Literature DB >> 29553069

Providencia in retail meats from Guangzhou, China and Osaka, Japan: prevalence, antimicrobial resistance and characterization of classes 1, 2 and 3 integrons.

Huiling DI1,2,3, Sisi Liang1, Qingyang Li1, Lei Shi2,4, Ayaka Shima3, Hecheng Meng1, He Yan1, Shinji Yamasaki3.   

Abstract

Bacteria of the genus Providencia are opportunistic pathogens of clinical significance due to their association with diarrhea and urinary tract infections. The present study was conducted to examine the prevalence and antimicrobial resistance of Providencia spp. in retail meats sold in Guangzhou, China and Osaka, Japan. Out of 158 meat samples including beef, pork and chicken, 67 Providencia (42%) belonging to four species viz., P. alcalifaciens, P. rustigianii, P. stuartii and P. rettgeri were isolated, and most of them were resistant to tetracycline (91%) followed by ampicillin (69%) and streptomycin (49%). Of 67 isolates, 29 (43%) were MDR, which is defined to be resistant to more than three classes of antimicrobials. No statistically significant differences were observed between Chinese and Japanese retail meat samples regarding contamination rate of Providencia spp. as well as frequency of the antimicrobial resistance of the isolates including MDR. Class 1 and/or class 2 integrons were detected in six of the eight isolates that were resistant to more than 4 antimicrobials, however none of the isolates harbored class 3 integron. A P. rustigianii harboring the blaOXA-10 gene was isolated, which is the first report of Providencia with blaOXA-10 gene of food origin. These data suggest that retail meats in China and Japan are substantially contaminated with Providencia spp., which displayed a high frequency of antimicrobial resistance, and establishing the surveillance of Providencia spp., especially antimicrobial resistant one, in retail meats is imperative.

Entities:  

Keywords:  Providencia; antimicrobial resistance; integron; retail meat

Mesh:

Substances:

Year:  2018        PMID: 29553069      PMCID: PMC5989031          DOI: 10.1292/jvms.18-0037

Source DB:  PubMed          Journal:  J Vet Med Sci        ISSN: 0916-7250            Impact factor:   1.267


The genus Providencia, which is a member of Enterobacteriaceae, presently includes nine species i.e. P. alcalifaciens, P. stuartii, P. rettgeri, P. rustigianii, P. heimbachae, P. vermicola, P. sneebia, P. burhodogranariea and P. thailandensis [24, 25, 39]. Among these, P. stuartii is the species most frequently attributed to urinary tract infections (UTI) in patients of advanced age [9]. P. alcalifaciens has been associated with diarrhea and gastroenteritis in children and travelers from developing countries [1, 2, 19, 20, 47]. Furthermore, three large outbreaks of food poisoning attributed to P. alcalifaciens were reported in Japan, the Czech Republic and Kenya [6, 29, 35]. In addition to P. alcalifaciens, P. rettgeri and P. heimbachae are also suggested to be etiological agents of diarrhea [28, 47]. The Chinese Centers for Disease Control also reported two outbreaks of food poisoning attributed to P. rettgeri [10, 48]. Although the increasing number of Providencia infections has attracted public attention, the contamination routes and prevalence of Providencia spp. in foods have not yet been thoroughly investigated. Multiple drug-resistant (MDR) Providencia spp., especially integron-mediated MDR, are frequently detected [16, 27]. The emergence of antimicrobial resistant pathogenic bacteria, caused by antimicrobial overuse as a result of inappropriate disease treatment and growth promotion in domestic livestock, has become a significant public health threat [18, 41, 45]. It is well known that integrons, located on plasmids, transposons, or other mobile genetic elements, with the help of integrase contribute to the dissemination of antimicrobial resistance in the environment and in humans [21, 32]. Three classes of integrons, including classes 1, 2 and 3 integrons, have been reported to be associated with MDR and the dissemination of resistance genes [5, 17, 30, 32]. Some studies have shown that many of the pathogens isolated from meats or other foods are resistant to clinically important antimicrobials [43]. Thus, consumption of meats contaminated with antimicrobial resistant Providencia strains may not only cause infection but also serve a source for the dissemination of antimicrobial resistant genes in humans, which could have a serious impact on consequent antimicrobial therapy. In this study, therefore, we conducted a survey regarding the prevalence of Providencia spp. in retail meats in a developing country, China, and a developed country, Japan, and examined the antimicrobial susceptibility and prevalence of classes 1, 2 and 3 integrons in MDR isolates.

MATERIALS AND METHODS

Sample collection

Raw meat samples (85 from Guangzhou, China, including 25 beef, 29 pork and 31 chicken and 73 from Osaka, Japan, including 23 beef, 25 pork and 25 chicken) were purchased from retail markets during 2012–2013. The meat samples were aseptically collected and transported to the laboratory in an icebox, and then used immediately for bacterial isolation.

Bacterial isolation and determination

Each sample (25 g) was placed into a sterile lateral bag containing 25 ml of sterilized PBS and homogenized for 1 min using a stomacher. Then, 1 ml of the homogenate was mixed with 4 ml of 1.25 × trypticase soy broth (TSB; Huankai Ltd., Guangzhou, China) and incubated in a shaker incubator overnight at 37°C. One loopful of the overnight culture was streaked onto selective polymyxin-mannitol-xylitol medium (PMXMP; containing Lab Lemco powder, sodium deoxycholate, anhydrous disodium hydrogen phosphate, phenol red dye, maltose, and xylose with polymyxin B sulfate) [47]. Presumptive Providencia colonies (red to pink on PMXMP medium) were streaked onto Luria-Bertani [2] agar and incubated overnight at 37°C. To identify the Providencia-positive isolates at the species level, the API 20E (a biochemical strip for Enterobacteriaceae; SYSMEX bioMérieux Co., Ltd., Tokyo, Japan) as well as the oxidase, adonitol and galactose utility tests were performed as previously described [34, 37, 47].

Antimicrobial susceptibility test

Antimicrobial susceptibility was determined by the disk diffusion method using 13 antimicrobial discs according to the 2012 Clinical and Laboratory Standards Institute (CLSI) guidelines. The following antimicrobial discs (Nissui Pharmaceutical Co., Ltd., Tokyo, Japan), corresponding to the drugs most commonly used for the treatment of infectious diseases caused by Gram-negative bacteria, were included in the experiment: tetracycline (TET) 30 µg, ampicillin (AMP) 10 µg, ceftazidime (CAZ) 30 µg, cefoxitin (CFX) 30 µg, imipenem (IPM) 10 µg, streptomycin (STR) 10 µg, gentamicin (GEN) 30 µg, kanamycin (KAN) 30 µg, nalidixic acid (NA) 30 µg, norfloxacin (NFLX) 10 µg, sulfamethoxazole-trimethoprim (SXT) 25 µg, chloramphenicol (CM) 30 µg, and fosfomycin (FOM) 50 µg. Escherichia coli ATCC 25922 was used as a quality control. All experiments were conducted and results were interpreted according to the CLSI guidelines.

Detection and characterization of classes 1, 2 and 3 integrons in MDR Providencia spp.

Based on the antimicrobial resistance profile of the isolates, eight MDR Providencia spp. isolates that were resistant to at least four antimicrobials were selected for further analysis of the presence of classes 1, 2 and 3 integrons by PCR using previously described primers and protocols (Table 1). Genomic DNA was extracted from the isolates with the TIANamp Genomic DNA Kit (Tiangen, Beijing, China). E. coli K-12 DH1 strains containing pR388 [7], pVC2554 [8], or pSMB731 [3], which respectively carrying class 1, 2 or 3 integron, were used as positive controls. Plasmid DNA was extracted from the control strains using the QIAGEN Plasmid Mini Kit (Qiagen) according to the manufacturer’s instructions, and quantified by 1% agarose gel electrophoresis in 0.5 × TAE buffer (45 min, 100 V).
Table 1.

Sequences and properties of the PCR primers used in this study

Name of primerSequence (5′-3′)Target geneAmplicon size (bp)Annealing temp (°C)Reference
INT-1UGTTCGGTCAAGGTTCTGintI192350 [36]
INT-1DGCCAACTTTCAGCACATG
INT-2UATGTCTAACAGTCCATTTTintI245050 [13]
INT-2DAAATCTTTAACCCGCAAAC
INT-3UATCTGCCAAACCTGACTGintI392155 [15]
INT-3DCGAATGCCCCAACAACTC
qacEΔ1-FATCGCAATAGTTGGCGAAGTqacEΔ1+sul1 (3′-CS of class 1 integron)80056 [12]
sul1-BGCAAGGCGGAAACCCGCGCC
in-FGGCATCCAAGCAGCAAGCClass 1 integron variable regionVariable52 [12]
in-BAAGCAGACTTGACCTGAT
Hep 74CGGGATCCCGGACGGCATGCACGATTTGTAClass 2 integron variable regionVariable58 [44]
Hep 51GATGCCATCGCAAGTACGAG
All PCR products were purified and sequenced by Invitrogen Biotechnology Co., Ltd. (Shanghai, China). The initial sequenced primers was the same to which were used for PCR listed in Table 1. In case the sequence was not completed, particularly variable regions of class 1/2 integron, a primer walking method was employed until sequencing was completed. The obtained sequences were analyzed by a BLAST search of the GenBank database at the National Center for Biotechnology Information via the BLAST network service (http://www.ncbi.nlm.nih.gov/).

RESULTS

Prevalence of Providencia in retail meats from China and Japan

Of the 73 retail meats purchased in Japan, 28 Providencia strains, belonging to four species, P. alcalifaciens, P. rustigianii, P. stuartii, and P. rettgeri, were isolated with an overall prevalence rate of 38% (Table 2). P. alcalifaciens was the most dominant species in beef and chicken samples. The other three species, P. rettgeri (2.7%), P. stuartii (4.1%) and P. rustigianii (2.7%) were detected in only two meats such as pork and beef or chicken at much lower rates. However, one strain isolated from chicken was not able to be identified species but the result of API 20E showed P. alcalifaciens or P. rustigianii because it was positive for both adonitol and galactose utility test.
Table 2.

Prevalence of Providencia spp. in retail meats in Guangzhou, China and Osaka, Japan

Species a)Percentage of contamination (nb))
China
Japan
Total (158)
Beef (25)Pork (29)Chicken (31)Subtotal (85)Beef (23)Pork (25)Chicken (25)Subtotal (73)
P. alca44.0 (11d))55.0 (16)16.0 (5)38.0 (32d))35.0 (8)0.048.0 (12)27.0 (20)33.0 (52)
P. ret0.00.00.00.04.3 (1)4.0 (1)0.02.7 (2)1.3 (2)
P. stu4.0 (1d))3.4 (1)3.2 (1)3.5 (3d))0.04.0 (1)8.0 (2)4.1 (3)3.8 (6)
P. rus4.0 (1)6.9 (2)3.2 (1)4.7 (4)0.04.0 (1)4.0 (1)2.7 (2)3.8 (6)
P. spp.0.00.00.00.00.00.04.0 (1c))1.4 (1c))0.6 (1c))

Total48.0 (13d))66.0 (19)23.0 (7)45.0 (39d))39.0 (9)12.0 (3)64.0 (16)38.0 (28)42.0 (67d))

a) P. alca, P. alcalifaciens; P. ret, P. rettgeri; P. stu, P. stuartii; P. rus, P. rustigianii. b) No. of positive isolates. c) API 20E indicated that this strain was P. alcalifaciesns or P. rustiganii but was positive for both adonitol and galactose utility test. d) Two species were isolated from one beef sample.

a) P. alca, P. alcalifaciens; P. ret, P. rettgeri; P. stu, P. stuartii; P. rus, P. rustigianii. b) No. of positive isolates. c) API 20E indicated that this strain was P. alcalifaciesns or P. rustiganii but was positive for both adonitol and galactose utility test. d) Two species were isolated from one beef sample. On the other hand, of the 85 retail meats purchased in China, 39 Providencia strains belonging to three species, P. alcalifaciens, P. rustigianii, and P. stuartii, were isolated from 38 retail meats with slightly higher prevalence (45%) compared to that in Japanese meats. P. alcalifaciens was also the most prevalent species in all three tested meats, followed by P. rustigianii (4.7%) and P. stuartii (3.5%), which were also detected in all three meats. However, P. rettgeri was not detected in any meat samples in China. One Chinese beef sample was contaminated with both P. alcalifaciens and P. stuartii. P. alcalifaciens, P. rustigianii and P. stuartii were detected in all three tested meats, and P. rettgeri was the least prevalent species which was isolated from only one beef and one pork sample purchased in Japan. Providencia-positive rate for pork samples in China was significantly higher than that in Japan (P<0.01, χ2-test), whereas the positive rate for chicken samples in Japan was higher than that in China (P<0.01, χ2-test). In the beef, the Providencia contamination rate was slightly higher in Chinese samples but there was no significant difference (P>0.05, χ2-test).

Antimicrobial susceptibility

The 67 Providencia strains were characterized by antimicrobial susceptibility to 13 antimicrobials belonging to seven families (Table 3). Of 28 Providencia strains isolated from retail meats purchased in Osaka, Japan, 26 (93%) exhibited resistance to at least one antimicrobial (Table 4A). Antimicrobial with the highest resistant frequencies was tetracycline (82%), followed by streptomycin (61%) and ampicillin (54%). Resistance was also observed, albeit to a much lesser extent, to fosfomycin (14%), chloramphenicol (7.1%), kanamycin (3.6%) and sulfamethoxazole-trimethoprim (3.6%) as shown in Table 3.
Table 3.

Antimicrobial resistance of Providencia isolates obtained from retail meats in Guangzhou, China and Osaka, Japan

Antimicrobials tested a)Percentage of resistant (No. of resistant isolates)
Chinese isolates
Japanese isolates
Total (67)
Beef (13)Chicken (7)Pork (19)Subtotal (39)Beef (9)Chicken (16)Pork (3)Subtotal (28)
Tetracycline (TET)92.0 (12)100.0 (7)100.0 (9)97.0 (8)89.0 (8)81.0 (1)67.0 (2)82.0 (23)91.0 (61)
β-Lactams
AMP62.0 (8)71.0 (5)95.0 (18)80.0 (31)44.0 (4)63.0 (10)33.0 (1)54.0 (15)69.0 (46)
CAZ000000000
CFX000000000
IPM000000000
Aminoglycosides
STR46.0 (6)57.0 (4)32.0 (6)41.0 (16)56.0 (5)69.0 (11)33.0 (1)61.0 (17)49.0 (33)
KAN0.8 (1)002.6 (1)11.0 (1)003.6 (1)3.0 (2)
GEN000000000
Quinolones
NA0.8 (1)14.0 (1)05.1 (2)00003.0 (2)
NFLX000000000
Sulfamide (SXT)0.8 (1)14.0 (1)5.3 (1)7.7 (3)11.0 (1)003.6 (1)6.0 (4)
Phenicol (CM)0.8 (1)14.0 (1)5.3 (1)7.7 (3)13.0 (2)07.1 (2)7.5 (5
Other (FOM)029.0 (2)05.1 (2)11.0 (1)13.0 (2)33.0 (1)14.0 (4)9.0 (6)

a) TET, tetracycline; AMP, ampicillin; CAZ, ceftazidime; CFX, cefoxitin; IPM, imipenem; STR, streptomycin; KAN, kanamycin; GEN, gentamicin; NA, nalidixic acid; NFLX, norfloxacin; SXT, sulfamethoxazole-trimethoprim; CM, chloramphenicol; FOM, fosfomycin.

Table 4.

Percentage of Providencia isolates exhibiting antimicrobial and multi-drug resistances: (A) in country-based; (B) in meat-based

Category(A) Country
(B) Meat
China (39)Japan (28)Total (67)Beef (22)Pork (22)Chicken (23)Total (67)
Percentage of antimicrobial resistant isolates (na))97.0 (38)93.0 (26)96.0 (64)91.0 (20)96.0 (21)96.0 (22)96.0 (64)
Percentage of MDR isolates (na))R3b)33.0 (13)32.0 (9)33.0 (22)32.0 (7)32.0 (7)35.0 (8)33.0 (22)
R4b)2.6 (1)3.6 (1)3.0 (2)4.5 (1)4.5 (1)0.03.0 (2)
R5b)7.7 (3)7.1 (2)7.5 (5)4.5 (1)0.017.0 (4)7.5 (5)
Total44.0 (17)43.0 (12)43.0 (29)41.0 (9)36.0 (8)52.0 (12)43.0 (29)

a) Number of samples analyzed. b) R3 to R5 resist to 3 to 5 different classes of antimicrobials, respectively.

a) TET, tetracycline; AMP, ampicillin; CAZ, ceftazidime; CFX, cefoxitin; IPM, imipenem; STR, streptomycin; KAN, kanamycin; GEN, gentamicin; NA, nalidixic acid; NFLX, norfloxacin; SXT, sulfamethoxazole-trimethoprim; CM, chloramphenicol; FOM, fosfomycin. a) Number of samples analyzed. b) R3 to R5 resist to 3 to 5 different classes of antimicrobials, respectively. On the other hand, of 39 Providencia strains isolated from retail meats purchased in Guangzhou, China, 38 (97%) were resistant to at least one tested antimicrobial (Table 4A). Of these resistant isolates, 97% were resistant to tetracycline, followed by ampicillin (80%) and streptomycin (41%). The resistant rates to other antimicrobials were much lower e.g. chloramphenicol (7.7%), sulfamethoxazole-trimethoprim (7.7%), fosfomycin (5.1%), nalidixic acid (5.1%) and kanamycin (2.6%) as shown in Table 3. The resistant rates to both tetracycline (P<0.05, χ2-test) and ampicillin (P<0.01, χ2-test) among isolates recovered from China were significantly higher than those of Japan. However, any Providencia isolated in this study did not show resistance to ceftazidime, cefoxitin, imipenem, gentamicin and norfloxacin (Table 3). Twenty-nine MDR strains (29/67, 43%), which exhibited resistance to more than three classes of antimicrobials, were obtained (Table 4A). There was no significant difference between Japanese and Chinese strains in terms of the frequency of MDR (P>0.05, χ2-test). From the viewpoint of meat source, the highest frequency of MDR was observed in isolates from chicken (52%), followed by beef (41%) and pork (36%); however, this difference was not statistically significant (P>0.05, χ2-test; Table 4B).

Prevalence and characterization of classes 1, 2 and 3 integrons in MDR Providencia spp.

Eight MDR strains that showed resistance to at least four antimicrobials were screened for the presence of intI1, intI2 and intI3 genes, and examined antimicrobial resistant gene cassettes. The PCR results revealed that six of the eight tested strains were intI1 gene-positive, and of these, only three harbored the classic qacEΔ-sul1 region as shown in Table 5. Class 1 integron gene cassette was amplified from only strains JA-b-9 (P. rettgeri) and CH-b-11 (P. rustigianii), which were subsequently confirmed to contain dfrA12-aadA2 (trimethoprim and streptomycin resistances) and aadB-cat-blaOXA-10-aadA genes (kanamycin, chloramphenicol, β-lactams and streptomycin resistances), respectively.
Table 5.

Characterization of integrons identified in MDR Providencia species (resistant to ≥4 kinds of antimicrobials) isolated from retail meats obtained in Guangzhou, China and Osaka, Japan

MDR isolates
Resistant phenotypeb)Integron regions
Speciesa)StrainsintI geneqacEΔ1-sul1c)Gene cassette arrayd)
P. rusCH-b-11TET-STR-KAN-NA-SXT-CM1,2+aadB-cat-blaOXA10-aadA1, dfrA1-sat1-aad1
P. alcaCH-c-71TET-AMP-STR-NA-SXT-FOM1,2-dfrI-sat2-aadA1
CH-c-09TET-AMP-STR-CM-FOM--ND
CH-p-45TET-AMP-STR-SXT1,2-ND
JA-b-5TET-AMP-STR-FOM--ND
P. retJA-b-9TET-STR-KAN-SXT1+dfrA12- aadA2
P. stuJA-c-39TET-AMP-STR-CM-FOM1+ND
JA-c-49TET-AMP-STR-CM-FOM1-ND

a) P. rus, P. rustigianii; P. alca, P. alcalifaciens; P. ret, P. rettgeri; P. stu, P. stuartii. b) TET, tetracycline; STR, streptomycin; KAN, kanamicin; NA, nalidixic acid; SXT, sulfamethoxazole-trimethoprim; CM, chloramphenicol; AMP, ampicillin; FOM, fosfomycin. c) +, qacEΔ1-sul1 positive; -, qacEΔ1-sul1 negative. d) Gene cassettes harbored by class 2 integron are underlined. ND: not detected.

a) P. rus, P. rustigianii; P. alca, P. alcalifaciens; P. ret, P. rettgeri; P. stu, P. stuartii. b) TET, tetracycline; STR, streptomycin; KAN, kanamicin; NA, nalidixic acid; SXT, sulfamethoxazole-trimethoprim; CM, chloramphenicol; AMP, ampicillin; FOM, fosfomycin. c) +, qacEΔ1-sul1 positive; -, qacEΔ1-sul1 negative. d) Gene cassettes harbored by class 2 integron are underlined. ND: not detected. Class 2 integron was also detected in three of the six intI1gene-positive Providencia strains, which were all isolated from Chinese samples. Variable regions, containing a similar set of antimicrobial resistant genes, i.e., dfrA1-sat1-aad1 and dfrI-sat2-aadA1, were detected in P. rustigianii and P. alcalifaciens strains (CH-b-11 and CH-c-71, respectively). However, no class 3 integron was detected in any Providencia strains analyzed in this study (Table 5).

DISCUSSION

Since isolation of Providencia and its association with diarrhea and UTI have been increasingly reported in developing and developed countries [2, 6, 7, 9,10,11, 19, 20, 23, 27, 29, 35, 37, 38, 42, 47, 48], in this study we therefore examined the prevalence of Providencia in retail meats purchased from markets in Guangzhou, China and Osaka, Japan. Our results indicate that retail meats in both China and Japan were substantially contaminated with Providencia spp., especially P. alcalifaciens, and Providencia contamination rate of retail meats purchased in China (45%) was higher than that in Japan (38%). On the other hand, the Providencia contamination rate in same kind of meats sold in Thailand was much higher (68%) [39] than that in China and Japan. These findings may indicate why diarrhea attributed to Providencia is more common in developing countries and travelers from developing countries [20, 33, 38, 47]. However, another study showed a significantly lower Providencia contamination rate in retail foods purchased in Guangzhou, China (2.9%) [46]. One possible reason for this difference is the selective media used for each study. For example, our study used selective medium for Providencia while their study used selective medium for Enterobacteriaceae. Alternatively, the different rates could be due to samples analyzed. Our study analyzed retail meats only but their study analyzed not only retail meats but also other food samples such as vegetables, aquatic products, frozen foods and so on. One more thing, which we have to discuss the result of this study, is the high prevalence rate of Providencia in Japanese beef. In slaughterhouse in Japan the strict regulation such as HACCP has been introduced. Thus, the contamination of the fecal bacteria must be very less. At this moment, however, we have no idea why the contamination rate of Providencia was so high in beef in Japan. One possible explanation would be cross contamination of Providencia to beef from other souses such as pork and chicken in the backyard of the supermarket. Further studies are required to understand the real situation of contamination rate of beef in Japanese. P. alcalifaciens, P. rettgeri, P. rustigianii, and P. stuartii were isolated from meat samples in both this study and study in Thailand [38]. The fact that P. alcalifaciens, P. rettgeri, and P. stuartii were isolated from both patients with diarrhea/urinary tract infections and meat samples suggests that food animals, and in particular their meat, might be an important source of Providencia transmission to humans. Further studies are required regarding prevalence of Providencia in the environment, food animals, pet animals and so on. In this study, we also examined antimicrobial susceptibility of the Providencia strains isolated from retail meats purchased in China and Japan. Our findings are similar to a previous report from Nigeria [1], showing that Providencia isolates in farm animals are commonly resistant to multiple antimicrobials including tetracycline, ampicillin, and streptomycin. On the other hand, the frequency of MDR was not statistically significant among Providencia strains isolated between China and Japan. Since usage of antimicrobials in veterinary settings must be different between China and Japan, there is no explanation why there was no significant different between these two countries. Although 43% (29/67) of the Providencia strains were MDR, it is reassuring that all the Providencia strains were susceptible to clinically important antimicrobials such as norfloxacin, imipenem, cefoxitin and ceftazidime. However, detection of resistance to sulfamethoxazole-trimethoprim, fosfomycin, and nalidixic acid is alarming because these antimicrobials are also important for the treatment of urinary tract infections and diarrhea. Therefore, rational use of antimicrobial agents should be emphasized in both veterinary and medical settings. Although our results cannot be used to ascribe the presence of resistance phenotypes to antimicrobials used in livestock, it does provide support for the idea that foods of animal origin are a potential source of antimicrobial resistant human pathogens [4, 14, 44]. Since integrons are often associated with MDR, we also examined the presence of integrons in MDR Providencia isolated in this study. Class 1 and/or class 2 integrons were detected in six of eight MDR Providencia strains with resistance to ≥4 antimicrobial agents. This finding supports the idea that class 1 and/or class 2 integrons present in MDR bacteria from meat samples most probably contaminated from food-producing livestock are a possible reservoir for the dissemination of resistance genes in the environment or in humans [5, 17, 40]. In particular, it should be noted that classes 1 and 2 integrons were detected in one MDR P. rustigianii isolated from a Chinese meat sample, which was also reported in another study that examined prevalence of Providencia spp. in animal feces [1, 26]. Machado et al. [26] suggested that various recombinational events may occur in these genetic platforms. However, additional detail investigations are necessary to support this hypothesis. Extended spectrum β-lactamases (ESBL), which can degrade a variety of β-lactamases, is also one of the most important antimicrobial resistances in clinical settings. blaOXA-10 is one of the genes encoding β-lactamases. blaOXA-10 has been so far detected in only clinical Providencia strains such as P. rettgeri (Guangzhou, China, GenBank accession no. KJ488989.1), P. rettgeri (Nigeria, GenBank accession no. GU056843.2) and P. stuartii (Tunisian Burn Unit, GenBank accession no. JN193567.1). In this study, blaOXA-10 gene was detected in Providencia spp. isolated from a retail meat sample. This is the first report, to the best of our knowledge, regarding isolation of Providencia spp. a carrying blaOXA-10 gene from meats. The blaOXA-10 gene encodes β-lactamases with a serine residue as an active site belonging to class D β-lactamases, which was found in a variety of Gram-negative bacteria, especially Pseudomonas aeruginosa [31]. The OXA-10 β-lactamase has a narrow spectrum that can hydrolyze cephalosporins, cefotaxime, ceftriaxone, and aztreonam at low levels but not ceftazidime, cephamycins, and carbapenems [22]. Likewise, in this study, a P. rustigianii strain (CH-b-11) harboring blaOXA-10 was susceptible to all four tested β-lactam antibiotics (Table 2). However, the importance of this β-lactamase-integron-carrying organism should not be neglected, as mutant derivatives of OXA-10, such as OXA-11, OXA-13, OXA-16, OXA-28, OXA-35 and OXA-74, possess increased activities toward expanded-spectrum cephalosporins [31]. In summary, this is the first report focusing on the prevalence and antimicrobial resistance of Providencia spp. in retail raw meats in China and Japan. Our results showed that retail meats in both China and Japan are substantially contaminated with Providencia spp., especially P. alcalifaciens, which displayed a high frequency of antimicrobial resistance. In addition, class 1 and/or 2 integrons were also associated with MDR in Providencia spp. These data suggest that meats may be a potential source of Providencia for human infections, which highlights the importance of Providencia spp. in retail meats as a reservoir for antimicrobial resistance genes. Although we detected only a small number of Providencia isolates, our data suggested that establishing a surveillance program for resistant Providencia spp. in retail meat is imperative, as well as supervision for prudent use of antimicrobials in food animals to prevent the dissemination of MDR Providencia spp. among animals and humans.
  45 in total

1.  Preclinical class 1 integron with a complete Tn402-like transposition module.

Authors:  Ammara Sajjad; Marita P Holley; Maurizio Labbate; H W Stokes; Michael R Gillings
Journal:  Appl Environ Microbiol       Date:  2010-10-29       Impact factor: 4.792

2.  Emergence of β-lactamases OXA-10, VEB-1 and CMY in Providencia spp. from Nigeria.

Authors:  Ibukun E Aibinu; Yvonne Pfeifer; Folashade Ogunsola; Tolu Odugbemi; Wolfgang Koenig; Beniam Ghebremedhin
Journal:  J Antimicrob Chemother       Date:  2011-05-24       Impact factor: 5.790

3.  Isolation of Providencia heimbachae from human feces.

Authors:  C Mohr O'Hara; A G Steigerwalt; D Green; M McDowell; B C Hill; D J Brenner; J M Miller
Journal:  J Clin Microbiol       Date:  1999-09       Impact factor: 5.948

4.  Prevalence of Providencia Strains among Patients with Diarrhea and in Retail Meats in Thailand.

Authors:  Ayaka Shima; Atsushi Hinenoya; Worada Samosornsuk; Seksun Samosornsuk; Narissara Mungkornkaew; Shinji Yamasaki
Journal:  Jpn J Infect Dis       Date:  2015-09-11       Impact factor: 1.362

5.  A large outbreak of foodborne infection attributed to Providencia alcalifaciens.

Authors:  T Murata; T Iida; Y Shiomi; K Tagomori; Y Akeda; I Yanagihara; S Mushiake; F Ishiguro; T Honda
Journal:  J Infect Dis       Date:  2001-08-29       Impact factor: 5.226

6.  Ceftriaxone-resistant salmonella infection acquired by a child from cattle.

Authors:  P D Fey; T J Safranek; M E Rupp; E F Dunne; E Ribot; P C Iwen; P A Bradford; F J Angulo; S H Hinrichs
Journal:  N Engl J Med       Date:  2000-04-27       Impact factor: 91.245

7.  A novel integron-like element carrying the metallo-beta-lactamase gene blaIMP.

Authors:  Y Arakawa; M Murakami; K Suzuki; H Ito; R Wacharotayankun; S Ohsuka; N Kato; M Ohta
Journal:  Antimicrob Agents Chemother       Date:  1995-07       Impact factor: 5.191

8.  Integron-containing bacteria in faeces of cattle from different production systems at slaughter.

Authors:  R S Barlow; N Fegan; K S Gobius
Journal:  J Appl Microbiol       Date:  2009-03-19       Impact factor: 3.772

9.  IncP-1ε Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes.

Authors:  Holger Heuer; Chu T T Binh; Sven Jechalke; Christoph Kopmann; Ute Zimmerling; Ellen Krögerrecklenfort; Thomas Ledger; Bernardo González; Eva Top; Kornelia Smalla
Journal:  Front Microbiol       Date:  2012-01-18       Impact factor: 5.640

10.  Integron involvement in environmental spread of antibiotic resistance.

Authors:  Thibault Stalder; Olivier Barraud; Magali Casellas; Christophe Dagot; Marie-Cécile Ploy
Journal:  Front Microbiol       Date:  2012-04-09       Impact factor: 5.640

View more
  5 in total

1.  Isolation and Molecular Identification and Antimicrobial Susceptibility of Providencia spp. from Raw Cow's Milk in Baghdad, Iraq.

Authors:  Nagham Mohammed Ayyal Al-Gburi
Journal:  Vet Med Int       Date:  2020-11-19

Review 2.  Epidemiology and Pathogenesis of Providencia alcalifaciens Infections.

Authors:  Mohammad Monir Shah; Erick Odoyo; Yoshio Ichinose
Journal:  Am J Trop Med Hyg       Date:  2019-08       Impact factor: 2.345

3.  Occurrence of blaNDM-1-Positive Providencia spp. in a Pig Farm of China.

Authors:  Wenxin Chen; Zhihong Liu; Hongguang Lin; Jie Yang; Ting Liu; Jiaomei Zheng; Xueming Long; Zhiliang Sun; Jiyun Li; Xiaojun Chen
Journal:  Antibiotics (Basel)       Date:  2022-05-25

4.  Providencia heimbachae Associated with Post-weaning Diarrhea in Piglets: Identification, Phenotype, and Pathogenesis.

Authors:  Zhuo Zhang; Lili Zhao; Manman Song; Jilong Luo; Hanghang Liu; Kun Xue; Chengshi Huang; Hongyan Chen; Junwei Ge
Journal:  Curr Microbiol       Date:  2021-12-04       Impact factor: 2.188

5.  Designing a Novel Peptide-Based Multi-Epitope Vaccine to Evoke a Robust Immune Response against Pathogenic Multidrug-Resistant Providencia heimbachae.

Authors:  Muhammad Naveed; Mohsin Sheraz; Aatif Amin; Muhammad Waseem; Tariq Aziz; Ayaz Ali Khan; Mustajab Ghani; Muhammad Shahzad; Mashael W Alruways; Anas S Dablool; Ahmed M Elazzazy; Abdulraheem Ali Almalki; Abdulhakeem S Alamri; Majid Alhomrani
Journal:  Vaccines (Basel)       Date:  2022-08-11
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.