Xinshan Cao1, Ling Xu2, Quanyuan Liu1, Lijuan Yang3, Na Li4, Xiaoxiao Li1. 1. Department of Radiology, Binzhou Medical University Hospital, Binzhou, Shandong, P.R. China. 2. Department of Liver Disease Center, Traditional Chinese Medicine Hospital of Binzhou City, Binzhou, Shandong, P.R. China. 3. Department of Experiment Center of Tumor, Binzhou Medical University Hospital, Binzhou, Shandong, P.R. China. 4. Department of Clinical Laboratory, Binzhou Medical University Hospital, Binzhou, Shandong, P.R. China.
Abstract
Our study aimed to investigate the roles and possible regulatory mechanism of miR-1277 in the development of hepatocellular carcinoma (HCC). HCC patients were identified from patients who were diagnosed with focal liver lesions using magnetic resonance imaging (MRI). The expression levels of miR-1277 in the serum of HCC patients and HepG2 cells were measured. Then miR-1277 mimic, miR-1277 inhibitor, or scramble RNA was transfected into HepG2 cells. The effects of miR-1277 overexpression and suppression on HepG2 cell proliferation, migration, and invasion were then investigated. Additionally, the expression levels of epithelial-mesenchymal transition (EMT)-related markers, including E-cadherin, β-catenin, and vimentin, were detected. Target prediction and luciferase reporter assay were performed to explore the potential target of miR-1277. miR-1277 was significantly downregulated in the serum of HCC patients and HepG2 cells. Suppression of miR-1277 promoted HepG2 cell proliferation, migration, and invasion, whereas overexpression of miR-1277 had opposite effects. In addition, after miR-1277 was suppressed, the expressions of E-cadherin and β-catenin were significantly increased, while the expressions of vimentin were markedly decreased. Bone morphogenetic protein 4 (BMP4) was identified as the direct target of miR-1277. Knockdown of BMP4 reversed the effects of miR-1277 suppression on HepG2 cell migration and invasion, as well as the expressions of E-cadherin, β-catenin, and vimentin. Our results indicate that downregulation of miR-1277 may promote the migration and invasion of HepG2 cells by targeting BMP4 to induce EMT. Combination of MRI and miR-1277 level will facilitate the diagnosis and treatment of HCC.
Our study aimed to investigate the roles and possible regulatory mechanism of miR-1277 in the development of hepatocellular carcinoma (HCC). HCC patients were identified from patients who were diagnosed with focal liver lesions using magnetic resonance imaging (MRI). The expression levels of miR-1277 in the serum of HCC patients and HepG2 cells were measured. Then miR-1277 mimic, miR-1277 inhibitor, or scramble RNA was transfected into HepG2 cells. The effects of miR-1277 overexpression and suppression on HepG2 cell proliferation, migration, and invasion were then investigated. Additionally, the expression levels of epithelial-mesenchymal transition (EMT)-related markers, including E-cadherin, β-catenin, and vimentin, were detected. Target prediction and luciferase reporter assay were performed to explore the potential target of miR-1277. miR-1277 was significantly downregulated in the serum of HCC patients and HepG2 cells. Suppression of miR-1277 promoted HepG2 cell proliferation, migration, and invasion, whereas overexpression of miR-1277 had opposite effects. In addition, after miR-1277 was suppressed, the expressions of E-cadherin and β-catenin were significantly increased, while the expressions of vimentin were markedly decreased. Bone morphogenetic protein 4 (BMP4) was identified as the direct target of miR-1277. Knockdown of BMP4 reversed the effects of miR-1277 suppression on HepG2 cell migration and invasion, as well as the expressions of E-cadherin, β-catenin, and vimentin. Our results indicate that downregulation of miR-1277 may promote the migration and invasion of HepG2 cells by targeting BMP4 to induce EMT. Combination of MRI and miR-1277 level will facilitate the diagnosis and treatment of HCC.
Hepatocellular carcinoma (HCC) is the leading cause of cancer-related mortality, accounting for 80% of all primary liver cancers1. Patients with HCC have a high rate of relapse after radical tumor resection2,3. Diagnosis of HCC depends on computed tomography (CT), magnetic resonance imaging (MRI), and biopsy4. MRI has been shown to have improved sensitivity and specificity compared to CT5. Despite these, most patients with HCC are always diagnosed at intermediate or advanced disease stages without curative approaches6. Therefore, an early diagnosis of HCC is of great importance for the possibility of curative treatment.Recently, new alternative approaches for HCC treatment have been changed to target the key molecular mechanisms. In addition to multiple genetic and epigenetic changes in protein-coding genes in HCC7, accumulating evidence has confirmed that microRNA (miRNA) deregulation contributes to the development of HCC via regulating cell growth, metastasis, and apoptosis8–11. Thus, identification of crucial miRNAs may provide a new perspective for the diagnosis and treatment of HCC. In recent years, miR-1277 was found to be dysregulated in renal cell carcinoma and thus may serve as a signature for the classification of kidney cancer subtypes12. Watahiki et al. demonstrated that dysregulation of miR-1277 was associated with metastatic behaviors in prostate cancer13. Importantly, a study has confirmed that miR-1277 is identified to be downregulated in the bone marrow of patients with HCC14; however, the relationship between miR-1277 dysregulation and HCC pathogenesis has not been investigated.In the present study, we first collected the serum of HCC patients, whose diagnosis had been confirmed by MRI, and subsequently analyzed whether miR-1277 was dysregulated. We then overexpressed and suppressed miR-1277 in HCC HepG2 cells and investigated the effects of miR-1277 dysregulation on HepG2 cell proliferation, migration, and invasion. The relationship between miR-1277 and bone morphogenetic protein 4 (BMP4) was also explored. The objective of our study was to explore the potential roles and possible regulatory mechanism of miR-1277 in HCC development to provide a new clinical perspective for early diagnosis and treatment of HCC.
MATERIALS AND METHODS
Patient Samples
This study was approved by the ethics committee of Binzhou Medical University Hospital (Shandong, P.R. China), and written informed consent was provided by all patients. During January 2013 and April 2016, a total of 102 patients, who were diagnosed with focal liver lesions in our hospital, were enrolled in the present study. None of the patients underwent chemotherapy or radiation therapy before hepatectomy. Focal liver lesions were further classified using MRI. MRI was performed on a 1.5-T system (Magnetom Avanto; Siemens Medical Solutions, Erlangen, Germany) with two spine clusters (three channels each) posterior and two six-channel body phased array coils anterior. Routine breath-hold T2-weighted turbo spin-echo (TSE), breath-hold T2-weighted half-Fourier acquisition single-shot turbo spin-echo (HASTE), and dynamic contrast-enhanced 3D gradient echo [volumetric interpolated breath-hold examination (VIBE)] sequences were performed in all patients. HCC was further confirmed by histopathological examination.On the day of enrollment into the clinical trial, blood samples were taken from each patient. Serum was collected by centrifugation at 1,500 × g for 10 min at 4°C. To completely remove any remaining cells, serum was further centrifuged at 2,000 × g for 10 min at 4°C. Last, the serum samples were portioned in aliquots and stored at −80°C until subsequent use.
Cell Culture
The human HCC cell line HepG2 and normal liver cell line L02 were obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were then cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (HyClone, Logan, UT, USA) containing heat-inactivated 10% fetal bovine serum (FBS; HyClone) and maintained in a 5% CO2 humidified incubator at 37°C.
Cell Transfection
The miR-1277 mimic, miR-1277 inhibitor, scramble RNA, siRNA-BMP4, and Silencer® Negative Control siRNA were purchased from Life Technologies™ (Burlington, ON, Canada). HepG2 cells were plated on 60-mm dishes. After 24 h of incubation, cells were treated with the above miRNAs or siRNAs and Lipofectamine® RNAiMAX Transfection Reagent (Life Technologies) in Opti-MEM® I Reduced Serum Medium (Life Technologies). At 24 h after the transfection, the cells were prepared for subsequent analysis.
Analysis of Cell Proliferation Using MTT and Colony Formation Assays
After transfection, HepG2 cells at a density of 3,000 cells/well were plated in 96-well plates. At 24, 48, 72, and 96 h after transfection of miR-1277 mimic, miR-1277 inhibitor, scramble RNA, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazo-liumbromide (MTT) reagent (AMRESCO, Solon, OH, USA) was added into each well, and the cells continued to be incubated for 4 h at 37°C. The supernatants were then removed, and dimethyl sulfoxide (DMSO; 150 μl/well; Sigma-Aldrich, St. Louis, MO, USA) was added to dissolve the formazan crystals. The absorbance of each sample at 490 nm was then measured using a multilabel plate reader (PerkinElmer, Waltham, MA, USA). In addition, at 72 h after transfection, the colony formation assay was also performed to assess cell proliferation. Cells at a density of 100 cells/dish were placed into 60-mm culture dishes and maintained in complete medium for 2 weeks. Colonies were then fixed with methanol and stained with 0.1% crystal violet (Sigma-Aldrich). Colonies that contained more than 30 cells were then counted under a microscope (IX83; Olympus, Tokyo, Japan). All determinations were conducted in triplicate.
Analysis of Cell Invasion and Migration Using Transwell Assays
Cell invasion and migration assays were assessed using a Transwell (Millipore, Billerica, MA, USA) assay. Before cell seeding, the upper compartment of Transwell chambers were coated with Matrigel (BD Biosciences, San Jose, CA, USA) for invasion assays, whereas the upper compartment was not coated with Matrigel for migration assays. After that, 5 × 104 HepG2 cells were seeded in the upper compartment of the Transwell chambers containing serum-free medium after 72 h of transfection. The lower compartment was filled with medium supplemented with 10% FBS as a chemoattractant. After 24 h of incubation at 37°C, the invasive and migratory cells on the bottom surface were then fixed, stained with crystal violet, and counted using light microscopy. The experiments were performed in triplicate.
Target Prediction and Dual-Luciferase Reporter Assay
In this study, TargetScan 6.2 (http://www.targetscan.org) was used to predict the target genes of miR-1277. After that, the luciferase reporter assay was performed to validate the predicted target genes of miR-1277. Briefly, HepG2 cells were cotransfected with 20 mM miR-1277 mimic or the negative control and 500 ng of psiCHECK-2-BMP4-3′-UTR-WT or psiCHECK-2-IGF-BMP4-3′-UTR-MUT. The psiCHECK-2 vector (Promega, Madison, WI, USA) was cotransfected as an internal control, which could provide the constitutive expression of Renilla luciferase. At 48 h after transfection, cells were collected and analyzed with the Dual-Luciferase Reporter Assay System (Promega). Finally, luciferase activity was measured using the GloMax fluorescence reader (Promega) and normalized to Renilla luciferase activity.
RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
Total RNA was extracted from HCC blood samples and HepG2 cells using RNAiso Plus reagent (Takara Bio Inc., Dalian, P.R. China). The concentration and purity of isolated RNA were then measured using an ultraviolet spectrophotometer (SMA 400 UV-VIS; Merinton, Shanghai, P.R. China). Reverse transcription for cDNA synthesis was then performed using PrimeScript RT Reagent Kit (Takara) in accordance with the manufacturer’s protocol. Then the qRT-PCR was performed in the ABI PRISM 7300 Fast Real-Time PCR System (Ambion, Foster City, CA, USA) to detect the expression of targets using the SYBR ExScript RT-qPCR Kit (Takara). The reaction for target amplification was performed under conditions of 95°C for 10 s, 95°C for 30 s, and 40 cycles at 60°C for 30 s. Moreover, melting curve analysis was performed at the end of each PCR to confirm that only one product was amplified. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control, and the relative expression of targets was calculated with the 2−ΔΔCt method. Primers were designed by Primer 5.0 (Primer-E, Ltd., Plymouth, UK) and are shown in Table 1.
Table 1
Primers Used for Target Amplification
Gene
Forward Primer (5′-3′)
Reverse Primer (5′-3′)
miR-1277
UACGUAGAUAUAUAUGUAUUUU
UUUUTUCUTUTUTUTCTUCGTU
BMP4
ATGTGGGCTGGAATGACTGG
GCACAATGGCATGGTTGGTT
E-cadherin
AACGCATTGCCACATACAC
AACGCATTGCCACATACAC
β-catenin
AAGGTAGAGTGATGAAAGTTGTT
CACCATGTCCTCTGTCTATTC
Vimentin
TCCAAGTTGCTGACCTCTC
TCAACGGCAAAGTTCTCTTC
GAPDH
GAACCCGTGAGGTGGAAGAA
TGGGTAAAGGCGGGGGAAAAG
Primers Used for Target Amplification
Western Blot Analysis
Whole-cell lysates were obtained using radioimmunoprecipitation assay (RIPA) (Sangon Biotech, Shanghai, P.R. China). Equal quantities of lysates from each sample were separated in a 12% SDS-PAGE gel and then electrically transferred to nitrocellulose membranes (Sigma-Aldrich). After the membrane was blocked with PBST (0.1% triton in 1% PBS) for 2 h, the membranes were hybridized with primary monoclonal antibodies against BMP4, E-cadherin, β-catenin, vimentin, and GAPDH (1:1,000 dilution; Santa Cruz Co, Santa Cruz, CA, USA) at 4°C overnight. GADPH was used as the loading control. The membranes were then washed twice followed by incubation with secondary alkaline phosphatase conjugate antibody (1:2,000 dilution; Sigma-Aldrich) for 2 h at room temperature. Last, the membranes were visualized with SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL, USA) by exposure to the film.
Statistical Analysis
A test of normal distribution was done using one-sample K-S test. Differences in continuous data between groups were assessed using Student’s t-test, whereas clinicopathological variables were analyzed by two-sided Fisher’s exact test. All statistical analyses were performed using SPSS 18.0 (SPSS, Chicago, IL, USA). A value of p < 0.05 was considered statistically significant.
RESULTS
Expression of miR-1277 in Clinical HCC Serum Samples and HCC HepG2 Cells
A total of 102 patients with focal liver lesions were collected for MRI. The results showed that there were 42 cases of HCC, 31 cases of liver metastases, 19 cases of liver hemangioma, and 10 cases of liver cysts. In addition, the expression of miR-1277 in the serum of patients with HCC or liver metastasis was significantly lower than that in the serum of patients with liver hemangioma or cysts (p < 0.05) (Fig. 1A). However, there was no significant difference in the miR-1277 expression between HCC samples or liver metastasis samples (p > 0.05) (Fig. 1A). We also found that miR-1277 expression in HCC HepG2 cells were also markedly lower than that in normal liver L02 cells, and significant difference existed between them (p < 0.05) (Fig. 1B).
Figure 1
The expression of microRNA-1277 (miR-1277) in the serum of hepatocellular carcinoma (HCC) patients (A) and HCC HepG2 cells (B). Error bars indicate means ± SD. **p < 0.01.
The expression of microRNA-1277 (miR-1277) in the serum of hepatocellular carcinoma (HCC) patients (A) and HCC HepG2 cells (B). Error bars indicate means ± SD. **p < 0.01.
Effects of Aberrant miR-1277 Expression on Cell Proliferation
To investigate the effects of aberrant miR-1277, HepG2 cells were transfected with miR-1277 mimic, inhibitor, or scramble into cells. As shown in Figure 2A, compared with the scramble group, miR-1277 expression was significantly increased in the miR-1277 mimic, while obviously decreased in the miR-1277 inhibitor group (p < 0.05), indicating that miR-1277 was successfully overexpressed and suppressed in HepG2 cells.
Figure 2
The effects of miR-1277 on HepG2 cell proliferation. (A) The expression of miR-1277 in different transfection groups. (B) The MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazo-liumbromide] assay showed the HepG2 cell viability of different transfection groups. (C, D) The colony assay showed the number of colony of different transfection groups. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 compared with the scramble group.
The effects of miR-1277 on HepG2 cell proliferation. (A) The expression of miR-1277 in different transfection groups. (B) The MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazo-liumbromide] assay showed the HepG2 cell viability of different transfection groups. (C, D) The colony assay showed the number of colony of different transfection groups. Error bars indicate means ± SD. *p < 0.05 and **p < 0.01 compared with the scramble group.In addition, the results of the MTT assay showed that, in comparison with the scramble group, the cell viability was significantly inhibited at 72 and 96 h after transfection with miR-1277 mimic, while being obviously increased after transfection with miR-1277 inhibitor (p < 0.05) (Fig. 2B). Also, colony formation assay showed similar results in that the number of colonies was markedly decreased in the miR-1277 mimic group and significantly increased in the miR-1277 inhibitor group (p < 0.05) (Fig. 2C and D).
Effects of Aberrant miR-1277 Expression on Migration and Invasion
Figure 3 illustrates the effects of aberrant miR-1277 expression on cell migration and invasion. In comparison with the control group, the number of migrated cells in the miR-1277 mimic group was significantly decreased while being markedly increased in the miR-1277 inhibitor group (p < 0.05) (Fig. 3A and B). Furthermore, the expected results were obtained in that the number of invaded cells in the miR-1277 mimic group was also significantly decreased while being markedly increased in the miR-1277 inhibitor group (p < 0.05) (Fig. 3C and D). We measured the expression of epithelial–mesenchymal transition (EMT) markers, including E-cadherin, β-catenin, and vimentin. The results showed that the expression of E-cadherin and β-catenin in the miR-1277 mimic group was significantly increased compared with the scramble group, while the expression of vimentin was markedly decreased (p < 0.05) (Fig. 3E). Opposite expression changes of these EMT-related markers were observed in the miR-1277 inhibitor group (p < 0.05) (Fig. 3E and F).
Figure 3
The effects of miR-1277 on HepG2 cell migration and invasion. (A, B) The Transwell assay showed the number of migrated cells in the different transfection groups. (C, D) The Transwell assay showed the number of invaded cells in different transfection groups. (E) The expression levels of E-cadherin, β-catenin, and vimentin in the different groups determined by quantitative real-time PCR (qRT-PCR). (F) The expression levels of E-cadherin, β-catenin, and vimentin in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the scramble group.
The effects of miR-1277 on HepG2 cell migration and invasion. (A, B) The Transwell assay showed the number of migrated cells in the different transfection groups. (C, D) The Transwell assay showed the number of invaded cells in different transfection groups. (E) The expression levels of E-cadherin, β-catenin, and vimentin in the different groups determined by quantitative real-time PCR (qRT-PCR). (F) The expression levels of E-cadherin, β-catenin, and vimentin in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the scramble group.
BMP4 Was the Direct Target of miR-1277
According to the sequence information of TargetScan 6.2, BMP4 was predicted as a potential target of miR-1277 (Fig. 4A). To further verify the predicted results, luciferase report assay was performed. Expected results were obtained in that cotransfection of miR-1277 mimic significantly inhibited the luciferase reporter activity of the BMP4 3′-UTR-WT, but not the BMP4 3′-UTR-MUT (p < 0.05) (Fig. 4B), indicating that BMP4 was a direct target of miR-1277. In addition, the expression of BMP4 in different transfected cells was determined. In comparison with the scramble group, both the mRNA and protein expression levels of BMP4 in the miR-1277 mimic group were significantly downregulated while being markedly upregulated in the miR-1277 inhibitor group (p < 0.05) (Fig. 4C and D), suggesting that BMP4 was negatively regulated by miR-1277.
Figure 4
Bone morphogenetic protein 4 (BMP4) was a direct target of miR-1277. (A) BMP4 was predicted as a target of miR-1277 using TargetScan 6.2 (retrieved from http://www.targetscan.org/vert_61/). (B) Luciferase report assay showed that miR-1277 directly targeted the BMP4 3′-UTR-WT. (C) The expression of BMP4 in different transfection groups determined by qRT-PCR. (D) The expression of BMP4 in different transfection groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05.
Bone morphogenetic protein 4 (BMP4) was a direct target of miR-1277. (A) BMP4 was predicted as a target of miR-1277 using TargetScan 6.2 (retrieved from http://www.targetscan.org/vert_61/). (B) Luciferase report assay showed that miR-1277 directly targeted the BMP4 3′-UTR-WT. (C) The expression of BMP4 in different transfection groups determined by qRT-PCR. (D) The expression of BMP4 in different transfection groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05.
Effects of BMP4 Suppression on Cell Migration and Invasion
To further investigate whether miR-1277 regulated cell migration and invasion in HCC via targeting BMP4, we used si-BMP4 to knock down the expression of BMP4. As displayed in Figure 5A and B, after si-BMP4 treatment, both the mRNA and protein expression levels of BMP4 were significantly decreased compared with the control group (p < 0.05). In addition, cells were cotransfected with si-BMP4 and miR-1277 inhibitor simultaneously to detect the regulatory relationship between BMP4 and miR-1277. The results showed that the promoted effects of miR-1277 inhibitor on cell migration and invasion were counteracted after cells were transfected with si-BMP4 and miR-1277 inhibitor simultaneously (p < 0.05) (Fig. 5C–F). Moreover, the miR-1277 inhibitor-caused decreased expressions of E-cadherin and β-catenin, as well as the enhanced expression of vimentin, were also reversed by si-BMP4 (p < 0.05) (Fig. 5G and H). These results suggested that miR-1277 targeted BMP4 to control EMT, so as to regulate cancer cell migration and invasion.
Figure 5
The effects of BMP4 on HepG2 cell migration and invasion. (A) RT-qPCR showed the mRNA expression of BMP4 in HepG2 cells after si-BMP4 treatment. (B) Western blot showed the protein expression of BMP4 in HepG2 cells after si-BMP4 treatment. (C, D) Transwell assay showed the number of migrated HepG2 cells in different groups. (E, F) Transwell assay showed the number of invaded HepG2 cells in different transfection groups. (G) The mRNA expression levels of E-cadherin, β-catenin, and vimentin in different groups determined by RT-qPCR. (H) The protein expression levels of E-cadherin, β-catenin, and vimentin in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 compared with the control group and #p < 0.05 compared with the inhibitor group.
The effects of BMP4 on HepG2 cell migration and invasion. (A) RT-qPCR showed the mRNA expression of BMP4 in HepG2 cells after si-BMP4 treatment. (B) Western blot showed the protein expression of BMP4 in HepG2 cells after si-BMP4 treatment. (C, D) Transwell assay showed the number of migrated HepG2 cells in different groups. (E, F) Transwell assay showed the number of invaded HepG2 cells in different transfection groups. (G) The mRNA expression levels of E-cadherin, β-catenin, and vimentin in different groups determined by RT-qPCR. (H) The protein expression levels of E-cadherin, β-catenin, and vimentin in different groups determined by Western blot. Error bars indicate means ± SD. *p < 0.05 compared with the control group and #p < 0.05 compared with the inhibitor group.
DISCUSSION
Early diagnosis is imperative because several curative treatments are available for small HCC15. MRI is shown to have the advantage in the diagnosis of HCC due to the improved sensitivity and specificity16. In the present study, HCC patients were identified using MRI from patients who were diagnosed with focal liver lesions. Then the expression levels of miR-1277 in the serum of HCC patients were measured. We found that miR-1277 was significantly downregulated in the serum of HCC patients and HepG2 cells. Suppression of miR-1277 promoted the proliferation, migration, and invasion of HepG2 cells, whereas overexpression of miR-1277 had opposite effects. In addition, after miR-1277 was suppressed, the expression of E-cadherin and β-catenin was significantly increased, while the expression of vimentin was markedly decreased. BMP4 was identified as the direct target of miR-1277. Knockdown of BMP4 reversed the effects of miR-1277 suppression on HepG2 cell migration and invasion, as well as the expression of E-cadherin, β-catenin, and vimentin. All these findings imply the crucial role of miR-1277 in HCC development and merit further discussion.One of the important findings of our study was that miR-1277 was significantly downregulated in the serum of HCC patients and HepG2 cells, which was consistent with a previous study where miR-1277 was downregulated in the bone marrow of patients with HCC14. However, the impact of miR-1277 on cancer cell proliferation, migration, and invasion has never been addressed, let alone its regulatory mechanism. In this study, we found that after miR-1277 was suppressed, the expressions of E-cadherin and β-catenin were significantly increased, while the expression of vimentin was markedly decreased. In a previous study, Armc8 was shown to regulate the invasive ability of HCC via disruption of the E-cadherin/catenin complex17. Bufalin can inhibit the invasion and metastasis of HCC cells via strengthening the intercellular E-cadherin/β-catenin complex to control EMT18. miR-148b was shown to inhibit cell proliferation and invasion in HCC via targeting the WNT1/β-catenin pathway19. In addition, overexpression of vimentin was confirmed to contribute to the metastasis of HCC20. Long noncoding RNA AOC4P was found to suppress the metastasis of HCC through enhancing vimentin degradation and inhibiting EMT21. Based on the results of our study, we therefore speculate that downregulation of miR-1277 is correlated to the pathogenesis of HCC through involving the EMT signal pathway.Furthermore, another important finding of our study was that BMP4 was identified as the direct target of miR-1277. Knockdown of miR-1277 may promote cell migration and invasion via inducing EMT. BMP4 reversed the effects of miR-1277 suppression on cell migration and invasion. BMP4 is a member of the transforming growth factor-β (TGF-β) superfamily, and recent studies have revealed that BMP4 dysregulation contributes to the cell migration and invasion in different types of cancers, such as colonic adenocarcinomas22, breast cancer23, and head and neck cancer24. In addition, BMP4 has been implicated in the pathogenesis of HCC25. Chiu et al. found that BMP4 was overexpressed in HCC and could promote HCC cell proliferation and migration via activation of the MEK/ERK signaling pathway26. Maegdefrau et al. also demonstrated that BMP4 was upregulated in HCC samples, and suppression of BMP4 could result in a strong reduction of migratory and invasive potential in HCC27,28. Li et al. also showed that BMP4 could promote the migration and invasion of HCC via regulating the expression of EMT-related proteins, including E-cadherin and vimentin29. Furthermore, upregulation of BMP4 was confirmed as an important marker for predicting the poor prognosis in patients with HCC30. Taken together, it can therefore be speculated that downregulation of miR-1277 may promote cell migration and invasion via targeting BMP4 to control EMT. However, we did not detect the expression of BMP4 in the serum of patients with HCC, which was a limitation of our study. Further studies are still needed to verify our findings.In conclusion, our findings indicate that downregulation of miR-1277 may promote the migration and invasion of HepG2 cells by targeting BMP4 to induce EMT. Combination of MRI and miR-1277 level will facilitate the diagnosis and treatment of HCC.
Authors: Youssef M Youssef; Nicole M A White; Jörg Grigull; Adriana Krizova; Christina Samy; Salvador Mejia-Guerrero; Andrew Evans; George M Yousef Journal: Eur Urol Date: 2011-01-13 Impact factor: 20.096