| Literature DB >> 29616002 |
Zhongwei Wang1, Aislinn Dunne1, Mark C M van Loosdrecht2, Pascal E Saikaly1.
Abstract
Saline wastewater is known to affect the performance of phosphate-accumulating organisms (PAOs) in enhanced biological phosphorus removal (EBPR) process. However, studies comparing the effect of salinity on different PAO clades are lacking. In this study, 'Candidatus Accumulibacter phosphatis' Clade I and II (hereafter referred to as PAOI and PAOII) were highly enriched (∼90% in relative abundance as determined by quantitative FISH) in the form of granules in two sequencing batch reactors. Anaerobic and aerobic batch experiments were conducted to evaluate the effect of salinity on the kinetics and stoichiometry of PAOI and PAOII. PAOI and PAOII communities showed different priority in using polyphosphate (poly-P) and glycogen to generate ATP in the anaerobic phase when exposed to salt, with PAOI depending more on intracellular poly-P degradation (e.g., the proportion of calculated ATP derived from poly-P increased by 5-6% at 0.256 mol/L NaCl or KCl) while PAOII on glycolysis of intracellularly stored glycogen (e.g., the proportion of calculated ATP derived from glycogen increased by 29-30% at 0.256 mol/L NaCl or KCl). In the aerobic phase, the loss of phosphate uptake capability was more pronounced in PAOII due to the higher energy cost to synthesize their larger glycogen pool compared to PAOI. For both PAOI and PAOII, aerobic conversion rates were more sensitive to salt than anaerobic conversion rates. Potassium (K+) and sodium (Na+) ions exhibited different effect regardless of the enriched PAO culture, suggesting that the composition of salt is an important factor to consider when studying the effect of salt on EBPR performance.Entities:
Keywords: enhanced biological phosphorus removal; phosphate-accumulating organism (PAO); saline wastewater; water scarcity; ‘Candidatus Accumulibacter phosphatis’ Clade I and II
Year: 2018 PMID: 29616002 PMCID: PMC5865004 DOI: 10.3389/fmicb.2018.00479
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Primers and qPCR conditions used in this studya.
| Primer | Sequence (5′ – 3′) | Target | Primer concentration (nM) | T (°C) |
|---|---|---|---|---|
| Acc-ppk1-763f | GACGAAGAAGCGGTCAAG | Acc-I | 500 | 61 |
| Acc-ppk1-1170r | AACGGTCATCTTGATGGC | |||
| Acc-ppk1-893f | AGTTCAATCTCACCGAGAGC | Acc-IIA | 550 | 61 |
| Acc-ppk1-997r | GGAACTTCAGGTCGTTGC | |||
| Acc-ppk1-870f | GATGACCCAGTTCCTGCTCG | Acc-IIB | 400 | 61 |
| Acc-ppk1-1002r | CGGCACGAACTTCAGATCG | |||
| Acc-ppk1-1123f | GAACAGTCCGCCAACGACC | Acc-IIC | 500 | 63 |
| Acc-ppk1-1376r | ACGATCATCAGCATCTTGGC | OTU NS D3 | ||
| Acc-ppk1-375f | GGGTATCCGTTTCCTCAAGCG | Acc-IID | 400 | 63 |
| Acc-ppk1-522r | GAGGCTCTTGTTGAGTACACGC | |||
Relative abundance of specific Accumulibacter clades within the total Accumulibacter lineagea.
| I | IIA | IIB | IIC | IID | |
|---|---|---|---|---|---|
| SBR1b | ∖ | 0.2 ± 0.1% | 4.8 ± 0.9% | ∖ | |
| SBR2b | 4.2 ± 1.1% | 30.9 ± 1.9% | 8.1 ± 2.4% | 0.7 ± 0.2% | |
Stoichiometric values of enriched PAOI and PAOII cultures calculated from the batch experiments.
| Enriched cultures | Salinity (mol/L) | Anaerobic | Aerobic | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| P/HAc (P-mol/C-mol) | Gly/HAc (C-mol/C-mol) | PHA/HAc (C-mol/C-mol) | P/PHA (P-mol/C-mol) | Gly/PHA (C-mol/C-mol) | |||||||
| Batch 1 | Batch 2 | Batch 1 | Batch 2 | Batch 1 | Batch 2 | Batch 1 | Batch 2 | Batch 1 | Batch 2 | ||
| PAOI | Control | 0.49 | 0.55 | 0.29 | 0.33 | 1.37 | 1.51 | 0.37 | 0.41 | 0.21 | 0.25 |
| NaCl-0.171 | 0.52 | 0.56 | 0.29 | 0.33 | 1.30 | 1.40 | 0.31 | 0.33 | 0.22 | 0.25 | |
| KCl-0.171 | 0.52 | 0.54 | 0.29 | 0.33 | 1.25 | 1.35 | 0.32 | 0.33 | 0.23 | 0.24 | |
| NaCl-0.256 | 0.72 | 0.78 | 0.30 | 0.36 | 1.20 | 1.32 | 0.20 | 0.24 | 0.20 | 0.22 | |
| KCl-0.256 | 0.69 | 0.73 | 0.26 | 0.41 | 1.16 | 1.46 | 0.23 | 0.25 | 0.21 | 0.23 | |
| PAOII | Control | 0.32 | 0.34 | 1.15 | 1.28 | 1.50 | 1.62 | 0.18 | 0.20 | 0.66 | 0.84 |
| NaCl-0.171 | 0.37 | 0.38 | 1.42 | 1.56 | 1.26 | 1.48 | 0 | 0.01 | 0.72 | 0.76 | |
| KCl-0.171 | 0.32 | 0.34 | 1.40 | 1.48 | 1.35 | 1.47 | 0 | 0.04 | 0.71 | 0.77 | |
| NaCl-0.256 | 0.32 | 0.34 | 2.03 | 2.17 | 1.24 | 1.44 | -0.12 | -0.06 | 0.62 | 0.66 | |
| KCl-0.256 | 0.31 | 0.33 | 2.90 | 2.15 | 1.05 | 1.34 | -0.07 | -0.09 | 0.62 | 0.66 | |