Genetic contexts related to the diffusion of plasmid-mediated CTX-M-55 extended-spectrum beta-lactamase isolated from Enterobacteriaceae in China.

BACKGROUND: CTX-M-55 extended-spectrum beta-lactamases are being rapidly disseminated and transmitted in clinical practices around the world. The genetic contexts of the transferable plasmid-mediated blaCTX-M-55 gene in Enterobacteriaceae were detected and characterized in this study.
METHODS: Isolates were obtained from the First Affiliated Hospital of Zhengzhou University between September 2015 and March 2016. Based on polymerase chain reaction and BLAST analysis, resistance genes and genetic context of the blaCTX-M-55 gene were investigated. Conjugation experiments and multilocus sequence typing were performed to demonstrate plasmid-mediated blaCTX-M-55 transmission.
RESULTS: Thirteen blaCTX-M-55-positive isolates of Enterobacteriaceae were obtained. Seven isolates were Escherichia coli, 3 were Klebsiella pneumoniae, 1 was Citrobacter freundii, 1 was Morganella morganii and 1 was Serratia marcescens. The blaCTX-M-55 gene has not previously been identified from C. freundii and M. morganii. Four different blaCTX-M-55 genetic contexts were identified, and all of them harbored ISEcp1 in the region upstream of blaCTX-M-55 (in two cases, ISEcp1 was truncated by IS26, and in one case, it was truncated by IS1294), whereas ORF477 was detected downstream of the blaCTX-M-55 gene from 12 of 13 strains. The novel genetic context of ISEcp1∆-blaCTX-M-55-∆IS903 was firstly detected the IS903 element which was identified downstream of blaCTX-M-55. A conjugation assay revealed that all blaCTX-M-55 plasmids were quickly and easily transferable to recipient E. coli, which then presented resistance to multiple antibiotics.
CONCLUSIONS: Numerous blaCTX-M-55-positive strains were isolated in a short period of 7 months. The findings indicate that blaCTX-M-55 was rapidly disseminated. The genetic context and conjugative transfer found in this study demonstrate that there is active transmission of blaCTX-M-55 among strains of Enterobacteriaceae in China, which could give rise to an urgent global public health threat.

Background

Since the first reports of CTX-M extended-spectrum beta-lactamases (ESBLs) in 1989 [1], at least 26 bacterial species across the world have been referenced in the “CTX-M pandemic” [2]. More than 190 diverse variants of CTX-M have been recorded to date. Among these variants, CTX-M-55 pertains to the CTX-M-1 cluster, which is a variant of CTX-M-15 with only one amino acid substitution (Ala-80-Val) [3]. This variant was first reported in 2006 [4] and was identified in Thailand as well as in the UK [3-5]. Over the past decade, the isolate rate of CTX-M-55 in Escherichia coli from animals has been increasingly raised. However, CTX-M-55 was not identified in clinical practices in China until 2010, when it was detected from a person who traveled to China [6]. Since then, plenty of surveys have confirmed the emergence of bla among clinical pathogenic in China [7-11].

Conjugative plasmids are one of the most important mechanisms for the appearance and spread of bla. These plasmids facilitate horizontal transfer to other isolates and even cross-species barriers [12]. Insertion sequences (ISs), which cause insertion mutations and genome rearrangements, are the smallest mobile elements (< 2.5 Kb) independent transposition in an organism and competent to promote translocation, and the transferability of a resistance gene will largely increased under the mediated of ISs [13]. Various types of genetic platforms are associated with bla genes, and ISEcp1 is frequently recorded upstream of bla. ISEcp1 can transpose the bla gene and act as a strong activator for the high expression of it [12, 14, 15]. In addition, other insertion sequences, including IS26, IS903 and ORF477, are also frequently detected surrounding bla [16, 17].

Thus, this study intends to inquire into the prevalent trend of bla genes and their transferability and genetic contexts among clinical strains in Henan Province in central China.

Methods

Bacterial isolates, antimicrobial susceptibility testing and ESBLs confirmation

Total number of 227 unduplicated ESBL-positive Enterobacteriaceae [Escherichia coli (n = 93), Klebsiella pneumoniae (n = 86), Enterobacter cloacae (n = 13), Enterobacter aerogenes (n = 6), Proteus mirabilis (n = 7), Citrobacter freundii (n = 13), Morganella morganii (n = 3), Serratia marcescens (n = 5), and Shigella flexneri (n = 1)] clinical isolates were obtained from the First Affiliated Hospital of Zhengzhou University in Central China between September 2015 and March 2016. All strains were confirmed by using Vitek 2 (bioMérieux, France). Antimicrobial susceptibility for the blaCTX-M-55-producing strains and transconjugants were determined using Vitek 2, followed by the measurement of minimum inhibitory concentrations (MICs) utilizing the broth microdilution method (for piperacillin–tazobactam, ampicillin–sulbactam, cefotaxime, ceftazidime, cefotetan, cefepime, imipenem, ertapenem, amikacin, gentamicin, levofloxacin, and ciprofloxacin). Microbroth and agar dilution methods were standardized following the protocols from the Clinical and Laboratory Standards Institute (CLSI) [18]. The MIC results were judged by 2014 CLSI criteria [18]. All isolates were confirmed to have the ESBL phenotype through the CLSI disc confirmatory test [18]. K. pneumoniae ATCC 700603 and E. coli ATCC 25922 were used as quality control strains.

Identification of resistance genes and the genetic contexts of bla

To verify the emergence of plasmid-mediated ESBL genes, all ESBL-positive strains were further characterized, and plasmid DNA was extracted utilizing a Tiangen Plasmid Purification Mini Kit (Tiangen Biotech, China) referring to the protocol of manufacturer. The primer sequences presented in Table 1 were used for the bla, bla, and bla to determine the genetic context of bla. Purified PCR productions were sequenced immediately from two ends and compared with genes in GenBank (http://www.ncbi.nlm.nih.gov/genebank/).

Table 1

PCR primers characteristics in this study

PCR target	Primer name	Primer sequence (5′→3′)	Annealing temperature (°C)	Product (bp)	Reference
Upstream flanking region of blaCTX-M-55	ISEcp1-F	CAAAATGATCCCCTCGTCAAC	55	Variable	[29]
	IS26-F	TTACATTTCAAAAACTCTGCTTACC	57	Variable	[32]
	blaCTX-M-1-R	ACTTTACTGGTACTGCACAT
Downstream flanking region of blaCTX-M-55	blaCTX-M-1-F	TTCTGGTGACRTACTTRACCCA
	IS903-R	GTTTAATGACCAGCACAGT	55	364	This study
	ORF477-R	TCGTTTCGTGGTGCTGAATTT	57	Variable	[29]
bla CTX-M-1	blaCTX-M-1-F	CAGCGCTTTTGCCGTCTAAG	52	946	This study
	blaCTX-M-1-R	GGCCCATGGTTAAAAAATCACTGC
bla TEM	blaTEM -F	CATTTCCGTGTCGCCCTTATTC	56	800	[11]
	blaTEM -R	CGTTCATCCATAGTTGCCTGAC
bla SHV	blaSHV -F	AGCCGCTTGAGCAAATTAAAC	55	713	[11]
	blaSHV -R	ATCCCGCAGATAAATCACCAC

Multilocus sequence typing (MLST)

MLST for clinical E. coli and K. pneumoniae strains were detected basis on the assay discussed above [19, 20]. The sequence types (STs) and allelic profiles were assigned after comparing them to an online database (http://bigsdb.Pasteur.fr/ecoli/ecoli.html and http://bigsdb.Pasteur.fr/klebsiella/klebsiella.html).

Conjugation experiments

Conjugative assays were performed using the methods discussed above [7]. The bla-positive isolates served as donors, and E. coli C600 functioned as a recipient. Transconjugants were screened on Mueller–Hinton agar containing 750 μg/ml rifampin and 100 μg/ml ampicillin. The existence of bla in the transconjugants was identified through antimicrobial susceptibility, PCR and DNA sequencing.

Results

Identification of bla-positive isolates and their antimicrobial susceptibility and resistance determinants

Based on the results of this study, among 227 ESBL-positive Enterobacteriaceae, 13 [13/227 (5.73%)] were identified as bla-positive, including 7/93 E. coli, 3/86 K. pneumoniae, 1/13 C. freundii, 1/3 M. morganii, and 1/5 S. marcescens, which were collected from blood (n = 6), urine (n = 3), and sputum (n = 3) samples (Table 2). The antimicrobial susceptibility analyses of the 13 bla-positive isolates are presented in Table 3. All strains were insusceptible to third-generation cephalosporins (ceftazidime and cefotaxime), fluoroquinolones (levofloxacin and ciprofloxacin), and gentamicin. In addition, 100% susceptibility to amikacin was found. The isolates were also generally sensitive to imipenem (10/13, 76.92%) and ertapenem (9/13, 69.23%), whereas all the other microbiotics, including cefepime, cefotetan and piperacillin–tazobactam, exhibited moderate to low susceptibility. Additionally, among 13 isolates carrying bla, 5 isolates contained bla, and 2 isolates had both bla and bla (Table 3).

Table 2

Characterisitics of blaCTX-M-55-positive isolates

Isolate	Specimen	Department	ESBL	MLST
EC30	Blood	Urology	TEM/SHV	ST156
EC32	Blood	Gastroenterology	–	ST305
EC44	Urine	Respiration	–	ST182
EC45	Sputum	ICU	TEM	ST305
EC52	Blood	Urology	–	ST381
EC54	Blood	EICU	–	ST446
EC67	Blood	Gastroenterology	TEM	ST2
KP26	Sputum	Thoracic surgery	TEM	ST148
KP37	Blood	General surgery	TEM/SHV	ST269
KP146	Urine	Urology	TEM	ST37
CF547	Urine	Urology	–	–
MM556	Drainage fluid	Anus and intestine surgery	TEM	–
SM554	Sputum	Neurosurgery	–	–

EC, E. coil; KP, K. pneumoniae; CF, C. freundii; MM, M. morganii; SM, S. marcescens; ICU, intensive care unit; EICU, emergency ICU

Table 3

Antibiotic susceptibilities of bla-positive and their transconjugants

Isolate	Antibiotica susceptibility (μg/ml)
	SAM	TZP	CTX	CAZ	CTT	FEP	IPM	ETP	AMK	GEN	LVX	CIP
EC30	> 256	> 256	> 256	> 256	> 256	> 256	< 1	2	< 2	64	> 32	> 32
EC32	> 256	8	> 256	> 256	8	> 256	< 1	1	< 2	64	16	8
EC44	> 256	8	> 256	> 256	8	> 256	< 1	<0.5	< 2	32	16	8
EC45	> 256	64	> 256	> 256	32	> 256	< 1	<0.5	< 2	32	16	8
EC52	> 256	8	> 256	> 256	8	2	< 1	<0.5	< 2	64	> 32	8
EC54	> 256	8	> 256	> 256	8	16	< 1	<0.5	< 2	32	16	8
EC67	> 256	> 256	> 256	> 256	>256	> 256	< 1	2	< 2	32	> 32	8
KP26	> 256	64	> 256	> 256	32	> 256	< 1	1	< 2	32	> 32	8
KP37	> 256	> 256	> 256	> 256	> 256	> 256	8	2	< 2	32	16	8
KP146	> 256	64	> 256	> 256	> 256	> 256	8	2	< 2	64	> 32	8
CF547	> 256	8	> 256	64	8	> 256	< 1	< 0.5	< 2	64	16	8
MM556	> 256	64	> 256	> 256	> 256	2	< 1	< 0.5	< 2	32	16	8
SM554	> 256	8	> 256	64	8	> 256	8	< 0.5	4	32	16	8
E. coil transconjugants
EC30-C600	> 256	64	> 256	> 256	> 256	> 256	< 1	2	< 2	64	< 0.25	< 0.25
EC32-C600	> 256	8	> 256	> 256	8	8	< 1	1	< 2	32	< 0.25	< 0.25
EC44-C600	> 256	8	128	64	4	4	< 1	< 0.5	< 2	32	< 0.25	< 0.25
EC45-C600	> 256	32	> 256	> 256	32	16	< 1	< 0.5	< 2	16	< 0.25	< 0.25
EC52-C600	> 256	8	> 256	128	8	2	< 1	< 0.5	< 2	32	< 0.25	< 0.25
EC54-C600	> 256	8	128	> 256	8	16	< 1	< 0.5	< 2	32	< 0.25	< 0.25
EC67-C600	> 256	> 256	> 256	128	> 256	> 256	< 1	2	< 2	16	< 0.25	< 0.25
KP26-C600	> 256	32	> 256	> 256	16	8	< 1	1	< 2	32	< 0.25	< 0.25
KP37-C600	> 256	64	64	128	> 256	8	8	2	< 2	16	< 0.25	< 0.25
KP146-C600	> 256	32	> 256	> 256	> 256	> 256	8	2	< 2	64	< 0.25	< 0.25
CF547-C600	> 256	4	> 256	64	8	32	< 1	< 0.5	< 2	32	< 0.25	< 0.25
MM556-C600	> 256	64	64	> 256	> 256	2	< 1	< 0.5	< 2	16	< 0.25	< 0.25
SM554-C600	> 256	8	> 256	64	8	32	8	< 0.5	4	32	< 0.25	< 0.25
EC-C600	< 2	< 4	< 1	< 1	< 4	< 1	< 1	< 0.5	< 2	< 1	< 0.25	< 0.25

EC, E. coil; KP, K. pneumoniae; CF, C. freundii; MM, M. morganii; SM, S. marcescens

aSAM, ampicillin–sulbactam (1/0.5–256/128) [(μg/ml) for each agent, and the numbers in parentheses indicate the test range]; TZP, piperacillin–tazobactam (0.5/4–256/4); CTX, cefotaxime (0.03–256); CAZ, ceftazidime (0.03–256); CTT, cefotetan (0.03–256); FEP, cefepime (0.015–256); IPM, imipenem (0.06–32); ETP, ertapenem (0.004–32); AMK, amikacin (0.5–256); GEN, gentamicin (0.25–256); LVX, levofloxacin (0.008–32); CIP, ciprofloxacin (0.004–32)

MLST and conjugal transfer of the bla gene

MLST was detected for bla-positive E. coli and K. pneumoniae strains. Nine types of MLST were detected among the 7 E. coli strains (ST156, ST305, ST182, ST381, ST446 and ST2) and 3 K. pneumoniae strains (ST148, ST269 and ST37). Two E. coli isolates (EC32 and EC45) shared the same ST type (ST305) (Table 2). Conjugative assays indicated that all bla plasmids were transmitted to E. coli C600 from 13 donors successfully through conjugation. Although all transconjugants exhibited resistance to cefotaxime and ceftazidime, they were all sensitive to fluoroquinolones. Additionally, the bla and bla resistance genes were transformed to E. coli C600 with the bla for some isolates (Table 3).

Genetic contexts of bla

The flanking region of bla is presented in Fig. 1. Four different architectures [type I (9 isolates), type II (2 isolates), type III (1 isolate), and type IV (1 isolate)] were identified regarding the genetic contexts of the plasmid-mediated bla genes. Type I architecture (ISEcp1∆-bla-∆ORF477) was the most common and was identified in 9 (69.23%) of 13 bla-positive isolates; the occurrence of type II (IS26-∆ISEcp1-bla-∆ORF477) and type III architecture (ISEcp1∆-IS1294-∆ISEcp1-bla-∆ORF477) was similar to type I architecture, although ISEcp1 was disrupted by IS26 in type II and by IS1294 in type III. Type IV (ISEcp1∆-bla-∆IS903) was characterized by the existence of IS903, which was detected firstly downstream of bla.

Fig. 1

Surrounding the regions of bla gene in this study. Type I architecture (ISEcp1∆-bla-∆ORF477) was found in isolates (EC32, EC44, EC52, EC67, KP26, KP146, CF547, MM556, SM554) (GenBank Accession Numbers: KX889071; KX889081; KX889072; KX889073; KX889074; KX889075; KX889076; KX889077; KX889078); Type II architecture (IS26-∆ISEcp1-bla-∆ORF477) was found in isolates (EC45, KP37) (GenBank Accession Numbers: KX889079; KX889080); Type III architecture (ISEcp1∆-IS1294-∆ISEcp1-bla-∆ORF477) was found in isolate (EC30) (GenBank Accession Number: KX889070); Type IV architecture (ISEcp1∆-bla-∆IS903) was found in isolate (EC54) (GenBank Accession Numbers: KX898438 and KX898439)

Discussion

Since the CTX-M-55 firstly reported in 2006, it has been identified in E. coli, K. pneumoniae, S. flexneri and Salmonella enteritidis [3, 7, 10]. For all we know, bla in C. freundii and M. morganii is firstly detected in this study. In addition, 13/227 isolates were identified as bla-positive in just 7 months. This rate far surpasses other ESBLs [21-23], which demonstrates the rapid dissemination of bla. Notably, all bla-positive isolates were identified as multiple drug-resistant (MDR) bacteria that are strongly resistant to ceftazidime and cefotaxime (MIC > 256 μg/ml). More significantly, molecular characterization also revealed that most of the bla-positive isolates harbored bla. In addition, some isolates contained bla. These results imply that the spreading of bla over many different genera of Enterobacteriaceae is activated in hospitals in Henan Province, which represents a public health issue due to the inability to treat these bacteria.

Two E. coli isolates (EC32 and EC45) isolated from two different departments (Gastroenterology and ICU) shared the same ST type (ST305), which suggests that they are clonally related. However, the data indicate that the CTX-M-55-positive E. coli and K. pneumoniae strains identified in our study were not clonally related by MLST, which indicates that there is no specific ST in Henan Province. This finding contrasts with observations in the region of European and North American, where a high prevalence of ST131 has been observed [24]. Furthermore, this study demonstrates the association of eight STs [ST305, ST182, ST381, ST446 and ST2 (E. coli) and ST148, ST269 and ST37 (K. pneumoniae)] with the products of CTX-M-55 first time, which means bla has been actively spreading among Enterobacteriaceae in China. Given our focus on conjugative assays, the 13 transconjugants all exhibited resistance to cefotaxime and ceftazidime but sensitivity to fluoroquinolones, which was consistent with the original isolates. These results suggest that the plasmid-mediated blagene is to answer for an ESBL phenotype with poor susceptibility to cefotaxime and ceftazidime and exhibits a strong transferability of resistance. This finding also indicates that fluoroquinolones should be used for the therapy of bla-positive pathogen infections in clinical settings. Interestingly, our data indicate that some original isolates were resistant to cefepime, but the transconjugants were susceptible, which suggests that the original isolates may include other resistance genes that promote resistance to cefepime. We did not detect these genes in our study. These resistance genes cannot be transmitted through conjugative assays and are not located on the chromosome. Thus, this mechanism requires further study.

The sporadic existence of CTX-M-55-positive strains in mainland China has been occasionally detected. In some surveys, CTX-M-55 incidence has surpassed that of CTX-M-15 [25]. Heterogeneous genetic contexts may indicate the dissemination and mobilization of bla. As shown in Fig. 1, all isolates were detected ISEcp1, locating upstream of bla; this region contain the promoter sequence (− 35 and − 10) and act as a significant role in the expression and mobilization of the β-lactamase genes [12, 15, 26]. Moreover, the presence of ISEcp1 in this cross-species study indicates that the complete or partial insertion sequence was probably excised along with CTX-M-55 during horizontal transfer. Previous reports demonstrated that the disruption of the ISEcp1 element by IS26 was linked to the promotion of bla gene dissemination [27, 28]. Interestingly, as previously reported, ISEcp1 disruption by IS1294 in bla was detected from a chicken in China, which may contribute to the mobilization of blaCTX-M-55 [29]. Remarkably, the two E. coli strains [EC30 (this study) and E. coli C21 [29] ] shared the same MLST type (ST156), which suggests that these isolates are clonally related. This coincidence implies that bla is likely to be transferred from animals to the clinical setting. Fey et al. found that a 12-year-old boy acquired ceftriaxone-resistant Salmonella enterica serotype Typhimurium from cattle [30]. Jing Zhang et al. reported that CTX-M-55 had already been transmitted to humankind from animals and is distributed among both hospitals and community in China. The findings of our investigation and previous studies indicate that bla can be transmitted to humankind from food and can enhance clinical resistance. Notably, the novel arrangement ISEcp1∆-bla-∆IS903 is characterized by the element of IS903 which is detected downstream of bla first time and often identified by the context of other bla genes [31]. The mechanism responsible for its presence remains unclear. According to Poirel et al., ISEcp1, bla and IS903 form a putative transposon, and this block of genes could be disseminated by transposition [26, 32]. This finding implies that IS903 contributes to the dissemination of bla, which requires further study. Therefore, our findings strongly suggest that genetic elements (ISEcp1, ORF477, IS26, IS1294, and IS903) are involved in the inter-species and intra-species mobilization and dissemination of bla. Additionally, CTX-M-55-harboring isolates in animals may act as a potential storage of bacterial that is spread in clinical.

Conclusions

This investigation reminds a high occurrence rate of CTX-M-55-producing ESBLs in patients from different departments at the First Affiliated Hospital of Zhengzhou University in Henan Province. These plasmid-mediated bla-positive isolates are contributed to the transmission of bla to new species and new hosts by conjugation. Data obtained in this study suggest that the genetic context of bla, especially ISEcp1, act as a vital part in the mobilization, dissemination and expression of drug resistance determinants. We also demonstrated a novel arrangement of bla (ISEcp1∆-bla-∆IS903). Thus, the presence of MDR Enterobacteriaceae contains conjugative plasmids that co-harbor other IS elements, such as ISEcp1, should be surveilled worldwide because the active transfer and high prevalence of these pathogenic will significantly decrease our further selection of clinical therapies. Further studies on this issue should be performed to help us obtain a deeper understanding of the transmission and dissemination of plasmid-mediated blaCTX-M-55 in different genetic platforms.

Nucleotide sequence accession number

The nucleotide sequences presence in this study have been submitted to GenBank under the following accession numbers: KX889070 (E. coli: EC30); KX889071 (E. coli: EC32); KX889072 (E. coli: EC52); KX898438 and KX898439 (E. coli: EC54); KX889073 (E. coli: EC67); KX889074 (K. pneumoniae: KP26); KX889075 (K. pneumoniae: KP146); KX889076 (C. freundii: CF547); KX889077 (M. morganii: MM556); KX889078 (S. marcescens: SM554); KX889079 (E. coli: EC45); KX889080 (K. pneumoniae: KP37); KX889081 (E. coli: EC44).