Literature DB >> 29558992

Anaplasma phagocytophilum, Bartonella spp., haemoplasma species and Hepatozoon spp. in ticks infesting cats: a large-scale survey.

Florent Duplan1, Saran Davies2, Serina Filler3, Swaid Abdullah2, Sophie Keyte1, Hannah Newbury4, Chris R Helps5, Richard Wall2, Séverine Tasker6,7.   

Abstract

BACKGROUND: Ticks derived from cats have rarely been evaluated for the presence of pathogens. The aim of this study was to determine the prevalence of Anaplasma phagocytophilum, Bartonella spp., haemoplasma species and Hepatozoon spp. in ticks collected from cats in the UK.
METHODS: Five hundred and forty DNA samples extracted from 540 ticks collected from cats presenting to veterinarians in UK practices were used. Samples underwent a conventional generic PCR assay for detection of Hepatozoon spp. and real-time quantitative PCR assays for detection of Anaplasma phagocytophilum and three feline haemoplasma species and a generic qPCR for detection of Bartonella spp. Feline 28S rDNA served as an endogenous internal PCR control and was assessed within the haemoplasma qPCR assays. Samples positive on the conventional and quantitative generic PCRs were submitted for DNA sequencing for species identification.
RESULTS: Feline 28S rDNA was amplified from 475 of the 540 (88.0%) ticks. No evidence of PCR inhibition was found using an internal amplification control. Of 540 ticks, 19 (3.5%) contained DNA from one of the tick-borne pathogens evaluated. Pathogens detected were: A. phagocytophilum (n = 5; 0.9%), Bartonella spp. (n = 7; 1.3%) [including Bartonella henselae (n = 3; 0.6%) and Bartonella clarridgeiae (n = 1; 0.2%)], haemoplasma species (n = 5; 0.9%), "Candidatus Mycoplasma haemominutum" (n = 3; 0.6%), Mycoplasma haemofelis (n = 1; 0.2%), "Candidatus Mycoplasma turicensis" (n = 1; 0.2%), Hepatozoon spp. (n = 2; 0.4%), Hepatozoon felis (n = 1; 0.2%) and Hepatozoon silvestris (n = 1; 0.2%).
CONCLUSION: These data provide important information on the prevalence of tick-borne pathogens in ticks infesting cats, with the identification of haemoplasma species, A. phagocytophilum, H. felis and Bartonella spp. (including B. henselae and B. clarridgeiae). This study also documents the first report of H. silvestris in ticks collected from domestic cats.

Entities:  

Keywords:  Anaplasma phagocytophilum; Bartonella clarridgeiae; Bartonella henselae; Feline; Haemoplasma; Hepatozoon felis; Hepatozoon silvestris; Mycoplasma haemofelis; Tick-borne pathogens; “Candidatus Mycoplasma haemominutum”; “Candidatus Mycoplasma turicensis”

Mesh:

Year:  2018        PMID: 29558992      PMCID: PMC5861659          DOI: 10.1186/s13071-018-2789-5

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Ticks are important arthropod vectors that transmit a wide range of viral, bacterial and protozoan pathogens [1]. Tick-borne pathogens are transmitted to the host mostly by tick bites, although tick ingestion is also a possible route of transmission [1]. Their prolonged periods of feeding and large blood meals allow important numbers of pathogens to be transmitted and this, together with their high rates of reproduction and possible pathogen transmission between tick life-cycle stages (trans-stadial) and generations (trans-ovarial) [2], make ticks efficient vectors. A recent study revealed that the most common tick species found on cats in the UK were (in decreasing order of prevalence) Ixodes ricinus, Ixodes hexagonus and Ixodes trianguliceps, with an overall prevalence of tick attachment on cats of 6.6% [3]. A similar study of ticks found on dogs in the UK revealed the presence of I. ricinus and I. hexagonus, but Ixodes canisuga, Haemaphysalis punctata and Dermacentor reticulatus were also reported, together with a much higher prevalence (30%) of tick infestation on dogs [4]. In line with the lower prevalence of tick infestation in cats compared to dogs, it is also thought that transmission of tick-borne pathogens is likely to be less common in cats than in dogs, although there is a lack of publications in this field [5]. Possible explanations for the species discrepancies are: differences in lifestyle, behaviour (e.g. increased self-grooming in cats compared to dogs) and in immunity to tick-borne infections [5]. Nevertheless, tick-borne pathogens are reported in cats and can be problematic; the pathogen species reported include Babesia spp., Hepatozoon spp., Borrelia spp., Ehrlichia spp., Anaplasma spp., haemoplasma species and Bartonella spp. [6]. The aim of this study was to determine the prevalence of selected tick-borne pathogens in ticks collected from cats in a large-scale national surveillance study. The tick-DNA samples analysed in the present study had previously been assessed for the presence of Borrelia spp. and Babesia spp. DNA [3]. The pathogens evaluated were A. phagocytophilum, Bartonella spp., Hepatozoon spp. and three haemoplasma species.

Methods

Tick samples

DNA samples obtained from 540 (308 I. ricinus, 224 I. hexagonus and 8 I. trianguliceps) ticks that were collected from 540 cats between May and October 2016 by veterinary surgeons throughout the UK as part of a national surveillance study, details of which have been published previously [3], were used in the current study. As previously described [3], these ticks had been collected by veterinarians from 278 veterinary practices and most ticks (440) were adults and most (535) were female; 122 were fully fed, 372 partially fed and 46 unfed. An internal amplification control (IAC) had been spiked into the tick samples before DNA extraction to monitor for successful extraction and the absence of PCR inhibitors by subsequent quantitative (q) PCR analysis of the IAC, as previously described [3].

Anaplasma phagocytophilum real-time qPCR

Anaplasma phagocytophilum DNA was detected using a qPCR for the msp2 gene [7] modified as follows: each qPCR consisted of GoTaq Hot Start Mastermix (Promega, Southampton, UK), MgCl2 to a final concentration of 4.5 mM, forward and reverse primers and TaqMan probe (Table 1) at a final concentration of 100 nM each, 2 μl of template DNA, and water to a final volume of 10 μl. Thermal cycling conditions comprised 95 °C for 2 min and 45 cycles of 95 °C for 15 s, and 60 °C for 30 s (Agilent MX3005P qPCR, Agilent, Stockport, UK). Fluorescence data were collected at 516 nm at the end of each annealing/extension step. A positive control sample (of known copy number) and negative control (water) were included on each plate.
Table 1

Details of the qPCR/PCR assays used in the study for the detection of tick-borne pathogens

Target species (target gene)PCR primer and probe sequences (5'–3')Product size (bp)Reference
Anaplasma phagocytophilum (msp2)F: ATGGAAGGTAGTGTTGGTTATGGTATT77[7]
R: TTGGTCTTGAAGCGCTCGTA
FAM-TGGTGCCAGGGTTGAGCTTGAGATTG-BHQ1
Bartonella henselae (alr-gcvP intergenic spacer)F: GAGGGAAATGACTCTCTCAGTAAAA110[9]a
R: TGAACAGGATGTGGAAGAAGG
FAM-CAGCCAAATATACGGGCTATCCATCAA-BHQ1
Bartonella spp. (ssrA)F: GCTATGGTAATAAATGGACAATGAAATAA299[8]b
R: GGCTTCTGTTGCCAGGTG
FAM-ACCCCGCTTAAACCTGCGACG-BHQ1
Candidatus Mycoplasma haemominutum” (16S rRNA gene)F: TGATCTATTGTKAAAGGCACTTGCT135[10]
R: TTAGCCTCYGGTGTTCCTCAA
FAM-TTCAATGTGTAGCGGTGGAATGCGT-BHQ1
Candidatus Mycoplasma turicensis” (16S rRNA gene)F: AGAGGCGAAGGCGAAAACT138[10]
R: ACGTAAGCTACAACGCCGAAA
FAM-CGTAAACGATGGGTATTAGATGTCGGGAT-BHQ1
Feline genomic DNA (28S rRNA)F: AGCAGGAGGTGTTGGAAGAG100[10]
R: AGGGAGAGCCTAAATCAAAGG
Texas Red-TGG CTT GTG GCA GCC AAG TGT-BHQ2
Hepatozoon. spp. (18S rRNA gene)F: AAACGGCTACCACATNTAAGGA522[11]
R: AATACAAATGCCCCCAACTNT
Mycoplasma haemofelis (16S rRNA gene)F: GTGCTACAATGGCGAACACA80[10]
R: TCCTATCCGAACTGAGACGAA
FAM-TGTGTTGCAAACCAGCGATGGT-BHQ1

aThe reverse and probe sequences in the original paper are incorrectly labelled; the correct sequences are cited in this table

bThe reverse primer has been modified compared to the one described in the paper

Abbreviations: F, forward primer sequence; R, reverse primer sequence; FAM, 6-carboxyfluorescein; BHQ, black hole quencher (1 or 2 as indicated)

Details of the qPCR/PCR assays used in the study for the detection of tick-borne pathogens aThe reverse and probe sequences in the original paper are incorrectly labelled; the correct sequences are cited in this table bThe reverse primer has been modified compared to the one described in the paper Abbreviations: F, forward primer sequence; R, reverse primer sequence; FAM, 6-carboxyfluorescein; BHQ, black hole quencher (1 or 2 as indicated)

Bartonella spp. qPCRs and sequencing

Bartonella spp. were detected using a qPCR targeting a fragment of the ssrA gene [8] modified as follows: each qPCR reaction consisted of GoTaq Hot Start Mastermix, MgCl2 to a final concentration of 4.5 mM, forward and reverse primers at a final concentration of 500 nM each and TaqMan probe at a final concentration of 100 nM (Table 1), 2 μl of template DNA and water to a final volume of 10 μl. The thermal cycling protocol consisted of an initial denaturation at 95 °C for 2 min and 40 cycles of 95 °C for 15 s and 60 °C for 30 s (Agilent MX3005P qPCR, Agilent, Stockport, UK). Fluorescence data were collected at 516 nm at the end of each annealing/extension step. A positive control sample (of known copy number) and negative control (water) were included on each plate. All samples positive on the Bartonella spp. qPCR were then screened using a B. henselae specific qPCR targeting the alr-gcvP intergenic spacer [9] modified as follows: each qPCR reaction consisted of GoTaq Hot Start Mastermix, MgCl2 to a final concentration of 4.5 mM, forward and reverse primers and TaqMan probe (Table 1) at a final concentration of 100 nM each, 2 μl of template DNA and water to a final volume of 10 μl. The thermal cycling conditions and controls used were identical to those described above for the Bartonella spp. qPCR. All samples positive for Bartonella spp. but negative for B. henselae underwent repeat amplification using the Bartonella spp. qPCR assay (as above) in a final volume of 25 μl. The PCR amplicons were prepared for DNA sequencing using a Nucleospin® 96 PCR Clean-up Core Kit (Macherey-Nagel, Düren, Germany) and submitted to a commercial sequencing laboratory (DNA Sequencing & Services, MRC I PPU, School of Life Sciences, University of Dundee, UK) using Applied Biosystems Big-Dye Ver 3.1 chemistry on an Applied Biosystems model 3730 automated capillary DNA sequencer.

Haemoplasma species qPCRs

Feline haemoplasma DNA was detected using individual species-specific qPCRs targeting the 16S rRNA gene each of M. haemofelis, “Ca. M. haemominutum” and “Ca. M. turicensis”, as previously described [10]. Each haemoplasma species qPCR was also duplexed with a qPCR for the detection of feline 28S rDNA as an internal control for feline blood (Table 1), again as previously described [10]. The qPCR assay for each species consisted of GoTaq Hot Start Mastermix, MgCl2 to a final concentration of 4.5 mM, forward and reverse primers (for each species as shown in Table 1) at a final concentration of 200 nM each, TaqMan probe (for each species as shown in Table 1) at 50 nM, 2 μl of template DNA and water to a final volume of 10 μl. A positive control sample (of known copy number) and negative control (water) were included on each plate. The thermal cycling conditions were identical to those described above for the Bartonella spp. qPCR.

Hepatozoon spp. PCR and sequencing

Hepatozoon spp. DNA was detected using a conventional PCR targeting the 18S rRNA gene as previously described [11]. Each PCR consisted of GoTaq Hot Start Mastermix, forward and reverse primers (Table 1) at a final concentration of 200 nM each, 2 μl of template DNA and water to a final volume of 10 μl. A positive control sample and negative control (water) were included on each plate. The thermal cycling protocol consisted of an initial denaturation at 95 °C for 2 min, then 40 cycles of 95 °C for 15 s and 60 °C for 45 s (BioRad DNA Engine PTC-200, BioRad, Watford, UK). Agarose gel electrophoresis was used to visualize target amplicons. Positive samples were identified as a defined band of approximately 522 bp on the gel. Samples positive for Hepatozoon spp. underwent repeat amplification using the Hepatozoon spp. assay (as above) in a final volume of 25 μl, amplicons were purified and submitted for DNA sequencing, as described above.

Data handling

Data was entered into Microsoft Excel (version 15.32) and descriptive statistics obtained. Coordinates were generated by converting owner postcodes. The WGS84 (World Geodetic System) was used to map the location of each sample in QGIS (version 2.18.2). Sequence data were edited and analysed in BioEdit Sequence Alignment Editor (version 7.2.5). Output sequences were BLAST searched against the NCBI GenBank sequence database to determine the species present (www.ncbi.nlm.nih.gov/BLAST/).

Results

Analysis of the controls

The IAC was successfully amplified in all samples following qPCR as previously described [3]. Feline 28S rDNA was amplified from 475 of the 540 (88%) tick samples. Details of the feline 28S rDNA results according to tick feeding status (i.e. fully fed, partially fed and unfed) are shown in Table 2.
Table 2

Feline 28S rDNA PCR results according to tick feeding status

Tick feeding statusPositive PCR result (%)Negative PCR result (%)Total
Fully fed102 (83.6)20 (16.4)122
Partially fed340 (91.4)32 (8.6)372
Unfed33 (71.7)13 (28.3)46
Feline 28S rDNA PCR results according to tick feeding status

Prevalence and geographical location of the different pathogens

Of the 540 DNA samples from ticks, 19 (3.5%) were positive by PCR/qPCR for DNA of one of the pathogens described; no tick was positive for DNA from more than one pathogen. The pathogens detected were widely distributed throughout the UK (Fig. 1).
Fig 1

Location of all ticks positive by PCR for any of the selected tick-borne pathogens

Location of all ticks positive by PCR for any of the selected tick-borne pathogens

Anaplasma phagocytophilum

Five of the 540 ticks (0.9%) were positive by qPCR for A. phagocytophilum DNA. Ticks positive for A. phagocytophilum DNA were widely spread throughout the UK (Fig. 2). The positive ticks comprised four I. ricinus and one I. hexagonus (Table 3).
Fig 2

Location of ticks positive by qPCR for A. phagocytophilum DNA.

Table 3

Prevalence, tick species identified, method of detection, sequence identity and sequence identity information

PathogenPrevalence (%) (n = 540)Tick species (n)Method of detectionSequence identity (%)GenBank ID
A. phagocytophilum 5 (0.9)I. hexagonus (1)qPCRnana
I. ricinus (4)
Bartonella spp. B. henselae 3 (0.6)I. hexagonus (2)qPCRnana
I. ricinus (1)
B. clarridgeiae 1 (0.2)I. hexagonus (1)qPCR96 (based on 225 bp)HG519012.1
Other species3 (0.6)I. hexagonus (3)nana
Haemoplasma speciesCa. M. haemominutum”3 (0.6)I. trianguliceps (1)qPCRnana
I. ricinus (2)
M. haemofelis 1 (0.2)I. trianguliceps (1)
Ca. M. turicensis”1 (0.2)I. ricinus (1)
Hepatozoon spp. H. felis 1 (0.2)I. hexagonus (1)PCR90 (based on 315 bp)KY215817.1
H. silvestris 1 (0.2)I. ricinus (1)100 (based on 452 bp)KX757032.1

Abbreviations: na, not applicable; PCR, conventional polymerase chain reaction; qPCR, quantitative polymerase chain reaction

Location of ticks positive by qPCR for A. phagocytophilum DNA. Prevalence, tick species identified, method of detection, sequence identity and sequence identity information Abbreviations: na, not applicable; PCR, conventional polymerase chain reaction; qPCR, quantitative polymerase chain reaction

Bartonella spp.

Seven of the 540 ticks (1.3%) were positive by qPCR for Bartonella spp. DNA (Table 1). Ticks positive for Bartonella spp. DNA were widely spread throughout the UK (Fig. 3). Three (0.6% of the total population of 540 ticks) of the seven ticks, two I. hexagonus and one I. ricinus, were positive by qPCR for B. henselae DNA (Table 3). One of remaining four ticks (0.2% of total population), an I. hexagonus, was found to be positive for B. clarridgeiae DNA following sequencing, with 96% sequence identity to a previously published sequence in GenBank (B. clarridgeiae, HG519012) (Table 3). Sequencing failed for the other three tick samples positive on the Bartonella spp. qPCR but negative for the B. henselae qPCR, despite the repeat Bartonella spp. qPCR still yielding a positive result, and thus no species identification could be made in these three samples.
Fig 3

Location of ticks positive by qPCR for Bartonella species DNA. Key: Green diamond, B. henselae; yellow diamond, B. clarridgeiae; brown diamond, Bartonella spp. (unable to identify to the species level)

Location of ticks positive by qPCR for Bartonella species DNA. Key: Green diamond, B. henselae; yellow diamond, B. clarridgeiae; brown diamond, Bartonella spp. (unable to identify to the species level)

Haemoplasma species

Five of the 540 ticks (0.9%) were positive by qPCR for haemoplasma DNA (Table 1). Ticks positive for haemoplasma DNA were widely spread throughout the UK (Fig. 4). Three ticks (0.6%, 3/540), two I. ricinus and one I. trianguliceps, were positive by qPCR for “Ca. M. haemominutum” (Table 3). One I. trianguliceps (0.2%) was positive by qPCR for M. haemofelis (Table 3). One I. ricinus (0.2%) was positive by qPCR for “Ca. M. turicensis” (Table 3). Interestingly, of the I. trianguliceps ticks in this study, 25% (2/8) were positive by qPCR for haemoplasma DNA.
Fig 4

Location of ticks positive by qPCR for feline haemoplasmas. Key: Red pentagon, “Ca. M. haemominutum”; turquoise pentagon: M. haemofelis, purple pentagon: “Ca. M. turicensis”

Location of ticks positive by qPCR for feline haemoplasmas. Key: Red pentagon, “Ca. M. haemominutum”; turquoise pentagon: M. haemofelis, purple pentagon: “Ca. M. turicensis

Hepatozoon spp.

Two of the 540 ticks (0.4%) were positive by conventional PCR for Hepatozoon spp. DNA. The Hepatozoon spp. positive ticks were collected in Wales and the south-east of England (Fig. 5). DNA sequencing and BLAST analysis identified one I. hexagonus (0.2%) positive for H. felis and one I. ricinus (0.2%) positive for H. silvestris (Table 3). DNA sequencing revealed 90 and 100% identity, to sequences available in GenBank (accession numbers KY215817 and KX757032, respectively).
Fig 5

Location of ticks positive by cPCR for Hepatozoon species DNA. Key Green square, H. felis; pink square, H. silvestris

Location of ticks positive by cPCR for Hepatozoon species DNA. Key Green square, H. felis; pink square, H. silvestris

Discussion

Relatively few studies have been performed describing the prevalence of tick-borne pathogens in ticks collected directly from cats compared to dogs. Here, the DNA samples from ticks collected from cats in the UK were analysed. As previously described, these ticks were mainly found in England and were screened for Babesia spp. and Borrelia burgdorferi (sensu lato) by PCR [3], with positive results for Babesia spp. found in 1.1% [n = 6 of 540 ticks, four “Babesia vulpes”, also known as Babesia microti-like, and two Babesia venatorum] and for B. burgdorferi (s.l.) in 1.9% (n = 10 of 540 ticks, six Borrelia garinii and four Borrelia afzelii), of the ticks. However, none of the ticks that were positive for Babesia spp. or B. burgdorferi (s.l.) in that study were positive by PCR for the selected pathogens described in the present study. In a study performed in southern Italy in which 73 ticks from 15 cats were analysed using qPCR, the prevalence of Bartonella spp. in the ticks was 2.7% (qPCR for detection of Bartonella spp. targeting the internal transcribed spacer 1 (ITS1)), but no haemoplasma, Ehrlichia/Anaplasma spp. or H. felis DNA was detected [12]. In another study performed in south-west Italy, 132 ticks collected from 308 cats were analysed using qPCR; the prevalence of B. clarridgeiae in the ticks was 1.5% (qPCR for detection of Bartonella spp. targeting ITS1 followed by DNA sequencing) and the prevalence of Ehrlichia canis was 0.75% (qPCR for detection of Ehrlichia/Anaplasma spp. targeting 16S rRNA followed by DNA sequencing), but no haemoplasma or H. felis DNA was detected [13]. In a study performed in Switzerland in which 71 ticks collected from 39 cats were screened for haemoplasma species using qPCR, the prevalence of “Ca. M. haemominutum” was 2.8% and no M. haemofelis and “Ca. M. turicensis” DNA was detected (qPCR for detection of haemoplasma species targeting 16S rDNA) [14]. Other recent studies in which ticks were collected from both cats and dogs and screened for pathogens by PCR revealed a prevalence of A. phagocytophilum of 24.2% in Belgium (2373 ticks from 506 cats and 647 dogs) and 14.4% in Poland (93 ticks from 171 cats); however neither study indicated the prevalence of pathogens in only those ticks collected from cats [15, 16]. The pathogen prevalences found in our study can only be compared accurately to the two previous Italian studies and the Swiss study [12-14] as these results were obtained from ticks collected from domestic cats only (rather than combined dogs and cats as in the Belgium and Poland studies [15, 16]). Anaplasma phagocytophilum (0.9%) and H. felis (0.2%) were both detected in ticks in our study whilst none were found in the Italian studies [12, 13]. However, Bartonella spp. (1.3%) and B. clarridgeiae (0.2%) were less frequently detected in our study compared to the Italian studies (2.7 [12] and 1.5% [13], respectively). Additionally, “Ca. M. haemominutum” (0.6%) was less frequently identified in this study compared to the Swiss study (2.8%); however, we also detected M. haemofelis (0.2%) and “Ca. M. turicensis” (0.2%) DNA, which were not found in the Swiss study [14]. Possible explanations for these discrepancies include: differences in the tick populations analysed (i.e. ticks collected from cats in Italy and Switzerland were mostly Rhipicephalus spp., including Rhipicephalus sanguineus (s.l.), Rhipicephalus pusillus and Rhipicephalus turanicus and Ixodes spp. (including Ixodes ventalloi as well as I. ricinus)), different methods for DNA extraction and PCR assays and the very low pathogen prevalence detected in our study. Studies investigating the prevalence of tick-borne pathogens in ticks collected from wild cats have been performed in Japan and Algeria [17-20]. DNA from Anaplasma spp., Bartonella spp., haemoplasma species and Hepatozoon spp. was identified in ticks from Japanese wild cats [17-19], whereas Bartonella spp. DNA was not identified in the ticks collected from Algerian wild cats, nor were these ticks tested for Anaplasma spp., haemoplasma species and Hepatozoon spp. DNA [20]. Thus, it is apparent that tick-borne pathogens may be of importance in wild cats too, although only limited data are available and comparisons with our data are difficult to make. The rodent tick, I. trianguliceps, comprised 1.5% of the ticks collected from cats in the UK [3]. Two haemoplasmas, “Ca. M. haemominutum” and M. haemofelis, were identified in two separate I. trianguliceps samples. No other pathogens were detected in this tick species in our study and Babesia spp. and Borrelia spp. DNA were not detected in these ticks in an earlier study [3]. Overall, the prevalence of haemoplasma DNA in I. trianguliceps was 25% (2/8), although the number of ticks included is small. The three remaining samples positive for haemoplasma DNA were derived from I. ricinus ticks; resulting in a haemoplasma prevalence of 1.0% (3/308) in I. ricinus. These results suggest a possible association between feline haemoplasmas and I. trianguliceps, which warrants further investigation with larger numbers of ticks. The Swiss study identified two “Ca. M. haemominutum” in Ixodes spp.; however, the tick species were not determined. To the authors’ knowledge, this is the first report of haemoplasma detection in I. trianguliceps ticks. In our study, the prevalence of Hepatozoon spp. was 0.4%. Sequencing confirmed the presence of one each of H. felis (n = 1 of 540 ticks, 0.2%) and H. silvestris (n = 1 of 540 ticks, 0.2%). Recently, H. silvestris was identified for the first time in European wild cats [21]. Meronts of H. silvestris were identified in cardiac and skeletal muscles associated with mild myocarditis and increased creatinine kinase activity, and pathogen DNA was also detected in the lungs and spleen of infected animals [21]. Interestingly, H. felis meronts were previously reported in cardiac and skeletal muscles in domestic cats without evidence of reactive inflammation suggestive of subclinical infection [22]. However, this is substantially different from Hepatozoon americanum infection reported in dogs and wildlife in the USA causing severe and painful pyogranulomatous myositis [22]. The present study is the first report of detection of H. silvestris in ticks collected from domestic cats. Additional studies are necessary to investigate further the pathogenicity and tropism of H. silvestris as compared to H. felis and H. americanum. Detection of more than one pathogen in an individual tick DNA sample was not reported in our study. However, co-detection of tick-borne pathogens in Ixodes spp. ticks have been previously described; these have included Babesia venatorum and Borrelia afzelii in the UK [3], A. phagocytophilum with Rickettsia helvetica or Borrelia afzelii in Belgium [15], and dual, triple or quadruple infections with combinations of Rickettsia spp., Babesia spp., “Candidatus Neoehrlichia mikurensis” and A. phagocytophilum in Poland [16]. In our study, 88% of the tick samples were PCR positive for feline DNA. This result confirmed that most ticks were collected from cats after a blood meal. However, 71.7% of ticks that were classified as being unfed were PCR positive for feline DNA; it is likely that these ticks were removed from cats soon after they had started feeding and before they had engorged. Intriguingly, 16.4% of fully fed ticks and 8.6% of partially fed ticks were PCR negative for feline DNA (Table 2). Errors in DNA purification or the presence of PCR inhibitors were excluded by the positive IAC PCR results obtained on the tick DNA samples previously [3]. Our study had some limitations. Only cats that were presented to veterinarians were used as the source of ticks and so this cannot be considered a random sample of domestic cat ticks, although the cats that were examined were not brought into the veterinary surgery specifically for tick infestation. It could be argued that the cats sampled might also have been likely to receive preventative tick treatment, since they were under veterinary care. No IAC PCR for the presence of tick DNA was available, but an artificial IAC was included to confirm the presence of amplifiable DNA [3]. We were not able to use PCRs for the detection of feline Anaplasma or Ehrlichia spp. infection at a genus level on the tick DNA samples, due to the known presence of endogenous tick Ehrlichia/Anaplasma spp., as previously described [23], which confounds any positive results. Ideally, we would have simultaneously collected blood samples from the infested cats to determine whether these were the origin of the positive results in the collected ticks, but such samples were not available. Controlled studies are also required to determine whether ticks are true vectors for these pathogens.

Conclusion

The results from this study provide important information on the prevalence of selected tick-borne pathogens in ticks found on cats, a research area infrequently studied. Mycoplasma haemofelis, “Ca. M. turicensis”, A. phagocytophilum and H. felis were found more commonly, and Bartonella spp., B. clarridgeiae and “Ca. M. haemominutum” less commonly, to similar studies on ticks from cats in Italy and Switzerland. This study also documents the first report of H. silvestris in ticks collected from domestic cats.
  21 in total

Review 1.  Tick modulation of host immunity: an important factor in pathogen transmission.

Authors:  S K Wikel
Journal:  Int J Parasitol       Date:  1999-06       Impact factor: 3.981

2.  Development of a novel genus-specific real-time PCR assay for detection and differentiation of Bartonella species and genotypes.

Authors:  Maureen H Diaz; Ying Bai; Lile Malania; Jonas M Winchell; Michael Y Kosoy
Journal:  J Clin Microbiol       Date:  2012-02-29       Impact factor: 5.948

3.  Prevalence of ticks and tick-borne pathogens: Babesia and Borrelia species in ticks infesting cats of Great Britain.

Authors:  Saran Davies; Swaid Abdullah; Chris Helps; Séverine Tasker; Hannah Newbury; Richard Wall
Journal:  Vet Parasitol       Date:  2017-08-01       Impact factor: 2.738

4.  Molecular survey of arthropod-borne pathogens in ticks obtained from Japanese wildcats.

Authors:  Morihiro Tateno; Ayano Sunahara; Nozomi Nakanishi; Masako Izawa; Tomohide Matsuo; Asuka Setoguchi; Yasuyuki Endo
Journal:  Ticks Tick Borne Dis       Date:  2015-02-11       Impact factor: 3.744

5.  Molecular evidence of vector-borne pathogens in dogs and cats and their ectoparasites in Algiers, Algeria.

Authors:  Amina Bessas; Hamza Leulmi; Idir Bitam; Sara Zaidi; Khatima Ait-Oudhia; Didier Raoult; Philippe Parola
Journal:  Comp Immunol Microbiol Infect Dis       Date:  2016-01-23       Impact factor: 2.268

Review 6.  Cats are not small dogs: is there an immunological explanation for why cats are less affected by arthropod-borne disease than dogs?

Authors:  Michael J Day
Journal:  Parasit Vectors       Date:  2016-09-20       Impact factor: 3.876

7.  Detection of selected pathogens in ticks collected from cats and dogs in the Wrocław Agglomeration, South-West Poland.

Authors:  Nina Król; Anna Obiegala; Martin Pfeffer; Elżbieta Lonc; Dorota Kiewra
Journal:  Parasit Vectors       Date:  2016-06-21       Impact factor: 3.876

8.  Hepatozoon silvestris sp. nov.: morphological and molecular characterization of a new species of Hepatozoon (Adeleorina: Hepatozoidae) from the European wild cat (Felis silvestris silvestris).

Authors:  Adnan Hodžić; Amer Alić; Senad Prašović; Domenico Otranto; Gad Baneth; Georg Gerhard Duscher
Journal:  Parasitology       Date:  2016-12-12       Impact factor: 3.234

9.  Prevalence study and risk factor analysis of selected bacterial, protozoal and viral, including vector-borne, pathogens in cats from Cyprus.

Authors:  Charalampos Attipa; Kostas Papasouliotis; Laia Solano-Gallego; Gad Baneth; Yaarit Nachum-Biala; Elpida Sarvani; Toby G Knowles; Sena Mengi; David Morris; Chris Helps; Séverine Tasker
Journal:  Parasit Vectors       Date:  2017-03-13       Impact factor: 3.876

10.  Ticks infesting domestic dogs in the UK: a large-scale surveillance programme.

Authors:  Swaid Abdullah; Chris Helps; Severine Tasker; Hannah Newbury; Richard Wall
Journal:  Parasit Vectors       Date:  2016-07-07       Impact factor: 3.876

View more
  11 in total

1.  Ecological and Socioeconomic Factors Associated with Bartonella henselae Exposure in Dogs Tested for Vector-Borne Diseases in North Carolina.

Authors:  Erin W Lashnits; Daniel E Dawson; Edward Breitschwerdt; Cristina Lanzas
Journal:  Vector Borne Zoonotic Dis       Date:  2019-05-21       Impact factor: 2.133

2.  Fatal infection with emerging apicomplexan parasite Hepatozoon silvestris in a domestic cat.

Authors:  Kristel Kegler; Ursina Nufer; Amer Alic; Horst Posthaus; Philipp Olias; Walter Basso
Journal:  Parasit Vectors       Date:  2018-07-20       Impact factor: 3.876

3.  Pathogens in fleas collected from cats and dogs: distribution and prevalence in the UK.

Authors:  Swaid Abdullah; Chris Helps; Séverine Tasker; Hannah Newbury; Richard Wall
Journal:  Parasit Vectors       Date:  2019-02-06       Impact factor: 3.876

4.  First autochthonous case of clinical Hepatozoon felis infection in a domestic cat in Central Europe.

Authors:  Walter Basso; Dagmar Görner; Majda Globokar; Anke Keidel; Nikola Pantchev
Journal:  Parasitol Int       Date:  2019-06-19       Impact factor: 2.230

5.  Tick-borne pathogens in Ixodidae ticks collected from privately-owned dogs in Italy: a country-wide molecular survey.

Authors:  Stefania Zanet; Elena Battisti; Paola Pepe; Lavinia Ciuca; Liliana Colombo; Anna Trisciuoglio; Ezio Ferroglio; Giuseppe Cringoli; Laura Rinaldi; Maria Paola Maurelli
Journal:  BMC Vet Res       Date:  2020-02-07       Impact factor: 2.741

6.  Arthropod-Borne Pathogens in Stray Cats from Northern Italy: A Serological and Molecular Survey.

Authors:  Valentina Virginia Ebani; Lisa Guardone; Federica Marra; Iolanda Altomonte; Simona Nardoni; Francesca Mancianti
Journal:  Animals (Basel)       Date:  2020-12-08       Impact factor: 2.752

7.  Bacterial Pathogens and Symbionts Harboured by Ixodes ricinus Ticks Parasitising Red Squirrels in the United Kingdom.

Authors:  Lisa Luu; Ana M Palomar; Gemma Farrington; Anna-Katarina Schilling; Shonnette Premchand-Branker; John McGarry; Benjamin L Makepeace; Anna Meredith; Lesley Bell-Sakyi
Journal:  Pathogens       Date:  2021-04-11

8.  Molecular Survey and Spatial Distribution of Rickettsia spp. in Ticks Infesting Free-Ranging Wild Animals in Pakistan (2017-2021).

Authors:  Abid Ali; Shehla Shehla; Hafsa Zahid; Farman Ullah; Ismail Zeb; Haroon Ahmed; Itabajara da Silva Vaz; Tetsuya Tanaka
Journal:  Pathogens       Date:  2022-01-26

9.  Transmission of Bartonella henselae within Rhipicephalus sanguineus: Data on the Potential Vector Role of the Tick.

Authors:  Wittawat Wechtaisong; Sarah I Bonnet; Yi-Yang Lien; Shih-Te Chuang; Yi-Lun Tsai
Journal:  PLoS Negl Trop Dis       Date:  2020-10-01

10.  Relationship among bats, parasitic bat flies, and associated pathogens in Korea.

Authors:  Haeseung Lee; Min-Goo Seo; Seung-Hun Lee; Jae-Ku Oem; Seon-Hee Kim; Hyesung Jeong; Yongkwan Kim; Weon-Hwa Jheong; Oh-Deog Kwon; Dongmi Kwak
Journal:  Parasit Vectors       Date:  2021-09-27       Impact factor: 3.876

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.