One of the most serious problems affecting children
is acute lymphoblastic leukemia (ALL) that mainly
occurs in the first 2 to 5 years of life. ALL is associated
with invasive properties and uncomfortable and life-
threatening complications, still, it is one of the most
curable malignancies of young age (1, 2). Because of
the unique situation of the bone marrow cavity, these
malignant cells survive a special condition compared to
the cells of other organs. There are mesenchymal stem
cell (MSC) in the bone marrow microenvironment, which
act on hematopoietic elements, as well as tumor cells,
supported through different ways (3, 4).There are some studies that focus on growth inhibition
and limiting the proliferation effects of MSCs on leukemic
cells. In total, MSCs are said to be either the helpers or the
enemies of malignant cells (5). On the other hand, the bone
marrow cavity has a hypoxic condition and its low oxygen
tension provides a special situation for hematopoietic
cells and other components of hematopoiesis, which
clearly affects the status of transcription factors and gene
expression profiles of the cells (6). One of the essential
effects of hypoxia is the induction of hypoxia inducible
factor-1 (HIF1) expression, a transcription factor that is the
cause of various events including angiogenesis, increase
in metabolism, and the initiation of the production of
diverse proteins. This case is more considerable for the
bone marrow resident cells (7). To mimic the hypoxic
situation, we used CoCl2 as a HIF1 inducer (8).The most crucial genes involved in cell survival and
death are the BCL2 family members, among which, BAX
and BCL2 have great importance. Dysregulation of BAX
and BCL2 expression is evident in various types of cancers
(9). For example, a common feature of cancerous cells is
overexpression of the BCL2 that is frequently linked
with poor prognosis and chemotherapy resistance (10).
Epigenetics is one of the central mechanisms for such
changes in mammalian cells and DNA methylation is
the most well-known epigenetic mechanism involved
in the regulation of gene expression. Methylation
mainly occurs at specific positions in gene promoters
called CpG islands, in which a methyl group attaches
to the 5th atom of the ring in the cytosine base in a
non-exclusive manner and inhibit transcription factor
adherence to the DNA, and consequently cause down-
regulation of gene expression (11-13).According to the "two hit hypothesis", the aberrant
methylation can be considered as a third factor in
carcinogenesis (13). Nowadays, epigenetic mechanisms
are interesting targets for cancer treatment studies. Of
course, these therapeutic strategies are in their infancy
and they sometimes show incompatible consequences
(14), but the imagination of a positive future for them is
not too implausible (15).Since hypoxia can provide a connection between the
extra-cellular environment, methylation of DNA, and
carcinogenesis, in the current study, the methylation levels
of BAX and BCL2 genes, as the critical genes involved
in cell death and survival, are evaluated via methylation
specific polymerase chain reaction (MSP) in MOLT-4
cells, a T-ALL cell line, co-cultured with bone marrow
MSCs under hypoxic condition.
Materials and Methods
In this experimental study that has been approved
by the Ethics Committee of the Tabriz University of
Medical Sciences, the MOLT-4 cells were provided from
Pasteur Institute Cell Bank (Tehran, Iran) and cultured
in RPMI 1640 (Gibco Laboratories, Grand Island, NY)
medium containing 10% fetal bovine serum (FBS, Gibco
Laboratories, Grand Island, NY). The cells were incubated
in 5% CO2 incubator at 37°C. Bone marrow MSCs
were purchased from Royesh Stem Cell Biotechnology
Institute Cell Bank (Tehran, Iran) and cultured in DMEM
(Dulbecco’s Modified Eagle Medium, Gibco Laboratories,
Grand Island, NY) including 10% FBS, then incubated in
5% CO2 at 37°C humidified atmosphere.
Evaluation of direct CoCl2 toxicity for the cells
The cytotoxicity of CoCl2 was measured by Trypan Blue
and 3-(4,5-dimethyl thiazol-2-yl)-5-diphenyl tetrazolium
bromide (MTT) assays to reach the maximum levels
of HIF1 induction with no significant cell death. The
cytotoxicity of CoCl2 on the MOLT-4 cells was assessed
using treatment of the cells with differing concentrations
of cobalt chloride with various timings (25, 50, 100, 150,
and 200 µM CoCl2).
MOLT-4 cell co-culture with mesenchymal stem cells
and hypoxic treatment
The MSCs were seeded at a density of 5×104 cells/cm2
in plates containing DMEM. Once every three days, the
medium was replaced with fresh medium, until the MSC
feeder layer reached confluence (70-80%). Next, 2×106
MOLT-4 cells were added to the culture and incubated for
6, 12, and 24 hours. Following that, we treated the MOLT-
4 and MSCs, in various designed modes, with 100 µM
CoCl2. The cells were incubated in a 5% CO2 incubator at
37°C for 6, 12, and 24 hours.
Extraction of DNAand treatment with sodium bisulfite
Extraction of total DNA from MOLT-4 cells was
done at 6, 12, and 24 hours after the co-culture using
a DNA extraction Kit (YT9040) according to the
manufacturer’s directions. The DNA quality was
evaluated by spectrophotometry and calculated by
the ratio of the optical density of DNA (260 nm) and
optical density of protein (280 nm). Sodium bisulfite
(SBS) treatment was applied to the extracted DNA. It
transforms unmethylated cytosines to uracils.Freshly prepared solutions of SBS and hydroquinone
were utilized. Primary denaturation of DNA was initiated
with 2 M solution of NaOH, then the tube was incubated
for 20 minutes at 37°C. The treatment of denaturated
DNA with 3 M SBS (pH=5) and 10 mM hydroquinone
was performed, then covered under a layer of mineral oil
and incubated for 16 hours at 50°C.At this point, the purification of modified DNA was
performed using YT9040 DNA purification columns
as stated by the manufacturer, then eluted into 150
µl of elution buffer. Subsequently, desulfonation was
accomplished by adding 3 M NaOH solution and
incubating at room temperature for 5 minutes. The
neutralization of the solution was done by adding 3M
ammonium acetate (pH=7.0). Next, by adding 4 times
the current volume in ethanol, the DNA was precipitated.
Drying and resuspending in 20 µl double distilled water
were the following steps. SBS treated DNA was used
directly for MSP or stored at -20°C.
Genomic DNA methylation using SssI methylase
enzyme
Methylated DNA needed to be prepared as the positive
control for MSP. DNA was extracted from peripheral
blood and methylated with the Sss1 methylase enzyme
(Biolabs, New England, US) following producer’s
directions (16). The methylated DNA was immediately
extracted via YT9040 DNA extraction kit and exposed
to SBS treatment, then used as a positive control for the
methylated DNA-specific primer (meth primer).
Methylation specific polymerase chain reaction
MSP was performed to evaluate the methylation status
of the BAX and BCL2 promoters. MSP-specific primers
are able to discern between methylated and unmethylated
DNA sequences. The designing of MSP primers was done
through MethPrimer software (17). The forward and
reverse primers for BAX and BCL2 genes have been listed
(Table 1).For the MSP test, the bisulfite-treated DNA of MOLT-4
cells was used along with control samples including SssItreated
DNA, meth primer positive control, peripheral blood
SBS-treated DNA, a positive control for unmethylated
DNA-specific primer (unmeth primer), normal human
DNA with no SBS treatment as the negative control for
both primers, and No-DNA sample as a negative control
for the PCR reaction. The PCR mixture contained 12.5 µL
of PCR master mix (Ampliqon, DENMARK), 1.25 µL of
each forward and reverse primers (in a final concentration
of 0.5 pM), bisulfite-modified DNA (150 ng), and double
distilled water, in the final volume of 25 µl. The thermal
cycler (MyCycler-BioRad) was used for amplification.
The time and thermal periods of PCR were as follows: 5
minutes at 95°C for 1 cycle, subsequently 45 seconds at
95°C, 30 seconds at 59°C, then 45 seconds at 72°C, for 35
cycles. Next, an ultimate extension for 5 minutes at 72°C.
Finally, in order to separate the PCR reaction products,
electrophoresis was carried out on a 1.5% agarose gel and
colored using safe stain, then studied under UV light.
Statistical analysis
Three separate tests have been performed for each value
and the data reported as mean ± SD. The significance of
data has been presented as P<0.05 by the t student test
using SPSS 16 (SPSS Inc., Chicago, IL, USA).
Results
Cell toxicity assessment of CoCl2-treated cells
CoCl2 is a hypoxia mimicry agent that induces HIF1
expression in a dose-dependent manner. Our results
showed that CoCl2 in less than 100 µM doses, doesn’t
significantly suppress cell growth in 24, 48, or 72 hours,
and in more than 100 µM doses, CoCl2 was lethal to
the cells in every exposure time. Therefore, 100 µM
concentration of CoCl2 was chosen as the best dose
during 24 hours. Indeed, this step has been conducted
to achieve the highest possible dose of CoCl2, to reach
the maximum possible amount of HIF1, in which the
cells can stay alive (Fig.1).The MSP-specific primers of BAX and BCL2 genes*; Annealing temperature and **; Nucleotide numbers.The evaluation of direct cytotoxicity of CoCl2 for the MOLT-4 cells. The MOLT-4 cells have been treated with different concentrations of COCl2 (25, 50,
100, 150, 200 µM) during 24, 48, and 72 hours. A. MOLT-4 cells counting using Trypan blue and B. MOLT-4 cells viability assessment using MTT assay. The
data shows that the highest possible concentration of CoCl2 for HIF1 induction without significant cell death is 100 µM in 24 hours. Error bars represent
standard deviations and data significance levels are shown as *P<0.05.
Analysis of MOLT-4 cells growth curve in co-
culture with mesenchymal stem cells under hypoxic
conditions
Untreated and cobalt-exposed (100 µM, 24, 48, and
72 hours) MOLT-4 cells were cultured in matching
numbers. After 24, 48, and 72 hours, the cells were
counted using Trypan blue staining. Diverse conditions
were provided for MOLT-4 cells in the culture
medium (besides MSCs, CoCl2, MSCs and CoCl2).
Our outcomes revealed that MSCs have suppressed
the growth of MOLT-4 cells in every timeframe. In
addition, hypoxia alone also has an inhibitory effect
on MOLT-4 cells proliferation in all time periods. As
expected, when we exposed MOLT-4 cells to MSCs
and hypoxia simultaneously, the cells growth showed
another drop (Fig.2).
The methylation status of the BAX gene promoter
Investigating the BAX gene promoter methylation
status in the untreated MOLT-4 cells showed that
both meth and unmeth primers made positive results
in the MSP test. These results were constant during
all of the study periods and none of them showed
absolute methylation or unmethylation for this gene’s
promoter. The final results of the MSP test were
positive for meth and unmeth primers of BAX gene
in the various designed conditions at 6, 12, and 24
hours (Fig.3).
The methylation status of the BCL2 gene promoter
The MSP results showed that the promoter of BCL2
in the untreated MOLT-4 cells was in the unmethylated
state. As shown in Figure 4, the meth primer for BCL2,
in contrast to the unmeth primer, had a negative result
and showed no visible band after electrophoresis. The
BCL2 gene remained in the unmethylated status in all
various conditions including MOLT-4 cells, MOLT-4
and MSCs, MOLT-4 and CoCl2, MOLT-4 and MSCs
with CoCl2 (Fig.4).MOLT-4 cells counting under different conditions of cell culture.
Cell counting was done after 24, 48, and 72 hours. Error bars represent
standard deviations and data significance levels are shown as *P<0.05.The MSP results for the BAX gene promoter in various conditions at 6, 12, and 24 hours with Meth and unmeth primers. The condition of
each line has been described in the bottom of the picture. The positive result with the meth primer generates a 162bp product, and with the
unmeth primer, it generates a 167 bp product. As shown in the picture, the studied sequence of the BAX gene promoter revealed positive results
with both meth and unmeth primers, indicating its partial methylation status in all conditions.The MSP results for the BCL2 gene promoter in various conditions at 6, 12, and 24 hours with meth and unmeth primers. The condition of each line
has been described in the bottom of the picture. The positive result with the eth primer generates a 192 bp product, and with unmeth primer, it generates
a 194bp product. As shown in the picture, the studied sequence of BCL2 gene promoter revealed negative results with the meth primer, and positive
results with the unmeth primer, indicating its fully-unmethylated status under all conditions.
Discussion
HIF1 is a key regulator of cell response to hypoxia that
can impress several mechanisms in the cell and have a
critical role in carcinogenesis (18). It also has an effect
on epigenetic mechanisms including DNA methylation.
Liu et al. (9) reported that HIF1 expression can result in
several genes being demethylated through a decrease in
the steady-state form of S-adenosyl methionine (SAM).
As expected, the anti-apoptotic genes of cancerous cells
routinely have high expression levels (19). BCL2 is one
of the fundamental anti-apoptotic genes that is important
for the unnatural survival of malignant cells and their
resistance to chemotherapy (20). Since the methylation
of the promoter region can silence a gene, if promoter
loses its methylation, the gene can reach to higher levels
of expression (21).Our results have shown that the BCL2 gene promoter
in untreated MOLT-4 cells was in the fully unmethylated
state, similar to Chatterton et al.’s investigations on
ALL cells in 2014 (22). In the following steps, to make
the environment of the MOLT-4 cells closer to the bone
marrow microenvironment, we co-cultured them with
MSCs that are the essential components of the BM
stroma, and treated them with CoCl2, as a HIF1 inducing
factor. Of course, CoCl2 has some limitations like its
toxicity, nonetheless, because of some of its benefits, like
accessibility, it is a commonly used substance in numerous
studies (23-25).The aforementioned conditions for MOLT-4 cells in the
present study weren’t able to affect the methylation status of
the BCL2 promoter. Another study by our team, investigating
BAX and BCL2 expression levels in similar situations
through the real-time PCR, showed that BCL2 expression in
the untreated MOLT-4 cells was higher than normal T cells,
and co-culturing with MSCs and treatment with CoCl2 have
increased this expression even more (26). This significant
increase in BCL2 expression is in contrast to some studies
like Wang et al. (13), but in complete coordination with
the results of the current study. The correlation between
the increased expression of BCL2 and loss of methylation
is totally logical. Regarding the BCL2 functions, we can
state that the MSCs and hypoxic condition have a favorable
effect on this gene’s expression and it has no association
with promoter methylation. So, other mechanisms might be
involved in this increase (27, 28).The investigations about the BCL2 gene expression
and its promoter methylation in various cancers have
led to different and sometimes conflicting results, such
as both up and down regulation of this gene by various
mechanisms (13, 29, 30). It is stated by Hogarth and Hall
(29) that the BCL2 expression levels can’t be useful in
the prognosis of the ALL patients, but obviously, the
downregulation of this gene, which might be happening
via the promoter methylation processes, can be a valuable
factor in tumor regression. On the other hand, MSCs
can secrete several hematopoiesis-supporting and niche
enhancing cytokines under hypoxia (3). Frolova et al.
(31) provided similar conditions for ALL cancer cells and
demonstrated diminished apoptosis in these cells. It is
clear that the BCL2 expression increase is supportive for
malignant MOLT-4 cells, but our data shows that this case
has no association with the methylation machinery.The BAX gene is a central pro-apoptotic gene that can
cause cell death and limit cancer progression (32). The
BAX gene promoter was methylated in many different
tumors, according to several reports (33-35). Our results
have shown that this gene was in the partial methylation
state in the untreated MOLT-4 cells. It means that both
meth and unmeth primers for the BAX gene promoter
exhibited positive results in MSP test.Our findings showed no change in the promoter
methylation levels of the BAX gene, which was in the
partial methylated mode before and after the co-culture
with MSCs and treatment with CoCl2. Of course, MSP is a
non-quantitative method and is not capable of determining
the precise percentage of methylation (36), thus, the
difference between various results of partial methylation
wasn’t measurable for us. However, the evaluation of
BAX expression showed that the gene expression had
no remarkable changes before and after co-culture with
MSCs and treatment with CoCl2 (26).The BAX gene only showed an insignificant increase
in the various conditions of the study compared
with the untreated MOLT-4 cells and it is actually
explainable with our results from MSP. In fact, the
loss of substantial changes in gene expression is
in line with the insignificant alterations in the gene
promoter methylation levels. So, even if methylation
has a role in BAX expression process of MOLT4
cells, we cannot prove this point with the current
outcomes. In total, as the MSCs and hypoxia don’t
apply any significant impact on BAX expression, they
don’t markedly change the methylation levels. Just
like the inconsistencies about BCL2 methylation and
expression status in ALL cells, there are many unlike
information about BAX gene too. For example, Wang
et al. (13) published article mentioned that the BAX
gene is increased in ALL cells, which was supported
by Kaparou et al. (37) studies, whereas Prokop et al.
(38) have reached a completely opposite conclusion.Although the increase of BAX expression was
insignificant, it might be due to the demethylation of its
promoter region. It should be assessed by more accurate
methods than MSP, e.g. Bisulfite-Sequencing PCR (BSP)
and Methylation-Sensitive-High Resolution Melting
(MS-HRM) (39, 40). Of course, the methylation is a time-
consuming process and should be assessed in longer time
periods. We know it is possible that our results might vary
after more time, and further investigations.
Conclusion
Although limited, our study attempts to bring new
parameters together, which were rarely addressed
before, and examine their effects on survival-related
genes of a malignant human cell line. We showed that
MSCs and hypoxia couldn’t change the methylation
signature of BAX and BCL2 promoters in particular
studied regions. Obviously, the promoter methylation
levels may undergo different alterations in other
regions that weren’t considered in the current study.
This material can broaden our perspective about the
mechanisms involved in the regulation of cancer
cell survival, and someday, may be helpful for novel
therapeutic strategies.
Table 1
The MSP-specific primers of BAX and BCL2 genes
Target sequence
Primer sequencing (5ʹ- 3ʹ)
Tₐ* (C˚)
Amplicon size (bp)
Amplified region**
BAX
Meth-F: GTATTAGAGTTGCGATTGGACGG
59
162
48954657-48954819
Meth-R: AAAATAACCGCTACCCCGC
Unmeth-F: GAAGGTATTAGAGTTGTGATTGGATG
58.5
167
48954653-48954820
Unmeth-R: CAAAATAACCACTACCCCACAA
BCL2
Meth-F: GTTTTTAGCGTTCGGTATCGG
60
192
63319549-63319741
Meth-R: AAATCTCTATCCACGAAACCGC
Unmeth-F: GGGTTTTTAGTGTTTGGTATTGG
59
194
63319549-63319743
Unmeth-R: AAATCTCTATCCACAAAACCACTTC
*; Annealing temperature and **; Nucleotide numbers.
Authors: A Prokop; T Wieder; I Sturm; F Essmann; K Seeger; C Wuchter; W D Ludwig; G Henze; B Dörken; P T Daniel Journal: Leukemia Date: 2000-09 Impact factor: 11.528