Literature DB >> 29553328

Lyssavirus in Japanese Pipistrelle, Taiwan.

Shu-Chia Hu, Chao-Lung Hsu, Ming-Shiuh Lee, Yang-Chang Tu, Jen-Chieh Chang, Chieh-Hao Wu, Shu-Hwae Lee, Lu-Jen Ting, Kwok-Rong Tsai, Ming-Chu Cheng, Wen-Jane Tu, Wei-Cheng Hsu.   

Abstract

A putative new lyssavirus was found in 2 Japanese pipistrelles (Pipistrellus abramus) in Taiwan in 2016 and 2017. The concatenated coding regions of the virus showed 62.9%-75.1% nucleotide identities to the other 16 species of lyssavirus, suggesting that it may be representative of a new species of this virus.

Entities:  

Keywords:  Japanese pipistrelle; Pipistrellus abramus; Taiwan; bat; lyssavirus; viruses

Mesh:

Year:  2018        PMID: 29553328      PMCID: PMC5875257          DOI: 10.3201/eid2404.171696

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


The Lyssavirus genus within the family Rhabdoviridae is composed of 14 species of lyssavirus: rabies lyssavirus (RABV), Lagos bat lyssavirus (LBV), Mokola lyssavirus (MOKV), Duvenhage lyssavirus (DUVV), European bat 1 lyssavirus (EBLV-1), European bat 2 lyssavirus (EBLV-2), Australian bat lyssavirus (ABLV), Aravan lyssavirus (ARAV), Khujand lyssavirus (KHUV), Irkut lyssavirus (IRKV), Shimoni bat lyssavirus (SHIBV), Bokeloh bat lyssavirus (BBLV), West Caucasian bat lyssavirus (WCBV), and Ikoma lyssavirus (IKOV) (). In addition, Lleida bat lyssavirus (LLEBV) (,) and Gannoruwa bat lyssavirus (GBLV) () were recently identified in bats, but their taxonomic statuses have not been determined by the International Committee on the Taxonomy of Viruses. The genus Lyssavirus can be subdivided into phylogroup 1 (RABV, DUVV, EBLV-1, EBLV-2, ABLV, ARAV, KHUV, IRKV, BBLV, and GBLV) and phylogroup 2 (LBV, MOKV, and SHIBV) according to genetic distances and serologic cross-reactivity (–). The remaining species, WCBV, IKOV, and LLEBV, cannot be included in either of these phylogroups (,). Bats are the natural hosts of most lyssaviruses, with the exceptions of MOKV and IKOV, which have not been identified in any bats (–). Information about lyssaviruses in bats in Asia is limited. In Central Asia, ARAV was identified in the lesser mouse-eared bat (Myotis blythi) in Kyrgyzstan in 1991, and KHUV was identified in the whiskered bat (M. mystacinus) in Tajikistan in 2001 (). In South Asia, GBLV was identified in the Indian flying fox (Pteropus medius) in Sri Lanka in 2015 (). Although IRKV was identified in the greater tube-nosed bat (Murina leucogaster) in China in 2012 (), knowledge of the exact species and locations of lyssaviruses in East Asia bat populations remains limited. In this article, we report a putative new lyssavirus isolated during our surveillance program in Taiwan. Our discovery suggests that this lyssavirus may be representative of a new species, based on genetic distance.

The Study

Specimens for this study were collected under a permit issued by the Forestry Bureau, Council of Agriculture, Executive Yuan, Taiwan (document no. 1055104969). From 2014 through the end of May 2017, a total of 332 bat carcasses from 13 species were collected for lyssavirus surveillance. Of the collected individuals, 2 tested positive for the virus by direct fluorescent antibody testing and reverse transcription PCR (–). The first bat showing loss of appetite without specific clinical signs was found in Tainan City and died on July 2, 2016. The second bat was found dead in Yunlin County on April 12, 2017, and the carcass was shipped to the Animal Health Research Institute (AHRI) in New Taipei City. We obtained two 428-bp amplicons (N113F/N304R, containing the partial nucleoprotein [N] gene and phosphoprotein [P] gene) from these cases using lyssavirus screen primers (Table 1); we then subjected their sequences to BLAST (https://www.ncbi.nlm.nih.gov/BLAST/), querying the GenBank database. Both sequences were similar to lyssaviruses, with nucleotide identities <79%.The 2 bats were identified as Japanese pipistrelle (Pipistrellus abramus), or Japanese house bat, by morphology (J.-T. Wu, Taxonomic study of the genus Pipistrellus [chiroptera: vespertilionidae] in Taiwan. Master’s thesis, Department of Biological Resources, National Chiayi University, Chiayi City, Taiwan, 2007 [in Chinese]) and DNA barcoding (based on subunit 1 of the mitochondrial protein NADH dehydrogenase [ND1] gene) (). The 2 sequences of partial ND1 genes were then submitted to GenBank; the first had been designated as 2016-2300 (GenBank accession no. MG763889) and the second 2017-1502 (GenBank accession no. MG763890).
Table 1

Lyssavirus screen primers and the 12 amplifying primer sets used to identify Taiwan bat lyssavirus, a putative new lyssavirus found in 2 Japanese pipistrelles (Pipistrellus abramus) in Taiwan in 2016 and 2017

Primer nameSequence, 5′ → 3′Position*
Lyssavirus screen
JW12 (7)ATGTAACACCYCTACAATG
N165–146 (7)GCAGGGTAYTTRTACTCATA
N113F (8)GTAGGATGCTATATGGG
N304R (9)
TTGACGAAGATCTTGCTCAT

Lyssavirus full genome
TWBLV 1FACGCTTAACGACAAAAYC1–18*
TWBLV 1RTCTTGCATTTCTTTCTCATC1154–1173
TWBLV 2FTTCGTAGGATGTTACATGGG1010–1029
TWBLV 2R taaaaatatcccagaagatc 2174–2193
TWBLV 3FAGARATAGCWCATCAGATWGC2118–2138
TWBLV 3RCTATTGTGTGGCACCATWAC3205–3224
TWBLV 4FGATGAGGATAAGAACACATC3072–3091
TWBLV 4RTCCTGAAGTGACTGAGTTTTC4274–4294
TWBLV 5FCTGATGGAYGGRTCATGGGT4081–4100
TWBLV 5RGAGACAGGAGCCGGAGTCTT5280–5299
TWBLV 6FAACAGGTAGCTCCCGAGTTTGTTC4881–4904
TWBLV 6RCTGAGTGAGACCCATGTATCCAAA5767–5790
TWBLV 7FACTGAGGTTTATGATGACCC5478–5497
TWBLV 7RCCCCAGTGTCTATARCAWCC6561–6580
TWBLV 8FCATTCTTTGGGGGATTTCCC6426–6445
TWBLV 8RGTTTGTGATTCTCTRTCWATC7595–7615
TWBLV 9FCATGCTGGAACGGTCAGGAYG7522–7542
TWBLV 9RCTGAGTTAAAGAAAGATTCTT8662–8682
TWBLV 10FCTCAGTGAGTTRTTYAGCTC8547–8566
TWBLV 10RCAGATAGAAGAGCCTATT9746–9763
TWBLV 11FCATGATTCAGGGTAYAAYGA9648–9667
TWBLV 11RGTCTGTAACTTCTGCATCAC10862–10871
TWBLV 12FATCTGGGAAAAGCCATCAGA10755–10774
TWBLV 12RACGCTTAACAAAAAAAACAA11961–11980

*Compared with reference genomic sequence, Irkut lyssavirus (GenBank accession no. NC020809). TWBLV, Taiwan bat lyssavirus.

*Compared with reference genomic sequence, Irkut lyssavirus (GenBank accession no. NC020809). TWBLV, Taiwan bat lyssavirus. We isolated lyssavirus successfully from the 2 bats’ brains; we confirmed the identity of lyssavirus morphologically by electron microscopy () and molecularly by nucleotide sequencing. In addition, after we isolated the viruses from the brain tissues, we performed reverse transcription PCR and virus isolation for visceral organs and salivary glands; both tests were positive for the salivary glands of both bats. We determined nucleotide sequences of the genome of the isolated viruses, designated Taiwan bat lyssavirus (TWBLV). The first TWBLV isolate was designated TWBLV/TN/2016 (GenBank accession no. MF472710), and the second TWBLV/YL/2017 (GenBank accession no. MF472709). We amplified the nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and RNA-dependent RNA polymerase (L) genes of the 2 TWBLV isolates by 12 primer sets designed by the AHRI (Table 1). The genome length of the 2 TWBLV isolates was 11,988 bases, with G+C contents of 43.66% for TWBLV/TN/2016 and 43.83% for TWBLV/YL/2017. The genomic organization was similar to those of other lyssaviruses: 3′ untranslated region (UTR), 70 nt; N, 1356 nt; N-P UTR, 99 nt; P, 897 nt; P-M UTR, 82 nt; M, 609 nt; M-G UTR, 212 nt; G,1629 nt; G-L UTR, 518 nt; L, 6384 nt; and 5′ UTR, 132 nt. The 2 TWBLV isolates showed 98.7% nucleotide identity in the N gene and 98.6% nucleotide identity in the concatenated coding genes (N+P+M+G+L). Nucleotide identities of different genes between the TWBLVs and the other 16 lyssaviruses are listed in Table 2. For the N gene, the TWBLVs had the highest identities with IRKV (79.0%–80.6%), followed by EBLV-1 (78.8%–79.4%). The TWBLVs shared nucleotide identities with the concatenated coding genes of EBLV-1 (75.1%), followed by IRKV (74.0%). The phylogenetic analysis demonstrated that lyssaviruses were separated into 2 phylogroups; the TWBLVs were grouped into phylogroup 1 and clustered with the EBLV-1, IRKV, and DUVV (Figure).
Table 2

Nucleotide identities for the N, P, M, G, L genes and the concatenated coding genes between Taiwan bat lyssavirus, a putative new lyssavirus found in 2 Japanese pipistrelles (Pipistrellus abramus) in Taiwan in 2016 and 2017, compared with other lyssaviruses*

Lyssavirus species (GenBank accession no.)Concatenated coding genes (N+P+M+G+L)
Identity, %
NPMGL
Rabies lyssavirus (NC001542)75.262.8–63.174.6–74.861.6–62.371.770.0–70.1
Lagos bat lyssavirus (NC020807)73.5–73.753.8–54.173.655.0–55.671.3–71.467.8–67.9
Mokola lyssavirus (NC006429)72.7–73.352.2–52.472.0–72.656.7–56.970.6–70.767.3 −67.4
Duvenhage lyssavirus (NC020810)77.7–77.967.5–67.678.4–79.263.9–64.074.8–74.973.2
European bat 1 lyssavirus (NC009527)78.8–79.469.6–69.780.9–81.166.176.7–76.875.1
European bat 2 lyssavirus (NC009528)75.3–75.666.0–66.379.2–79.564.5–64.673.772.2–72.3
Australian bat lyssavirus (NC003243)76.3–76.562.272.161.7–62.072.3–72.570.4
Aravan lyssavirus (NC020808)76.5 −76.765.6–6680.3–80.664.4–64.574.6–74.972.9–73.1
Khujand lyssavirus (NC025385)74.6–74.767.0–67.178.6–78.764.5–64.974.2–74.372.4–72.5
Irkut lyssavirus (NC020809)79.0–79.168.3–68.680.365.3–65.875.3–75.474
Irkut lyssavirus-THChina12 (JX442979)80.5–80.668.7–69.079.8–80.064–64.675.1–75.474
West Caucasian bat lyssavirus (NC025377)72.3–72.751.2–51.571.452.068.3–68.465–65.2
Shimoni bat lyssavirus (NC025365)74.1–74.554.9–55.174.2–74.656.2–56.471.1–71.268.2
Ikoma lyssavirus (NC018629)69.7–69.851.9–52.369.3–69.650.9–51.265.4–65.662.9
Bokeloh bat lyssavirus (NC025251)75.0–75.266.0–66.378.264.4–64.574.1–74.272.3–72.4
Lleida bat lyssavirus (NC031955)69.2–69.550.8–50.970.4–70.951.266.263.2–63.3
Gannoruwa bat lyssavirus (NC031988)
75.5–75.7
62.8–63.1
75.4–75.7
63.7–64.3
73.5–73.6
71.5–71.6
*G, glycoprotein; L, RNA-dependent RNA polymerase; M, matrix protein; N, nucleoprotein; P, phosphoprotein.
Figure

Phylogenetic relationship of TWBLV (boldface), a putative new lyssavirus found in 2 Japanese pipistrelles (Pipistrellus abramus) in Taiwan in 2016 and 2017, compared with other lyssaviruses. Using the concatenated coding genes, we constructed the phylogenetic tree by using the maximum-likelihood method with the general time reversible plus invariant sites plus gamma 4 model. Numbers at the nodes indicate bootstrap confidence values (1,000 replicates) for the groups being composed of virus genes at the right of the nodes. GenBank accession numbers are provided for reference viruses. Scale bar indicates nucleotide substitutions per site. ABLV, Australia bat lyssavirus; ARAV, Aravan lyssavirus; BBLV, Bokeloh bat lyssavirus; DUVV, Duvenhage lyssavirus; EBLV-1, European bat lyssavirus type 1; EBLV-2, European bat lyssavirus type 2; IKOV, Ikoma lyssavirus; IRKV, Irkut lyssavirus; KHUV, Khujand lyssavirus; LBV, Lagos bat lyssavirus; LLEBV, Lleida bat lyssavirus; MOKV, Mokola lyssavirus; SHIBV, Shimoni bat lyssavirus; RABV, rabies lyssavirus; TWBLV, Taiwan bat lyssavirus; WCBV, West Caucasian bat lyssavirus.

Phylogenetic relationship of TWBLV (boldface), a putative new lyssavirus found in 2 Japanese pipistrelles (Pipistrellus abramus) in Taiwan in 2016 and 2017, compared with other lyssaviruses. Using the concatenated coding genes, we constructed the phylogenetic tree by using the maximum-likelihood method with the general time reversible plus invariant sites plus gamma 4 model. Numbers at the nodes indicate bootstrap confidence values (1,000 replicates) for the groups being composed of virus genes at the right of the nodes. GenBank accession numbers are provided for reference viruses. Scale bar indicates nucleotide substitutions per site. ABLV, Australia bat lyssavirus; ARAV, Aravan lyssavirus; BBLV, Bokeloh bat lyssavirus; DUVV, Duvenhage lyssavirus; EBLV-1, European bat lyssavirus type 1; EBLV-2, European bat lyssavirus type 2; IKOV, Ikoma lyssavirus; IRKV, Irkut lyssavirus; KHUV, Khujand lyssavirus; LBV, Lagos bat lyssavirus; LLEBV, Lleida bat lyssavirus; MOKV, Mokola lyssavirus; SHIBV, Shimoni bat lyssavirus; RABV, rabies lyssavirus; TWBLV, Taiwan bat lyssavirus; WCBV, West Caucasian bat lyssavirus.

Conclusions

We report a lyssavirus, TWBLV, that is closely related to EBLV-1, IRKV, and DUVV. The full-length nucleotide sequence of the concatenated coding genes of TWBLV showed 62.9%–75.1% nucleotide identities to the other 16 lyssaviruses (Table 2), and TWBLV was the most closely related to EBLV-1. The demarcation criteria of lyssavirus species, established by the International Committee on the Taxonomy of Viruses, include genetic distance, topology, antigenic patterns, and additional characteristics (). Based on genetic distance, no similarity to the other lyssavirus species of more than 75.1% nucleotide identities of the concatenated coding genes of TWBLVs suggested that the isolated TWBLV was a new lyssavirus species. The presence of TWBLV in the bats’ salivary glands suggested that TWBLV may be shed through saliva. The study showed that the bat in East Asia could be infected with lyssavirus; however, because of the limited surveillance, the epidemiology of lyssavirus in Japanese pipistrelle and other bat species is still unclear. This uncertainty is likely to raise a public health concern in countries in Asia. In conclusion, a lyssavirus, TWBLV, was identified in Japanese pipistrelle, and the infected bats may shed the virus through saliva. Japanese pipistrelle is a common insectivorous bat of low-altitude urban areas in East Asia (,). Persons in countries in Asia should be aware to seek proper prophylaxis immediately if bitten by a bat. Studies on the epidemiology and pathogenicity of TWBLV are necessary to further characterize the virus.
  9 in total

1.  Cryptic diversity in European bats.

Authors:  F Mayer; O von Helversen
Journal:  Proc Biol Sci       Date:  2001-09-07       Impact factor: 5.349

2.  A new phylogenetic lineage of rabies virus associated with western pipistrelle bats (Pipistrellus hesperus).

Authors:  Richard Franka; Denny G Constantine; Ivan Kuzmin; Andres Velasco-Villa; Serena A Reeder; Daniel Streicker; Lillian A Orciari; Anna J Wong; Jesse D Blanton; Charles E Rupprecht
Journal:  J Gen Virol       Date:  2006-08       Impact factor: 3.891

3.  Bat lyssaviruses (Aravan and Khujand) from Central Asia: phylogenetic relationships according to N, P and G gene sequences.

Authors:  Ivan V Kuzmin; Lillian A Orciari; Yohko T Arai; Jean S Smith; Cathleen A Hanlon; Yosuke Kameoka; Charles E Rupprecht
Journal:  Virus Res       Date:  2003-11       Impact factor: 3.303

4.  WHO Expert Consultation on Rabies. Second report.

Authors: 
Journal:  World Health Organ Tech Rep Ser       Date:  2013

5.  A universal real-time assay for the detection of Lyssaviruses.

Authors:  David T S Hayman; Ashley C Banyard; Philip R Wakeley; Graeme Harkess; Denise Marston; James L N Wood; Andrew A Cunningham; Anthony R Fooks
Journal:  J Virol Methods       Date:  2011-07-12       Impact factor: 2.014

6.  Lyssavirus in Indian Flying Foxes, Sri Lanka.

Authors:  Panduka S Gunawardena; Denise A Marston; Richard J Ellis; Emma L Wise; Anjana C Karawita; Andrew C Breed; Lorraine M McElhinney; Nicholas Johnson; Ashley C Banyard; Anthony R Fooks
Journal:  Emerg Infect Dis       Date:  2016-08       Impact factor: 6.883

7.  Novel lyssavirus in bat, Spain.

Authors:  Nidia Aréchiga Ceballos; Sonia Vázquez Morón; José M Berciano; Olga Nicolás; Carolina Aznar López; Javier Juste; Cristina Rodríguez Nevado; Alvaro Aguilar Setién; Juan E Echevarría
Journal:  Emerg Infect Dis       Date:  2013-05       Impact factor: 6.883

8.  Isolation of Irkut virus from a Murina leucogaster bat in China.

Authors:  Ye Liu; Shoufeng Zhang; Jinghui Zhao; Fei Zhang; Rongliang Hu
Journal:  PLoS Negl Trop Dis       Date:  2013-03-07

Review 9.  Lyssaviruses and bats: emergence and zoonotic threat.

Authors:  Ashley C Banyard; Jennifer S Evans; Ting Rong Luo; Anthony R Fooks
Journal:  Viruses       Date:  2014-08-04       Impact factor: 5.048

  9 in total
  17 in total

Review 1.  Revising the paradigm: Are bats really pathogen reservoirs or do they possess an efficient immune system?

Authors:  Maya Weinberg; Yossi Yovel
Journal:  iScience       Date:  2022-07-19

2.  Divergent Rabies Virus Variant of Probable Bat Origin in 2 Gray Foxes, New Mexico, USA.

Authors:  Rene E Condori; Adam Aragon; Mike Breckenridge; Kendra Pesko; Kerry Mower; Paul Ettestad; Sandra Melman; Andres Velasco-Villa; Lillian A Orciari; Pamela Yager; Daniel G Streicker; Crystal M Gigante; Clint Morgan; Ryan Wallace; Yu Li
Journal:  Emerg Infect Dis       Date:  2022-06       Impact factor: 16.126

3.  Additional Progress in the Development and Application of a Direct, Rapid Immunohistochemical Test for Rabies Diagnosis.

Authors:  Charles E Rupprecht; Zhiquan Xiang; Alexandre Servat; Richard Franka; Jordona Kirby; Hildegund C J Ertl
Journal:  Vet Sci       Date:  2018-06-20

4.  Comprehensive Analysis of Codon Usage on Rabies Virus and Other Lyssaviruses.

Authors:  Xu Zhang; Yuchen Cai; Xiaofeng Zhai; Jie Liu; Wen Zhao; Senlin Ji; Shuo Su; Jiyong Zhou
Journal:  Int J Mol Sci       Date:  2018-08-14       Impact factor: 5.923

Review 5.  Bats and Viruses: Emergence of Novel Lyssaviruses and Association of Bats with Viral Zoonoses in the EU.

Authors:  Rebecca Shipley; Edward Wright; David Selden; Guanghui Wu; James Aegerter; Anthony R Fooks; Ashley C Banyard
Journal:  Trop Med Infect Dis       Date:  2019-02-07

6.  Bat lyssavirus should be further monitored in Rondônia state, Brazil.

Authors:  Lifeng Zhao; Teng Chen; Faming Miao; Junfeng Li; Haijun Du; Jinghui Zhao
Journal:  Rev Soc Bras Med Trop       Date:  2020-04-22       Impact factor: 1.581

7.  Serological Survey of Lyssaviruses in Polish Bats in the Frame of Passive Rabies Surveillance Using an Enzyme-Linked Immunosorbent Assay.

Authors:  Anna Orłowska; Marcin Smreczak; Conrad Martin Freuling; Thomas Müller; Paweł Trębas; Jerzy Rola
Journal:  Viruses       Date:  2020-02-28       Impact factor: 5.048

8.  2020 taxonomic update for phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales.

Authors:  Jens H Kuhn; Scott Adkins; Daniela Alioto; Sergey V Alkhovsky; Gaya K Amarasinghe; Simon J Anthony; Tatjana Avšič-Županc; María A Ayllón; Justin Bahl; Anne Balkema-Buschmann; Matthew J Ballinger; Tomáš Bartonička; Christopher Basler; Sina Bavari; Martin Beer; Dennis A Bente; Éric Bergeron; Brian H Bird; Carol Blair; Kim R Blasdell; Steven B Bradfute; Rachel Breyta; Thomas Briese; Paul A Brown; Ursula J Buchholz; Michael J Buchmeier; Alexander Bukreyev; Felicity Burt; Nihal Buzkan; Charles H Calisher; Mengji Cao; Inmaculada Casas; John Chamberlain; Kartik Chandran; Rémi N Charrel; Biao Chen; Michela Chiumenti; Il-Ryong Choi; J Christopher S Clegg; Ian Crozier; John V da Graça; Elena Dal Bó; Alberto M R Dávila; Juan Carlos de la Torre; Xavier de Lamballerie; Rik L de Swart; Patrick L Di Bello; Nicholas Di Paola; Francesco Di Serio; Ralf G Dietzgen; Michele Digiaro; Valerian V Dolja; Olga Dolnik; Michael A Drebot; Jan Felix Drexler; Ralf Dürrwald; Lucie Dufkova; William G Dundon; W Paul Duprex; John M Dye; Andrew J Easton; Hideki Ebihara; Toufic Elbeaino; Koray Ergünay; Jorlan Fernandes; Anthony R Fooks; Pierre B H Formenty; Leonie F Forth; Ron A M Fouchier; Juliana Freitas-Astúa; Selma Gago-Zachert; George Fú Gāo; María Laura García; Adolfo García-Sastre; Aura R Garrison; Aiah Gbakima; Tracey Goldstein; Jean-Paul J Gonzalez; Anthony Griffiths; Martin H Groschup; Stephan Günther; Alexandro Guterres; Roy A Hall; John Hammond; Mohamed Hassan; Jussi Hepojoki; Satu Hepojoki; Udo Hetzel; Roger Hewson; Bernd Hoffmann; Seiji Hongo; Dirk Höper; Masayuki Horie; Holly R Hughes; Timothy H Hyndman; Amara Jambai; Rodrigo Jardim; Dàohóng Jiāng; Qi Jin; Gilda B Jonson; Sandra Junglen; Serpil Karadağ; Karen E Keller; Boris Klempa; Jonas Klingström; Gary Kobinger; Hideki Kondō; Eugene V Koonin; Mart Krupovic; Gael Kurath; Ivan V Kuzmin; Lies Laenen; Robert A Lamb; Amy J Lambert; Stanley L Langevin; Benhur Lee; Elba R S Lemos; Eric M Leroy; Dexin Li; Jiànróng Lǐ; Mifang Liang; Wénwén Liú; Yàn Liú; Igor S Lukashevich; Piet Maes; William Marciel de Souza; Marco Marklewitz; Sergio H Marshall; Giovanni P Martelli; Robert R Martin; Shin-Yi L Marzano; Sébastien Massart; John W McCauley; Nicole Mielke-Ehret; Angelantonio Minafra; Maria Minutolo; Ali Mirazimi; Hans-Peter Mühlbach; Elke Mühlberger; Rayapati Naidu; Tomohide Natsuaki; Beatriz Navarro; José A Navarro; Sergey V Netesov; Gabriele Neumann; Norbert Nowotny; Márcio R T Nunes; Are Nylund; Arnfinn L Økland; Renata C Oliveira; Gustavo Palacios; Vicente Pallas; Bernadett Pályi; Anna Papa; Colin R Parrish; Alex Pauvolid-Corrêa; Janusz T Pawęska; Susan Payne; Daniel R Pérez; Florian Pfaff; Sheli R Radoshitzky; Aziz-Ul Rahman; Pedro L Ramos-González; Renato O Resende; Carina A Reyes; Bertus K Rima; Víctor Romanowski; Gabriel Robles Luna; Paul Rota; Dennis Rubbenstroth; Jonathan A Runstadler; Daniel Ruzek; Sead Sabanadzovic; Jiří Salát; Amadou Alpha Sall; Maria S Salvato; Kamil Sarpkaya; Takahide Sasaya; Martin Schwemmle; Muhammad Z Shabbir; Xiǎohóng Shí; Zhènglì Shí; Yukio Shirako; Peter Simmonds; Jana Širmarová; Manuela Sironi; Sophie Smither; Teemu Smura; Jin-Won Song; Kirsten M Spann; Jessica R Spengler; Mark D Stenglein; David M Stone; Petra Straková; Ayato Takada; Robert B Tesh; Natalie J Thornburg; Keizō Tomonaga; Noël Tordo; Jonathan S Towner; Massimo Turina; Ioannis Tzanetakis; Rainer G Ulrich; Anna Maria Vaira; Bernadette van den Hoogen; Arvind Varsani; Nikos Vasilakis; Martin Verbeek; Victoria Wahl; Peter J Walker; Hui Wang; Jianwei Wang; Xifeng Wang; Lin-Fa Wang; Tàiyún Wèi; Heather Wells; Anna E Whitfield; John V Williams; Yuri I Wolf; Zhìqiáng Wú; Xin Yang; Xīnglóu Yáng; Xuejie Yu; Natalya Yutin; F Murilo Zerbini; Tong Zhang; Yong-Zhen Zhang; Guohui Zhou; Xueping Zhou
Journal:  Arch Virol       Date:  2020-09-04       Impact factor: 2.574

9.  Lyssavirus Vaccine with a Chimeric Glycoprotein Protects across Phylogroups.

Authors:  Christine R Fisher; David E Lowe; Todd G Smith; Yong Yang; Christina L Hutson; Christoph Wirblich; Gino Cingolani; Matthias J Schnell
Journal:  Cell Rep       Date:  2020-07-21       Impact factor: 9.423

Review 10.  Bat-borne viruses in Africa: a critical review.

Authors:  W Markotter; J Coertse; L De Vries; M Geldenhuys; M Mortlock
Journal:  J Zool (1987)       Date:  2020-02-18       Impact factor: 2.394

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.