Hepatozoon apri n. sp. (Adeleorina: Hepatozoidae) from the Japanese wild boar Sus scrofa leucomystax (Mammalia: Cetartiodactyla).

Hepatozoon apri n. sp. is described from Japanese wild boars Sus scrofa leucomystax in Japan. The gamonts in the peripheral blood leukocytes were 11.6 ± 1.4 × 6.7 ± 1.3 μm in size. The meronts in the muscle tissues were 35.0-47.5 μm in length and 26.5-30 μm in width. A high rate (53.0%) of infection was found by nested PCR using muscle specimens from 181 wild boars captured in Tokushima, Japan. A phylogenetic analysis based on 18S rRNA gene sequences revealed that H. apri n. sp. detected in wild boars is closely related to Hepatozoon spp. isolated from carnivores. This is the first description of a species belonging to the genus Hepatozoon detected in ungulates.

Introduction

Species of the genus Hepatozoon Miller, 1908 are apicomplexan parasites that infect terrestrial vertebrates as intermediate hosts and hematophagous arthropods as final hosts. Among mammalian hosts, Hepatozoon infections have mainly been reported in rodents, lagomorphs, insectivores, marsupials, and carnivores, and have rarely been reported in ungulates (Clark et al., 1973, McCully et al., 1975, Smith, 1996, Graig, 2001). However, Hepatozoon sp. have recently been detected in muscle tissues of the Japanese wild boar Sus scrofa leucomystax (Mammalia: Cetartiodactyla) in Gihu Prefecture, Japan (Matsuo et al., 2016) and Hepatozoon DNA has been detected in wood ticks in the genus Dermacentor (Arthropoda: Ixodidae) collected from wild boars in Thailand (Sumrandee et al., 2015). These reports suggest that unknown Hepatozoon species are found in wild boars in Asia.

Population sizes of ungulates, such as wild boars and the sika deer Cervus nippon, have increased dramatically throughout Japan in recent decades, resulting in significant agricultural damage (Honda and Sugita, 2007, Honda et al., 2010). These animals play an important ecological role in the dispersal of zoonotic parasites, including Toxoplasma, Sarcocystis, Paragonimus, Onchocerca, and Gnathostoma (Takaoka et al., 2004, Meng et al., 2009, Sugiyama et al., 2015). Further, the risk of diseases caused by these parasites is an increasing concern owing to the frequent contact between humans and domestic animals. In the present study, we detected Hepatozoon species in a survey of zoonotic parasites in Japanese wild boars caught in the mountain area of Tokushima Prefecture located on Shikoku Island, Japan. The aims of this study were to determine the morphological and molecular characteristics of Hepatozoon species in wild boars, and to evaluate the prevalence of the species in wild populations in Tokushima, Japan.

Materials and methods

Sample collection

Between May 2014 and January 2017, 181 Japanese wild boars (93 males and 88 females), including 11 juveniles (with body striping) and 170 young or older individuals, and 113 sika deer (Cervus nippon centralis) were legally hunted by licensed hunters in Tokushima, Japan in accordance with the Protection and Control of Wild Birds and Mammals and Hunting Management Law. This study did not require approval by an animal ethics committee, since animals were not killed specifically for the study. Muscle tissue samples were obtained from all individuals. Heart, liver, kidney, and spleen tissues and EDTA-anticoagulated blood were obtained from five boars (sample IDs: 28-3, 28-11, 28-12, 28-18, and 28-26) caught between September 2016 and January 2017.

Hematological and histopathological examinations

Thin blood or buffy coat smears were prepared, air-dried, fixed, and stained using the Diff-Quik Staining Kit (Sysmex, Hyogo, Japan). Parasitemia was estimated by counting parasitized leukocytes among 3000–3100 leukocytes in these smears. Gamonts and meronts were measured using the cellSense software (Olympus, Tokyo, Japan). For histopathological examinations, the muscle, heart, liver, kidney, and spleen tissues from five boars were fixed in 10% formalin. These specimens were processed routinely, embedded in paraffin, and stained with hematoxylin and eosin (H&E).

In a previous study, Hepatozoon sp. was found in muscle tissues from a Japanese wild boar (ID: IB20) captured in Gifu prefecture, Japan (Matsuo et al., 2016). Sequence analyses revealed that Hepatozoon sp. from wild boar (ID: IB20) was identical to the Hepatozoon species found in the wild boars in the present study. To identify developmental stages of Hepatozoon sp. parasitizing wild boar, formalin-fixed paraffin-embedded myocardium and skeletal muscle tissues from IB20 were newly sectioned, stained with H&E, and examined microscopically.

DNA extraction, DNA amplification, and sequencing

Muscle, heart, liver, kidney, and spleen tissue samples (500 mg) were homogenized separately, supplemented with 700 μL of TE buffer (Nippon Gene, Toyama, Japan), and mixed vigorously for 30 s. After centrifugation at 6000 × g, genomic DNA was extracted from 200 μL of supernatants using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany). For blood specimens, DNA was extracted from buffy coat samples using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturer's instructions.

PCR was performed to amplify the partial 18S rRNA gene (18S) from five blood specimens using the primer set 18S1F/18S11R to detect apicomplexan parasites (Pritt et al., 2008). Nested PCR of the same region was performed using the blood and tissues of the heart, liver, kidney, and spleen from five boars and muscle samples from all 181 boars and 113 deer. For nested-PCR, the primers Hap1F, designed based on the 18S sequence of Hepatozoon species from wild boars in this study, and 18S11R were used. Expected amplicon size for 1st and 2nd PCR was 1108 bp and 557 bp, respectively. Detailed primer information is provided in Table 1.

Table 1

Primers used in this study.

Name	Direction	Sequence	Reference
18S1F	F	5′- GGATAACCGTGGTAATTCTATG -3′	Pritt et al., 2008
18S11R	R	5′- TCCTATGTCTGGACCTGGTGAG -3′	Pritt et al., 2008
Hap1F	F	5′- GCTTTTAATAAAAGTAGTATCTTGG -3′	Present study

The PCR mixture contained 2.5 μL of 10 × Ex Taq buffer (Takara Bio Inc., Otsu, Japan), 0.2 mM dNTP (Takara), 0.2 μM each primer, 1 U of Ex Taq polymerase (Takara) and 1 μL of DNA extract or 1st PCR products in a total volume of 20 μL. PCR conditions consisted of initial denaturation at 94 °C for 5 min, followed by 40 (1st PCR) or 25 cycles (2nd PCR) at 94 °C for 30 s, 60 (1st PCR) or 52.5 °C (2nd PCR) for 1 min, and 72 °C for 1 min, and then a final extension step at 72 °C for 5 min. All amplifications were performed using the Gene Atlas thermal cycler (Astec, Chattanooga, TN, USA). The amplified DNA was applied to 2% agarose gels, electrophoresed, and visualized under an LED transilluminator. PCR products were directly sequenced in both directions with the primers used for the 1st or 2nd PCR using the GenomeLab Dye Terminator Cycle Sequencing with Quick Start Kit (Beckman, Brea, CA, USA) and CEQ8000 (Beckman).

DNA sequence analyses

The 18S sequences were used to establish the phylogenetic position of the present Hepatozoon species. Sequence similarity was determined using a BLASTN search against the National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov/Blast.cg).

The obtained sequence and 18S sequences of Hepatozoon spp. and related genera (Hemolivia, Haemogregarina, Dactylosoma, and Adelina) available in the DDBJ/EMBL/GenBank databases were aligned using a web-based version of a multiple alignment program (MAFFT, version 7) (Katoh and Standley, 2013) with the Q-INS-i setting, followed by a manual check. Uncorrected p-distances between all sequence pairs were calculated using MEGA version 7.0 (Kumar et al., 2016). A phylogenetic analysis was performed using neighbor-joining (NJ) and maximum likelihood (ML) methods implemented in MEGA. All positions containing gaps and missing data were eliminated and both trees were constructed using the Tamura–Nei model and gamma-distributed rates (AICc score, 4313.7). A bootstrap analysis was performed using 1000 replicates.

Results

General findings

All blood smears from five different boar specimens had gamonts in leukocytes (Fig. 1a–d). The average parasitemia of Hepatozoon was 0.20%, ranging from 0.03% (ID: 28-12, 1/3060 leucocytes) to 0.39% (ID: 28-11, 12/3081 leucocytes). Evident anemia and leukocytosis were not observed in these specimens. Histological examinations demonstrated that there were a few focal legions in the skeletal muscle tissues of the boar (ID: 28-11). A lesion was comparable to a ruptured meront, characterized by an accumulation of phagocytes, neutrophils, and merozoites- or gamont-like cells (Fig. 2). We did not detect histologic lesions in any of the other tissues of wild boars captured in Tokushima, Japan. On the other hand, histological examinations of the myocardium and skeletal muscles of Japanese wild boar from Gifu prefecture (IB20) demonstrated the presence of trophozoite (Fig. 3a), immature (Fig. 3b and c) and mature meronts (Fig. 3d). These were located in the center of parasitophorous vacuoles and no inflammatory response was found in the surrounding region (Fig. 3a–d).

Fig. 1

a–b) Gamonts of Hepatozoon apri n. sp. in the cytoplasm of neutrophils detected in the blood smear of a boar (ID: 28-11), showing acentric and rounded nuclei (arrows) and a small protrusion containing eosinophilic granules (arrowheads).

Fig. 2

Inflammatory lesion with released merozoites or gamonts in the femoral muscle of Japanese wild boar.

Fig. 3

a–d) Various developmental stages of Hepatozoon apri n. sp. detected in the muscles. a) A trophozoite (arrow) in the femoral muscles. The outer layer contains a fibroblast-like nucleus (arrowhead). b–c) Immature meronts found in the heart. d) Mature meront in the femoral muscles. H&E stain. Bar = 20 μm.

In a PCR assay of five blood specimens with intraleukocytic parasites, the primer set 18S1F/18S11R yielded positive results, and the PCR products were approximately 1100 bp for all specimens. Partial 18S sequences (1007 bp) of 5 specimens were 100% identical. BLASTN analyses of partial 18S sequences obtained in this study and the top three hits in a search against the GenBank/DDBJ/EMBL databases indicated an identity of 100% (query cover: 100%) with Hepatozoon sp. (accession no. LC062147) from a Japanese wild boar (ID: IB20) in Gifu, Japan, 97.6% (query cover: 99.4%) with Hepatozoon felis (accession nos. AY620232, AY628688, and KX017290) from the domestic cat Felis catus, and 97.5% (query cover 100%) with Hepatozoon sp. (accession no. EF222257) from the European pine marten Martes martes. Based on the genetic similarities between the present species and Hepatozoon sp. from Japanese wild boar (ID: IB20), both were considered to be the same new species, and are described as follows.

Description

Phylum Apicomplexa Levine, 1970

Family Hepatozoidae Wenyon, 1926

Genus Hepatozoon Miller, 1908

Hepatozoon apri n. sp.

Gamont (Fig. 1a–d)

The gamont was ellipse-shaped, occupied the longitudinal length of the infected leukocytes, and possessed an acentric nucleus (Fig. 1a–d) and one small protrusion containing eosinophilic granules (Fig. 1b–d). The sizes were 11.59 ± 1.4 (9.08–16.52) μm in length and 6.67 ± 1.3 (4.28–11.52) μm in width. Based on morphological appearance, infected leukocytes resembled neutrophils.

Trophozoite and meront (Fig. 3a–d)

Trophozoites were found in the parasitophorous vacuoles of the host cells with foamy cytoplasm (Fig. 3a). Two types of developing meronts were observed in the tissues of myocardium muscles. These immature meronts were located in the center of enlarged vacuoles (Fig. 3b and c). One immature meront was wheel spoke-shaped and 45.0 × 27.5 μm in size, with approximately 30 peripherally arranged merozoites as palisades inside a membrane, and foamy cytoplasm (Fig. 3b). The other immature meront was ovoidal, 35.0 × 26.5 μm in size, and with a lumen loosely filled with approximately 50 merozoites with rounded large nuclei (Fig. 3c). One mature meront found in the skeletal muscle tissue was 47.5 × 30.0 μm in size, with a lumen densely filled with numerous small nucleated merozoites (Fig. 3d).

Taxonomic summary

Type host (intermediate host)

Japanese wild boar Sus scrofa leucomystax.

Location in type host

Gamonts were found in leukocytes in the peripheral blood. Trophozoites and meronts were found in the myocardium and skeletal muscle tissues.

Prevalence of infection in type hosts

Nested PCR using a specific primer set showed positive results in blood specimens and muscle, heart, liver and spleen tissues from five wild boars (Table 2) whose blood smears were microscopically positive for Hepatozoon parasites in leukocytes. Therefore, muscle samples were used to examine the prevalence of Hepatozoon infections among 181 Japanese wild boars hunted in Tokushima, Japan. A total of 96 (53.0%) were positive based on nested PCR (Table 3). Twenty positive samples were sequenced; these sequences were 100% identical to each other and were identified as H. apri n. sp.

Table 2

Results of nested PCR for detection of Hepatozoon 18S in five Japanese wild boars, whose blood smears showed Hepatozoon parasites in leukocytes.

Sample IDs	Blood	Muscle	Heart	Liver	Kidney	Spleen
28–3	+	+	ND	ND	ND	ND
28–11	+	+	+	+	–	+
28–12	+	+	–	–	–	–
28–18	+	+	+	–	–	–
28–26	+	+	ND	ND	ND	ND

+, PCR amplicon with nested PCR.

-, no amplicon.

ND, not done.

Table 3

Prevalence of Hepatozoon infection in muscle specimens of 181 Japanese wild boars and 113 sika deer hunted in Tokushima, Japan.

	Japanese boars (n = 181)				Sika deer (n = 113)
	Juvenile		Young or older
	Male	Female	Male	Female
Positive	0 (0%)	1 (0.6%)	49 (27.1%)	46 (25.4%)	0 (0%)
Negative	8 (4.4%)	2 (1.1%)	36 (19.9%)	39 (21.5%)	113 (100%)
Total	8	3	85	85	113

Vector (final host)

Unknown.

Other host

Unknown. All muscle specimens collected from 113 sika deer hunted in Tokushima, Japan were negative in a nested PCR analysis (Table 3).

Locality

Tokushima and Gifu prefectures, Japan. Based on the high infection rate, it is likely present in other areas of Japan.

Type specimens

A buffy coat smear from a Japanese wild boar (ID: 28-11) stained using the Diff-Quik Staining Kit containing intraleukocytic gamonts and muscle tissue slides from a Japanese wild boar (ID: 20B) stained by H&E containing mmature and immature meronts were deposited at the Meguro Parasitological Museum, Meguro, Tokyo, Japan under accession numbers MPM Col. No.21398, MPM Col. No. 21399, and MPM Col. No. 21340, respectively.

ZooBank LSID

The ZooBank LSID is urn:lsid:zoobank.org:act:pub:CE832E19-BF49-4A76-AA35-8C205573F308.

Representative DNA

One sequence representing a 1007 bp fragment of 18S rRNA has been deposited at DNA Data Bank of Japan (DDBJ) under accession no. LC314791.

Etymology

The specific epithet, apri, is derived from the genitive of the Latin noun aper, meaning a wild boar, the type host for the new species.

Phylogenetic analyses

A 522-bp nucleotide sequence alignment of the short 18S was generated for 41 sequences of Hepatozoon species and 4 sequences of other hemogregarines. Phylogenetic analyses using NJ and ML methods generated a similar tree topology with minor variation in bootstrap values. For brevity, we present only the ML tree with bootstrap values obtained from both ML and NJ trees (Fig. 4). Hepatozoon apri n. sp. belonged to a clade that contained sequences of Hepatozoon sp. detected in wild boar (ID: IB20) in Gihu, Japan (accession no. LC062147) and Dermacentor ticks collected from S. scrofa in Thailand (accession nos. KF318170 and KF318171). This clade was within a major clade containing Hepatozoon isolates from carnivores (dogs, cats, wild cat, bears, and martens). The uncorrected p-distances of 18S within the first clade containing Hepatozoon from wild boars and from Dermacentor ticks was 0.04; between H. apri n. sp. and the clade containing Hepatozoon species infecting carnivores was 0.032 ± 0.01 and ranged from 0.013 (H. felis found in the Iriomote cat Prionailurus bengalensis iriomotensis) to 0.055 (H. canis found in the dog and pampas fox Lycalopex gymnocercus); between H. apri n. sp. and other Hepatozoon species was 0.048 ± 0.02 and ranged from 0.029 (Hepatozoon sp. found in the Chielo opossum Dromiciops gliroides) to 0.101 (Hepatozoon sp. found in the Northern water snake Nerodia sipedon sipedon). The uncorrected p-distances between species in the genus Hepatozoon and Hemolivia mauritanica, Haemogregarina stepanowi, and Dactylosoma ranarum were 0.034 ± 0.01 (0.013–0.088), 0.068 ± 0.01 (0.047–0.112), and 0.078 ± 0.01 (0.059–0.118), respectively.

Fig. 4

Phylogenetic analysis of Hepatozoon apri n. sp. based on 18S rDNA sequences (522-bp). Adelina dimidiata (accession no. DQ096835) was chosen as the outgroup to root the phylogeny. Neighbor-joining (NJ) and maximum likelihood (ML) analysis showing the phylogenetic relationships among boar isolates and two Hepatozoon spp. (KF318170, KF318171) detected in Dermacentor ticks collected from wild boar in Thailand. Sequences included in the comparison were downloaded from the DDBJ/EMBL/GenBank databases. Filled circles indicate Hepatozoon species reported from Japan. Nodal support values based on 1000 bootstrap replicates (NJ/ML) are represented on the ML tree. Scale bar represents 0.01 nucleotide substitutions per site.

Remarks

Based on morphological characteristics of developmental stages, histological findings, and molecular and phylogenetic analyses, Hepatozoon species reported in the present study represent a new species, herein described as H. apri n. sp. No Hepatozoon species have been described in other ungulates, including those in the family Suidae. Hepatozoon apri n. sp. is closely related to Hepatozoon spp. isolated from carnivores, but the following features can be used to distinguish these species. (1) Gamonts of H. apri n. sp. (11.6 ± 1.4 × 6.7 ± 1.3 μm) were wider than H. ursi gamonts (10.9 ± 0.3 × 3.3 ± 0.2 μm) (Kubo et al., 2008), H. canis gamonts from the domestic dog Canis lupus familiaris (9.7 ± 1.4 × 5.4 ± 0.9 μm) (Baneth et al., 2007), H. americanum gamonts from the domestic dog (8.8 ± 0.6 × 3.9 ± 0.5 μm) (Vincent-Johnson et al., 1997), H. felis gamonts from the domestic cat Felis catus (10.5 ± 0.6 × 4.7 ± 0.8 μm) (Baneth et al., 2013), and H. procyonis from the raccoon Procyon lator (7.5 ± 0.5 × 3.9 ± 0.4 μm) (Clark et al., 1973). (2) Mature meronts of H. apri n. sp. (47.5 × 30.0 μm) are markedly smaller in size than H. americanum meronts (85 ± 7 × 79 ± 13 μm) (Vincent-Johnson et al., 1997). (3) Wheel spoke-shaped meronts of H. apri n. sp. contain around 30 merozoites, whereas H. felis from domestic cat and H. silvestris from European wild cat Felis silvestris silvestris contain 20–30 and 10–15 merozoites, respectively (Hodžić et al., 2016).

Discussion

Members of the genus Hepatozoon have been recorded from a wide variety of vertebrate hosts, and reptiles are the most commonly infected (Smith, 1996). However, in ungulates, Hepatozoon infections are apparently rare and there are no described species. Basson et al. (1967) found organisms in mononuclear leukocytes of the liver tissues of the impala Aepyceros melampus presumed to be H. canis gamonts on the basis of morphology, including the typical banana shape and slight curvature. These characteristics clearly differ from those of the gamont of H. apri n. sp., which have are ellipsoid. Interleukocytic parasites, probably Hepatozoon gamonts, were found in the blood smear of the reedbuck Redunca arundinum and the giraffe Giraffa camelopardalis in Barotseland, located in western Zambia (Fantham, 1922, Fantham, 1921). Presumed Hepatozoon spp. were also observed in the mononuclear leukocytes of tissues of the nyalas Tragelaphus angasi and bushbuck T. scriptus in South Africa (Basson et al., 1971). Clark et al. (1973) detected Hepatozoon gamonts and meronts in the myocardial tissues of a white-tailed deer Odocoileus virginianus from Liano country, Texas. Unfortunately, we could not compare H. apri n. sp. gamonts and Hepatozoon-like organisms detected in other ungulates owing to the paucity of morphological descriptions. Further investigations of the morphological and phylogenetical characteristics of Hepatozoon spp. detected in ungulates are needed in the future.

There are few reports of Hepatozoon isolates from wild mammals in Japan. Hepatozoon ursi has been reported in the Japanese black bear Ursus thibetanus japonicus (Uni et al., 2003, Kubo et al., 2008), H. felis in the Iriomote cat Prionailurus bengalensis iriomotensis (Sakuma et al., 2011), and unidentified Hepatozoon spp. in the Hokkaido brown bear Ursus arctos yesoensis (Kubo et al., 2010), the Ezo red fox Vulpes vulpes schrencki (Maeda et al., 1982), the Tsushima leopard cat Felis bengalensis euptilura (Kubo et al., 2006), the Northern red-backed vole Myodes rutilus and the large Japanese field mouse Apodemus speciosus (Moustafa et al., 2017), the Japanese marten Martes melampus (Yanai et al., 1995), and the Iriomote cat (Kubo et al., 2006). Among these species, morphological properties of immature and mature meronts of H. apri n. sp. are similar to those of undescribed Hepatozoon species found in the heart muscle of the Japanese marten, showing ellipsoidal and ovoidal shapes and sizes of approximately 25–40 μm (Yanai et al., 1995).

The majority of descriptions of Hepatozoon species are based mainly on the morphology of the gamont in hematocytes and systematic relationships among host species from which they are isolated. According to Smith (1996), species of Hepatozoon that parasitize vertebrate hosts display low host specificity to both their final and intermediate hosts; accordingly, descriptions of new Hepatozoon species based merely on new host records should be avoided. However, host specificity of Hepatozoon species found in carnivores has been poorly investigated, and each family or suborder level of carnivores has been assigned their own Hepatozoon species; H. canis, H. americanum, and H. procyonis found in canids, H. felis and H. silvestris in felids, H. ursi in ursids (Vincent-Johnson et al., 1997, Ewing and Panciera, 2003, Kubo et al., 2008, Baneth et al., 2013, Hodžić et al., 2016). Although canine Hepatozoon-like species were also reported from domestic cats (Jittapalapong et al., 2006, Allen et al., 2011), some researchers speculate that these are opportunists that take advantage of immunocompromised states that are otherwise resistant to infection (Baneth et al., 2007, Allen et al., 2011). Our findings showing high infection rates in Japanese wild boars indicate that the Hepatozoon species parasitizing wild boars is a new, dominant, and adapted species.

Sequence analyses using 18S rRNA are used to identify poorly described, rarely isolated, or phenotypically aberrant species, and are routinely used for the identification of Hepatozoon species (Criado-Fornelio et al., 2006, Kubo et al., 2008, Panciera et al., 2011, Baneth et al., 2013, Najm et al., 2014, Cook et al., 2016, Hodžić et al., 2016). In the present study, phylogenetic analyses using the same region support the conclusion that H. apri n. sp. is a novel species related to carnivore-related Hepatozoon species. Further, the genetic distance between the partial 18S sequence of H. apri n. sp. of boar isolates and Hepatozoon sp. detected in Dermacentor ticks from Sus scrofa in Thailand is apparently lower than inter-specific distances. This indicates that H. apri n. sp. or closely related Hepatozoon species are present in wild boars in Asia.

The diagnosis of Hepatozoon infection is usually performed by blood cytology, buffy coat smears, and/or PCR methods (Otranto et al., 2011); however, obtaining blood specimens from shot animals is difficult because they are sensitive to handling. Tissue samples are easy to collect in large quantities in the butchering process and can also be used for the direct detection of bacteria, viruses, and parasites. Although we did not find developmental stages of Hepatozoon in muscle specimens from four boars via histopathological observations, using nested PCR for the detection of H. apri n. sp., we amplified Hepatozoon DNA from all muscle specimens from infected boars. Results obtained using other tissues are not consistent with the smear test results, implying the organ specificity of H. apri n. sp. in boars. Nested PCR analysis using muscle specimens is useful to investigate the prevalence of H. apri n. sp. among a large number of wild boars. The prevalence of H. apri n. sp. in wild boars (53.0%) suggests that it is a widely distributed parasite in populations of Japanese wild boars.

In the life cycle of the genus Hepatozoon, merogony development takes place in vertebrate hosts, i.e., the intermediate host (Smith, 1996, Graig, 2001). Sporozoites in arthropods, the final host for Hepatozoon, are released into the intestinal tract and penetrate the gut wall to enter the circulation, and meronts that form merozoites occur in various internal organs, such as the intestinal wall, liver, lungs, spleen, bone marrow, and muscles. For mammalian Hepatozoon species, the free merozoites from mature meronts may enter other endothelial cells or penetrate mononuclear leukocytes and become gamonts in most species. After blood sucking by arthropods, both gametogony and sporogony take place in their bodies. The transmission of Hepatozoon to vertebrates occurs by ingestion by the final host, which contains the sporulated oocyst. Species of Hepatozoon isolated from the dog have been transmitted to uninfected rats and rabbits by the ingestion of H. americanum sporozoites and developed to a persistent cystozoite stage. Moreover, tissues containing those cystozoites are infectious in dogs, indicating that small animals could act as a natural reservoir for Hepatozoon species and that predator-prey cycles can occur in the life cycle of Hepatozoon (Johnson et al., 2008, Johnson et al., 2009). Furthermore, vertical transmission of H. canis in puppies has been reported (Murata et al., 1993). The final host for H. apri n. sp. is unknown, but molecular evidence indicates that Dermacentor ticks are potential vectors for the present species. The pathogenicity of H. apri n. sp. is unknown; however, the high prevalence in wild boars in the present study is evidence that the virulence of this parasite might be low and exposure is frequent in the wild populations, as observed in Japanese black bears (Kubo et al., 2008) and Japanese marten (Yanai et al., 1995) in Japan.

In conclusion, the newly described Hepatozoon species is widely distributed in wild boars. Future research should focus on the parasitological features, such as the developmental process, host specificity, transmission route, and pathogenicity, as well as the risk of H. apri n. sp. infection in domestic pig Sus scrofa domesticus and other mammals.

Conflicts of interest

None.