance to cephalosporins and carbapenems; however, only 25% of them detected integrons within the genome. Of the ACB complex, 32 isolates were not integrons, by which the multidrug resistance to antibiotics in these isolates must be related to other mechanisms of resistance which may be plasmid-mediated or through the reduction of the cell membrane or wall permeability . The largest numbers of integrons were detected in isolates obtained from sample tracking and nasal surgical wounds. These results do not agree with those obtained by Koleman et al. , whereas that the largest number of integrons was detected in isolates from blood and secretion; this discrepancy is probably due to the greater number of isolates of this study that were obtained from nasal colonization and absence of infections.

Introducción

Se ha reportado que Acinetobacter spp. está involucrada en infecciones adquiridas en el hospital con una frecuencia creciente . El uso extensivo de la quimioterapia antimicrobiana en entornos clínicos ha contribuido a la aparición y diseminación de infecciones nosocomiales por Acinetobacter spp . Las especies pertenecientes al complejo A. calcoaceticus- A. baumannii (complejo ACB) son principalmente cepas de Acinetobacter resistentes a antibióticos . Este complejo ha sido implicado como la causa de un amplio espectro de enfermedades infecciosas como neumonía, meningitis, bacteriemia, infecciones del tracto urinario e infecciones relacionadas con los dispositivos especialmente en unidades de cuidados intensivos (UCI), y asociadas a altas tasas de mortalidad . Debido al fenotipo resistente a múltiples fármacos (MDR, siglas en inglés) del organismo, estas infecciones son difíciles de tratar, lo que incluye resistencia a betalactámicos, aminoglucósidos, fluoroquinolonas y carbapenémicos ,. En los últimos años se ha producido un brote nosocomial significativo del complejo complejo MDR ACB en Colombia . La resistencia a los betalactámicos, incluidos los carbapenémicos en el complejo ACB, se debe principalmente a la producción de betalactamasas de espectro extendido (ESBLs), pero también a otros mecanismos, como alteraciones en proteínas de la membrana externa y proteínas de unión a penicilina y aumento de la actividad de las bombas de explusión . Tanto las ESBLs, carbapenemasas, como las metalo-beta-lactamasas (MBL) o las oxacilinasas, representan la mayor preocupación debido a la posibilidad de una diseminación rápida . Mientras que las MBL encontradas son de tipos IMP y VIM en A. baumannii, las oxacilinasas presentan cuatro subgrupos principales de OXA que son cromosómicamente localizados como similar a OXA-51 intrínseco; similar a OXA-23 adquirido; similar a OXA-40; y similar a OXA-58 -. La mayoría de los genes que codifican estos ESBLs se encuentran en plásmidos, o en forma de un casete genético en un integrón. Los integrones son elementos genéticos que poseen un sitio de recombinación particular, conocido como attl1, en el cual los genes de resistencia pueden insertarse mediante recombinación sitio específica en forma de casetes de genes . Se han descrito diferentes clases de integrones, y las clases 1, 2 y 3 se han asociado con resistencia a antibióticos ,. La diseminación de estos integrones de resistencia a antibióticos, que no pueden promover su movilización, está principalmente relacionada con transposones y plásmidos. Se han publicado diferentes informes que identifican a los integrones como responsables de la presencia y adquisición de resistencia a antibióticos en A. baumannii,. Hay datos limitados sobre la epidemiología global de A. baumannii en nuestra región. Sin embargo, la distribución del integrón de clase 2 es muy frecuente en aislamientos clínicos de A. baumannii de Argentina, Chile y Brasil ,. Los objetivos del presente estudio fueron analizar las características fenotípicas y moleculares del complejo de ACB y la resistencia a antibióticos en aislados clínicos en un hospital colombiano de atención terciaria. Además de determinar los perfiles de resistencia antimicrobiana de las cepas aisladas. También se comprobó la presencia de MBL o ESBL en Acinetobacter spp. Para probar la hipótesis de que la mayoría de los genes que codifican MBL o ESBL se encuentran en los casetes génicos de los integrones, se examinaron por PCR, en aislados representativos, la presencia de los integrones de clase 1 y clase 2 y los genes asociados a resistencia antimicrobiana. El conocimiento sobre la epidemiología y los mecanismos moleculares de la resistencia a los antimicrobianos en este importante patógeno es esencial para implementar estrategias de intervención.

Materiales y Métodos

Se llevó a cabo un estudio descriptivo respaldado por el comité de ética del hospital.

Muestras clínicas de cepas bacterianas

El estudio incluyó 52 cepas de Acinetobacter spp obtenidas de muestras clínicas, previamente identificadas por la tarjeta Vitek GNI (bioMeriex Vitek Inc., Hazelwood, MO), que crecieron en agar MacConkey estándar a 37 °C durante 48 h, entre marzo de 2009 y julio de 2010 de una unidad de cuidados intensivos médicos en el Hospital Universitario Rafael Uribe Uribe de Cali - Colombia. Las muestras clínicas se obtuvieron de: Rastreo nasal, 24 (46.2%); heridas, 12 (26.1%); punta del catéter, 6 (11.6%); el tracto urinario, 6 (11.6%); y sangre, 4 (7.7%). Todas las muestras se almacenaron a -80 °C en caldo nutritivo con 15% de glicerol. De las 52 cepas aisladas de Acinetobacter spp, se obtuvieron 24 (46.2%).

Prueba de sensibilidad antimicrobiana

La susceptibilidad a varias clases de antibióticos se determinó mediante el método de difusión de disco en un agar Mueller-Hinton (MH) (Difco Laboratories, Detroit, MI, EE. UU.), según las directrices del Instituto Clínico y de Laboratorio Estándar (CLSI) . Ambas cepas, Acinetobacter baumannii (ATCC(r) 19606 (tm)) y Escherichia coli (ATCC(r) 25922 (tm)) se usaron como cepas de control de calidad. Los discos de antibióticos (Oxoid(r)) probados fueron los siguientes: trimetroprima/sulfametoxazol (SXT, 23.75 μg/1.25 μg); ticarcilina/clavulanato (TIM, 75 μg/10 μg); gentamicina (GEN, 10 μg); tobramicina (TOB, 10 μg); ciprofloxacina (CIP, 5 μg); ceftazidima (CAZ, 30 μg); cefepime (FEP, 30 μg); aztreonam (ATM, 30 μg); imipenem (IMP, 10 μg); meropenem (MEM, 10 μg); ampicilina/sulbactam (SAM, 10 μg/10 μg); amikacina (AMK, 10 μg); cefoprazona/sulbactam (sulperazona, SUL, 75 μg/30 μg); y tigeciclina (TIG, 15 μg). De acuerdo con Manchanda et al. se definió Acinetobacter spp. MDR si los aislados son resistentes a tres antibióticos diferentes a la ceftazidima, como ciprofloxacina, gentamicina e imipenem.

Identificación de aislados de Acinetobacter spp.: Análisis de Restricción de ADN Ribosomal Amplificado (ARDRA)

La especie genómica de Acinetobacter spp. fue determinada por ARDRA, de acuerdo con Vaneechoutte et al. En resumen, el ADN de un cultivo de una noche en caldo LB a 37°C fue extraído utilizando el kit "Easy-DNATM" (Invitrogen, life technologies (r)) de acuerdo con las instrucciones del fabricante. Después de la electroforesis, el gel se tiñó con bromuro de etidio (1.5 μg/mL) y se analizó en un FOTO/Analyst(r) Investigator/FX Systems (FOTODYNE Incorporated). Para cada muestra, la reacción de PCR se realizó para la amplificación del gen 16s ADNr utilizando el siguiente par de cebadores: Acf5'-TGG CTC AGA TTG AAC GCT GGC GGC-3'y Acr5'-TAC CTT GTT ACG ACT TCA CCC CA-3'. Los productos de PCR se digirieron con las siguientes enzimas: CfoI; Alu; Mbo; y MspI (Fermentas (tm)) y separados por electroforesis en gel de poliacrilamida (PAGE 8.0%). Los últimos perfiles de restricción se compararon con la base de datos de la biblioteca de cepas (http://users.ugent.be/~mvaneech/ARDRA/Acinetobacter.html) para identificar la especie de acuerdo con Dijkshoorn et al . La cepa de A. baumannii (ATCC(r) 19606 (tm)) se usó como control.

Identificación de aislados clínicos de Acinetobacter spp. mediante PCR-secuenciación del gen 16s ADNr

Se purificaron 27 productos de PCR para el gen 16s ADNr, usando el kit "High Pure PCR Purification Kit Version 20, de acuerdo con las instrucciones de la compañía (Roche Applied Science®) y luego, cada producto de PCR purificado se secuenció directamente mediante el método dideoxi de Sanger usando un Secuenciador ABI 3730XL. Las secuencias de 16S ADNr se alinearon con 27 secuencias de referencia de Acinetobacter albergadas en la base de datos GenBank-NCBI. El árbol filogenético se realizó utilizando el software MEGA v.5 bajo el modelo de Máxima Verosimilitud con los parámetros Kimura-2, y la distribución Gamma asumiendo sitios invariables (K2 + G + I). La robustez del árbol filogenético se calculó mediante un bootstrap no paramétrico con 1,000 réplicas ,. Se utilizó una secuencia de Staphylococcus aureus como grupo externo.

Detección de genes de ESBL por PCR

Genes de ESBL, tales como blaTEM; blaSHV; blaOXA; blaCTX-M; blaIMP; y blaVIM, se detectaron por PCR usando los cebadores enumerados en la Tabla 1 -. El volumen final de la reacción de PCR fue de 50 μL con 5-10 ng (ADN genómico) buffer de reacción, 1 U de Taq polimerasa (Bioline, Londres, Reino Unido), 200 μM para cada desoxinucleósido trifosfato, 1.5 o 2.5 mM MgCl2, 10 pmol de cada primer. La temperatura del termociclador fue de 94° C durante 5 min; 94° C durante 30 s por 35 ciclos. Para blaTEM, 52° C durante 45 s; blaOXA-51 y blaOXA-58, 62° C durante 1 minuto; blaCXT-M, 51° C durante 45 segundos; blaVIM y blaIMP 51° C durante 1 min; y 72° C durante 60 s. Una etapa final de 10 min a 72° C.
Tabla 1:

Cebadores usados en el estudio

CebadorSecuencia de oligonucleotidos Tamaño (bp)Referencia
rDNA16S ACF-5'_TGGCTCAGATTGAACGCTGGCGGC_3'1,50018
R-5'_TACCTTGTTACGACTTCACCCCA_3'
blaTEMF-5´_ATGAGTATTCAACAT TTCCG_3´95623
R-5´_CTGACAGTTACCAATGCTTA_3´
bla VIMF-5´_AAAGTTATGCCGCACTCACC_3´86524
R-5´_TGCAACTTCATGTTATGCCG_3´
bla IMPF- 5´_ATGAGCAAGTTATCCTTATTC_3´74125
R- 5´_GCTGCAACGACTTGTTAG_3´
blaCTX-M-9F -5´_GTGACAAAGAGAGTGCAACGG_3´85626
R-5´_ATGATTCTCGCCGCTGAAGCC_3´
blaOXA-51F-5´_CGGAGAACGACTCCTCATTAAAAA_3´43127
R-5´_TTTAGCTCGTCGTATTGGACTTGA_3´
blaOXA-58F-5´_AAGTATTGGGGCTTGTGCTG_3´59928
R-5´_CCCCTCTGCGCTCTACATAC_3´
Int1F-5´_CAGTGGACATAAGCCTGTTC_3´16029
R-5'_CCCGAGGCATAGACTGTA_3´
Int2F-5´_TTGCGAGTATCCATAACCTG_3´28829
R-5´_TTACCTGCACTGGATTAAGC_3´
CSR-5´_GGCATCCAAGCAGCAAG_3´Variable29
F-5´_AAGCAGACTTGACCTGA_3´
hep35R-5´_TGCGGGTYAARGATBTKGATTT_3´49130
hep36F-5´_CARCACATGCGTRTARAT_3´

Detección de genes de integrasa por PCR

Los genes de la integrasa clase 1 (intI) y 2 (intII) se amplificaron como se describió previamente ,. La amplificación para cada uno se realizó en volúmenes de 50 μL usando 5-10 ng (ADN genómico) de buffer de reacción, 2 U de polimerasa Taq (Bioline, Londres, Reino Unido), 200 μM para cada desoxinucleósido trifosfato, 2,0 mM de MgCl2, 10 pmol de cada cebador. Las condiciones de PCR fueron las siguientes: un inicio con choque de calor a 94 °C durante 5 min; 35 ciclos de 30 s a 94 °C, 30 s a 55 °C; y un paso final de 10 min a 72 °C. La mezcla de reacción para los cebadores degenerados hep35 y hep36 eran equivalentes a los anteriores excepto por la concentración de cada cebador (2.0 μM) y para los pasos de extensión de la PCR (72º C y 2 min).

Análisis estadístico

Los datos se analizaron usando Stata versión 11.0 (Stata Corp, College Station, Tex). Las variables categóricas se analizaron mediante la prueba χ2. Todas las pruebas fueron de dos colas con p <0.05 considerado significativo.

Resultados

Susceptibilidad a antibióticos

Los antibióticos probados por el método de difusión en disco mostraron resistencia múltiple a una amplia gama de antibióticos. La mayoría de los aislamientos de Acinetobacter spp. fueron resistentes a trimetoprima / sulfametoxazol, gentamicina, amikacina, tobramicina, ticarcilina/ácido clavulánico, cefepime, ceftazidima e imipenem con tasas de resistencia del 100%; mientras presentaban susceptibilidad variable a ciprofloxacina (51/52, 98.1%), levofloxacina (45/52, 86.5%), ampicilina-sulbactam (49/52, 94.2%) y meropenem (50/52, 96.2%). Los agentes antimicrobianos a los que las cepas de Acinetobacter spp fueron más susceptibles fueron la tigeciclina y la sulperozona. Por el contrario, el 21.2% (11/52) y el 28.8% (15/52) de ellos fueron resistentes a tigeciclina y sulperozona, respectivamente. Además, todos los aislamientos fueron resistentes a al menos tres clases de antibióticos (imipenem o meropenem, amikacina o tobramicina y cefalosporinas de espectro extendido), cumpliendo así los criterios de resistencia a múltiples fármacos . Es de resaltar, que de los aislamientos distribuidos en julio y septiembre de 2009, 10 aislamientos (19.3%) se consideraron Pan resistente a las drogas (PDR) de acuerdo con Falagas et al., demostrando resistencia a todos los antibióticos probados en este estudio.

Un antibiótico común en cepas no relacionadas de co-circulación

Dependiendo de sus susceptibilidades a 14 diferentes fármacos antimicrobianos, los 52 aislamientos del complejo ACB se agruparon en cinco (I a V) antibiotipos diferentes. La mayoría de los aislamientos pertenecientes al antibiotipo I (50.0%), con menos aislados pertenecientes al antibiotipo IV (19.3%), antibiotipo II (17.3%) y antibiotipo V, con solo 1.9% de todos los aislados. Curiosamente, los aislados pertenecientes al antibiótipo I eran susceptibles a tigeciclina y sulperozona, y la mayoría de los aislados clínicamente significativos se encontraban en rastreo nasal (57.7%), seguidos de heridas y puntas de catéter (23.1% y 15.4%, respectivamente) (p <0.05) (Tabla 2). Del antibiotipo I, veinticinco aislados fueron recolectados entre junio y noviembre de 2009 y solo se detectó un aislado en mayo de 2010.
Tabla 2

Antibiotipos del complejo A. baumannii-calcoaceticus aislados del sitio de muestreo, perfiles de resistencia y susceptibilidad

Antibiotipo Aislados n (%)Sitio de muestraPerfil de resistancIAPerfil de susceptibilidad
MN n (%)San n (%)PC N (%)He n (%)Or n (%)SU n (%)
I26 (50.0)15 (57.7)1 (3.8)4 (15.4)6 (23.1)-- AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEMTIG, SUL
II9 (17.3)6 (66.7)-2 (22.2)-1 (11.1)-AMK, GEN, TOB, CIP, SXT, TIC/AC, FEP, CAZ, IMPTIG, SUL/ LVX, SAM o MEM
III6 (11.5)1 (16.7)2 (33.3)-1 (16.7)2 (33.3)-AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEMTIG ó SUL
IV10(19.3)*2 (20.0)--5 (50.0)**1 (10.0)2 (20.0)AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEM, TIG, SUL-
V1 (1.9)-1 (100)----AMK, GEN, TOB, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEMTIG, SUL, CIP, LVX
Total52 (100)24 (46.2)4 (7.7)6 (11.5)12 (23.1)4 (7.7)2 (3.8)
El antibiotipo IV agrupó significativamente los aislados de PDR (19.3%) (p <0.05) y se detectó con mayor frecuencia en heridas (50%; OR = 5.000; p = 0.025). Este antibiotipo se detectó por primera vez en marzo de 2009 y apareció nuevamente en julio, agosto y noviembre del mismo año, así como en abril, mayo y junio de 2010. Como se muestra en la Tabla 2, 27 aislamientos de A. baumannii (37.1%) exhibieron cinco antibiotipos distintos. Doce de los aislados (54.5%) se clasificaron como antibiotipo I, dos (9.1%) aislados para antibiotipo III, cuatro (18.2%) aislamientos para antibiotipo IV y un (5.0%) aislado para antibiotipo V. Cuatro cepas de A. calcoaceticus revelaron dos antibiotipos distintos, y tres cepas de 13TU mostraron tres antibiotipos diferentes.

Identificación de aislados de Acinetobacter spp

La identificación genómica de 52 cepas pertenecientes al complejo ACB se realizó mediante el método ARDRA y secuenciación (Tabla 3 y ). Los resultados revelaron que 23 (44.2%) aislamientos tenían el perfil combinado "1 1 1 2 3" o "1 1 1 2 1" para las diversas enzimas CfoI, AluI, MboI, RsaI y MspI. De acuerdo con la biblioteca de referencias, las cepas de perfiles identificaron los organismos como especies 2 (A. baumannii), tres (5.8%) fueron A. nosocomialis (13TU), dos fueron A. calcoaceticus y dos fueron A. pitti (genospecies 3).
Tabla 3

Distribución y caracterización molecular de aislados del complejo A. baumannii-calcoaceticus.

CódigoSitio de muestreoAntibiotipo Genes BlaIntegron
OXA-51TEMCTXM-9VIM-2IMP-1OXA-58
5790341 Muestra nasal 1+
5793548 Muestra nasal1++ +
21262Orina2+
5701177Herida1++ +
1 Herida 4+ ++
5793546Muestra nasal1+ ++
5702062Muestra nasal2+
5701373 Herida 1++ + +
5704225H Herida 4+ +
5717479 Muestra nasal 1+
5718164 Muestra nasal 2+ ++
21311Herida1+ +
5728549Herida3+ + +
21499 Muestra nasal 1+ +
5730330Punta cateter1++ +
5748866Sangre5+
5749428 Muestra nasal 1+ + +
5761126Punta Cateter1+ +
5750598Secreción uretra4+ +
5723185 Muestra nasal 1+ +
2513Orina3+ ++ +
5759531 Muestra nasal 4++ + +
209021(13TU) Muestra nasal 3 +
5725011 (13TU) Muestra nasal 2 + +
5717971 (13TU) Muestra nasal 1 + ++
Ab3 (A. calcoaceticus)Herida1 ++ +
5701789 (A. calcoaceticus) Muestra nasal 4 + +
5701372 (A. calcoaceticus) Muestra nasal 1
85.7%21.4%10.7%25.0%10.7%53.6%28.6%
Tabla 4

Perfiles obtenidos por analisis de restriccion de genes amplificando rRNA del complejo A. baumannii-calcoaceticus

No.Secuencia genotipoPerfil ARDRAAisladosEnzimas
CfoIAluIMboIMspI
1ABAB5704225H1111
2ABABAb196061111
3ABAB25131111
4ABAB57488661111
5ABAB57903411111
6ABAB57303301111
7ABABAb214991111
9ABABAb213111111
10 ABAB57285491111
11ABAB57174791111
12ABAB57935381111
13ABAB57611261111
14ABAB57020621111
16ABAB212621111
17ABABAb11113
18 ABAB57011771113
19 ABAB57595311113
20ABAB57505981113
2113TUAB2090211111
2213TUAB57250111111
2313 TUAB57179711113
24 UDAB57045811111
25 Calcoaceticus13TU57013722113
26Calcoaceticus13TU57017892111
27 UD13TU57486232111
28AB3U57935462133
29UD3U57384062131
30UDUDNAC512241

Los perfiles de resistencia fueron: Calcoaceticus=A. calcoaceticus (2 2 1 3); AB= A. baumannii (1 1 1 1 / 1 1 1 3); 3U= Acinetobacter 3U (2 1 3 3); A. haemolyticus (1 4 1 2); 13TU= Acinetobacter 13TU (2 1 1 1 / 2 1 1 3); UD= indefinido

Para el análisis NCBI-BLAST, se consultaron 27 cepas utilizando secuencias de un fragmento de 1,500 pb del ADNr 16s. Esta identificación de todos los aislados clínicos a nivel de especie mostró que todos los amplicones tenían una concordancia de secuencia de 61 a 99% . Los perfiles de resistencia fueron: Calcoaceticus=A. calcoaceticus (2 2 1 3); AB= A. baumannii (1 1 1 1 / 1 1 1 3); 3U= Acinetobacter 3U (2 1 3 3); A. haemolyticus (1 4 1 2); 13TU= Acinetobacter 13TU (2 1 1 1 / 2 1 1 3); UD= indefinido En la Figura 1, se muestra el árbol filogenético de las genoespecies de Acinetobacter mediante el análisis de secuenciación del ADNr 16s. De todos los aislamientos, el 74.1% (20/27) se agruparon con A. baumannii mientras que A. nosocomialis constituyó el 11.1% (3/27) del total. Los métodos moleculares (ARDRA y análisis de secuencia) aplicados en este estudio nos permitieron discriminar dentro del complejo ACB cada una de las especies que lo componen. Sin embargo, encontramos ambigüedad entre los dos métodos al definir las genoespecies A. calcoaceticus, Acinetobacter 3U, Acinetobacter 13U como se muestra en la Tabla 4.
Figura 1

Árbol filogenético de Acinetobacter genospecies por análisis de secuenciación de rDNA 16s. En total, 27 aislados clínicos se compararon con las secuencias de Acinetobacter 16s rDNA16 informadas en el GenBank-NCBI. El árbol filogenético se realizó utilizando el software MEGA v.5 bajo el modelo de Máxima Verosimilitud con los parámetros Kimura-2, y la distribución Gamma asumiendo sitios invariables (K2 + G + I). La robustez del árbol filogenético se calculó mediante un bootstrap no paramétrico con 1,000 réplicas.

Caracterización molecular de genes de ESBL

Todos los aislados productores de ESBL en el complejo ACB se sometieron a experimentos de PCR para detectar los genes ESBL, que incluyen blaTEM, blaSHV, blaCTX-M, blaOXA-51, blaOXA-58, blaVIM y blaIMP. Treinta y nueve aislamientos (75.0%) portaban varios genes bla (hasta dos genes). La amplificación por PCR de los genes de beta-lactamasa de clase A reveló que el 17.3% (9/52) de los aislados contenían blaTEM-1 y cinco (9.6%) aislados contenían blaCTXM-9, mientras que blaOXA-58 se encontró significativamente en todas cepas de A. baumannii resistentes a carbapenem (p <0.05). El gen blaTEM-1 se identificó en cuatro aislados de A. baumannii y un aislado de A. calcoaceticus. El gen blaCTXM-9 se detectó en dos aislados de A. calcoaceticus y un aislado de 13TU, el gen blaOXA-58 se detectó en un aislado de A. baumanni, dos aislados de A. calcoaceticus y un aislado de 13TU. Todos los aislamientos de A. baumannii fueron positivos para genes similares a blaOXA-51. La PCR no detectó los genes blaOXA-23 y blaSHV. Entre los aislamientos productores de MBL en el complejo ACB, blaVIM-2 y blaIMP-1 se encontraron en 21.2% y 7.7% de los aislamientos, respectivamente. En 30.0% de las cepas de A. baumannii se detectó el gen blaVIM-2, y todas se obtuvieron de rastreos nasales.

Detección de integrones por PCR

La detección por PCR de los genes intl1, intl2 e integrasa demostró la presencia de integrones en las especies de Acinetobacter aisladas. La PCR realizó la determinación del tamaño de cualquier casete de gen insertado dentro del genoma. En general, la PCR del gen de la integrasa dio como resultado una frecuencia de aislamientos positivos para el integrón del 38.5% (20/52) con diversos tamaños de insertos dentro del complejo ACB, de acuerdo con estudios previos que informaron una alta frecuencia de gramnegativos multirresistentes aislados que contienen integrones -,,. Los integrones de clase 1 se encontraron en el 23.1% (12/52) de los aislamientos del complejo ACB. La longitud de los amplicones de las regiones variables oscilaba entre 0.75 y 2.5 kb; 0.75 kb (13.0%), 2.5 kb (5.0%) y (0.75 + 2.5 kb) (7.0%). Adicionalmente, la PCR podría ser útil para determinar sus surtidos de casete genético. La mayoría de los aislamientos con integrones pertenecientes al antibiotipo I se encontraron en rastreos nasales y heridas. El gen intI2 de los integrones de clase 2 se detectó en el 17.3% (9/52) de los aislados. La presencia de integrones de clase 2, en seis aislamientos, que también contenían un integrón de clase 1 fue estadísticamente significativa (p <0.05%). Se detectaron integrones de clase 1 y 2 en dos aislados pertenecientes a los antibiotipos I y IV con los genes blaTEM-1 y blaOXA. Además, los aislados pertenecientes a los antibiotipo II y III también contenían integrones. Por el contrario, no se encontraron cepas con integrasa positiva en el antibiotipo V. Los integrones se encontraron en 30.4% (7/23) aislados de A. baumannii. Se detectaron integrones de clase 1 en 26.1% (6/23) de los aislamientos de A. baumannii, mientras que solo una cepa de A. baumannii contenía un integrón de clase 2 (Tabla 3). Los integrones se detectaron en cuatro aislamientos de A. baumannii (13.6%) obtenidos de rastreos nasales, dos (9.1%) de las heridas y uno (4.5%) de las vías urinarias, aunque la asociación no fue estadísticamente significativa (p <0.05). Además, los aislamientos de A. baumannii positivos para el integrón contenían los genes blaTEM-1 y blaVIM-2.

Discusión

Se han notificado infecciones nosocomiales por A. baumannii en todo el mundo ,. Sin embargo, hay poca información sobre el comportamiento epidemiológico de los aislados que circulan en la ciudad de Cali. En este sentido, la disponibilidad de 52 aislados nosocomiales ha ofrecido la oportunidad de evaluar los perfiles de susceptibilidad, los determinantes de la resistencia a los antibióticos y sus mecanismos de resistencia. La mayoría de los aislamientos del complejo ACB fueron más frecuentes en el rastreo nasal (46.2%) y de éstos, el 63.6% corresponde a A. baumannii en pacientes ingresados ​​en la UCI. Este hallazgo es significativo porque la colonización nasal en pacientes mayores de 65 años con enfermedad pulmonar preexistente o cualquier enfermedad debilitante, especialmente en la UCI, tiene un mayor riesgo de desarrollar infecciones asociadas a la atención médica (IAH) ,. Por otro lado, preocupa que los 52 aislamientos fueran multi-resistentes a los antibióticos, y la tigeciclina y sulperazona fueran las únicas que mantuvieron la actividad antimicrobiana contra la mayoría de los aislados evaluados (80.0%). Además, se identificaron aislamientos de PDR (19.3%), con un valor estadísticamente significativo (p≤0.05), un resultado similar al reportado por algunos autores en Brasil en los mismos años de este estudio, donde se encontraron aislamientos con esta característica en 11% . En Colombia, la resistencia informada en A. baumannii ha aumentado en los últimos años. Específicamente, en Bogotá entre los años 2001 y 2008, hubo cepas aisladas sensibles a carbapenémicos, quinolonas, y a cefalosporinas de última generación y aminoglucósidos en el 30% de los casos . Además, Pinzon et al. (, para ese mismo año, reportó cepas sensibles a carbapenémicos (35.8%); sin embargo, en 2012, el número de aislamientos con resistencia a carbapenémicos aumentó, en más del 90% . En 2009, la PAHO informó en los países de América Latina porcentajes de resistencia a carbapenem por encima del 70%, y resultados similares en el comportamiento de la resistencia a los aminoglucósidos, trimetoprim-sulfametoxazol en varios países de América Central y del Sur . Los informes de SENTRY en países de América Latina, Europa y los Estados Unidos indican que Acinetobacter spp. presenta altas tasas de resistencia incluso al carbapenem. Un estudio multicéntrico realizado por Higgins et al. (, en el año 2010 mostró que el 100% de los aislamientos de A. baumannii eran resistentes a imipenem, lo que coincide con los datos obtenidos en este estudio durante el mismo período. Todos los complejos ACB aislados fueron resistentes a múltiples fármacos, incluidos los aislados de A. baumannii, con porcentajes de resistencia a carbapenem en más del 96%, lo que muestra un aumento en la resistencia a los antibióticos en los últimos años. Estos hallazgos son inquietantes porque los nuevos agentes antibacterianos desarrollados, como el doripenem, el ceftobiprol y la ceftarolina, no muestran actividad contra A. baumannii resistente a cefalosporinas y carbapenémicos . Boo et al., plantean la posibilidad de que se produzca una co-selección de cepas resistentes a carbapenémicos mediante la adquisición de carbapenemasas de tipo OXA de clase D. Nuestro estudio demostró que todos los aislamientos de A. baumannii presentaban la capacidad de hidrolizar cefalosporinas de amplio espectro (ceftazidima y cefepima) y carbapenémicos (imipenem y meropenem). Detectamos la presencia de beta-lactamasa tipo OXA-51 y OXA-58, lo que explicaría la resistencia tan marcada al carbapenem, reportado de manera similar por Gales et al . Este estudio demostró la escasa capacidad de identificación de especies de Acinetobacter por el sistema Vitek-2 GNI. Resalta la necesidad de considerar tales resultados como datos preliminares. La identificación precisa mediante métodos moleculares no solo es importante en la investigación de los brotes causados ​​por especies de Acinetobacter, sino que también es relevante en estudios epidemiológicos como este informe. Nuestros resultados son similares a los informes publicados en otras regiones geográficas y coinciden con los informes de Karageorgopoulos et al., que encontró sensibilidad a la tigeciclina inferior al 90% de los aislamientos de Acinetobacter spp. Lo anterior, lo convierte en una opción de tratamiento potencialmente útil contra bacterias altamente resistentes; sin embargo, algunas de estas bacterias también presentan resistencia a la tigeciclina. Dentro de aislamientos multirresistentes del complejo ACB y los de A. baumannii, se detectó bla (TEM-1, CTX-9, OXA-58, IMP-1 y VIM-2). Aunque la presencia de la beta-lactamasa TEM-1 se informa como una de las principales causas de resistencia a los antibióticos beta-lactámicos en los aislados de A. baumannii, en este estudio, solo el 22.7% de los aislados fueron portadores del gen blaTEM- 1. En los últimos años, la tendencia ha cambiado; el aumento de la resistencia a los carbapenémicos se debe principalmente a la presencia de metalo-beta-lactamasas y carbapenemasa tipo OXA de clase D, cuya sobreexpresión está regulada por la presencia de elementos de inserción aguas arriba, como ISAba1 . En este estudio, el 38.5% de los aislados de complejo ACB y el 50.0% de A. baumannii presentaron beta-lactamasas tipo OXA-58. A pesar de eso, algunos informes han sugerido que los genes de beta-lactamasas tipo OXA se transportan en integrones ,, nuestros resultados mostraron que el 82% de los aislamientos del complejo ACB y A. baumannii que contenían estos genes no mostraron relación con integrones. Estos resultados son consistentes con los informados por Poirel et al., quien dijo que estos genes no se encuentran generalmente en forma de casetes de genes y, según el mismo autor, estos genes se transportan en plásmidos o están asociados con un proceso de recombinación homóloga. La presencia de integrones (clase 1 y 2) en el 40% de los aislamientos fue estadísticamente significativa; ambas clases de integrones se han descrito entre los miembros del género Acinetobacter aislados tanto en entornos clínicos como medioambientales . Se informa que las cepas epidémicas de A. baumannii tienden a contener un mayor número de integrones que no son epidémicos, y afirma que el uso de antibióticos tiene un gran impacto en el desarrollo de la diversidad y el mantenimiento de estas cepas en la UCI . El integrón de clase 1 presenta múltiples casetes, lo que confiere resistencia a varios antibióticos, como un sello fenotípico distintivo en los aislados de A. baumanni-,, lo que explicaría la resistencia a múltiples fármacos detectada en aislamientos del complejo ACB y A. baumannii. La integración de estos elementos en el cromosoma bacteriano puede afectar la expresión de genes como blaOXA-51, que codifica un Amp c, b, y la carbapenemasa cromosómica. En este estudio, los 22 aislamientos de A. baumannii mostraron resistencia a cefalosporinas y carbapenémicos; sin embargo, solo el 25% de ellos detectaron integrones dentro del genoma. Del complejo ACB, en 32 aislamientos no fueron detectados integrones, por lo que la resistencia a múltiples antibióticos en estos aislamientos debe relacionarse con otros mecanismos de resistencia que pueden ser mediados por plásmidos o mediante la reducción de la permeabilidad membrana celular o de la pared . El mayor número de integrones se detectó en aislamientos obtenidos por rastreo de muestras nasales y heridas quirúrgicas. Estos resultados no concuerdan con los obtenidos por Koleman et al., mientras que el mayor número de integrones se detectó en aislados de sangre y secreciones; esta discrepancia probablemente se deba a la mayor cantidad de aislados de este estudio que se obtuvieron a partir de la colonización nasal y la ausencia de infecciones.
  41 in total

1.  Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from the SENTRY Antimicrobial Surveillance Program.

Authors:  Timothy R Walsh; Mark A Toleman; Waleria Hryniewicz; Peter M Bennett; Ronald N Jones
Journal:  J Antimicrob Chemother       Date:  2003-06-12       Impact factor: 5.790

2.  Increasing frequency of class 1 and 2 integrons in multidrug-resistant clones of Acinetobacter baumannii reveals the need for continuous molecular surveillance.

Authors:  María Soledad Ramírez; María Silvina Stietz; Elisabet Vilacoba; Paola Jeric; Adriana S Limansky; Mariana Catalano; Daniela Centrón
Journal:  Int J Antimicrob Agents       Date:  2010-12-21       Impact factor: 5.283

3.  Partial rpoB gene sequencing for identification of Leptospira species.

Authors:  Bernard La Scola; Lan T M Bui; Guy Baranton; Atieh Khamis; Didier Raoult
Journal:  FEMS Microbiol Lett       Date:  2006-10       Impact factor: 2.742

4.  Characterisation of carbapenem-resistant Acinetobacter calcoaceticus--A. baumannii complex isolates in a third-level hospital in Bogotá, Colombia.

Authors:  S Y Saavedra; J C Nuñez; I Y Pulido; E B Gonzalez; E M Valenzuela; M T Reguero; J R Mantilla; A I Arango; P Bravo
Journal:  Int J Antimicrob Agents       Date:  2008-03-04       Impact factor: 5.283

5.  Emergence of blaOXA-23 and blaOXA-58 carbapenemase-encoding genes in multidrug-resistant Acinetobacter baumannii isolates from University Hospital of Annaba, Algeria.

Authors:  Meriem Touati; Seydina M Diene; Abdelkarim Racherache; Mazouz Dekhil; Abdelghani Djahoudi; Jean-Marc Rolain
Journal:  Int J Antimicrob Agents       Date:  2012-05-11       Impact factor: 5.283

Review 6.  Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology.

Authors:  L Poirel; P Nordmann
Journal:  Clin Microbiol Infect       Date:  2006-09       Impact factor: 8.067

7.  Molecular characterization of carbapenem-resistant Acinetobacter species in an Irish university hospital: predominance of Acinetobacter genomic species 3.

Authors:  T W Boo; F Walsh; B Crowley
Journal:  J Med Microbiol       Date:  2009-02       Impact factor: 2.472

8.  Multidrug-resistant Acinetobacter infection mortality rate and length of hospitalization.

Authors:  Rebecca H Sunenshine; Marc-Oliver Wright; Lisa L Maragakis; Anthony D Harris; Xiaoyan Song; Joan Hebden; Sara E Cosgrove; Ashley Anderson; Jennifer Carnell; Daniel B Jernigan; David G Kleinbaum; Trish M Perl; Harold C Standiford; Arjun Srinivasan
Journal:  Emerg Infect Dis       Date:  2007-01       Impact factor: 6.883

Review 9.  Tigecycline for the treatment of multidrug-resistant (including carbapenem-resistant) Acinetobacter infections: a review of the scientific evidence.

Authors:  Drosos E Karageorgopoulos; Theodore Kelesidis; Iosif Kelesidis; Matthew E Falagas
Journal:  J Antimicrob Chemother       Date:  2008-04-24       Impact factor: 5.790

10.  Frequency of microorganisms isolated in patients with bacteremia in intensive care units in Colombia and their resistance profiles.

Authors:  Jorge Alberto Cortes; Aura Lucía Leal; Anita María Montañez; Giancarlo Buitrago; Juan Sebastián Castillo; Lucy Guzman
Journal:  Braz J Infect Dis       Date:  2013-05-14       Impact factor: 3.257

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.