Literature DB >> 29550352

Rapid detection of transmissible gastroenteritis virus in swine small intestine samples using real-time reverse transcription recombinase polymerase amplification.

Jinfeng Wang1, Jianchang Wang1, Ruoxi Zhang2, Libing Liu1, Ruihan Shi1, Qingan Han2, Wanzhe Yuan3.   

Abstract

A rapid and specific real-time reverse-transcription recombinase polymerase amplification assay (RT-RPA) was developed to detect the transmissible gastroenteritis virus (TGEV) in this study. The primers and exo probe were designed to be specific for a portion of spike (S) gene conserved in TGEV, but absent in the closely related porcine respiratory coronavirus (PRCV). The amplification was performed at 40 °C for 20 min. The assay could only detect the TGEV, and there was no cross-reaction with other pathogens tested. Using the in vitro transcribed TGEV RNA as template, the limit of detection of the developed RT-RPA was 100 copies per reaction. The assay performance was evaluated by testing 76 clinical samples by RT-RPA and a real-time RT-PCR. Fourteen samples were TGEV RNA positive in RT-RPA (18.4%, 14/76), which were also positive in the real-time RT-PCR. The diagnostic agreement between the two assays was 100% (76/76). The R2 value of RT-RPA and real-time RT-PCR was 0.959 by linear regression analysis. The developed RT-RPA assay provides a useful alternative tool for rapid, simple and reliable detection of TGEV in resource-limited diagnostic laboratories and on-site facilities.
Copyright © 2018 Elsevier B.V. All rights reserved.

Entities:  

Keywords:  Exo probe; RT-RPA; S gene; TGEV

Mesh:

Year:  2018        PMID: 29550352      PMCID: PMC7113865          DOI: 10.1016/j.jviromet.2018.03.005

Source DB:  PubMed          Journal:  J Virol Methods        ISSN: 0166-0934            Impact factor:   2.014


Transmissible gastroenteritis (TGE) is an acute enteric viral disease of pigs resulting in vomiting and diarrhea in all ages of pigs and with high mortality rate in piglets (Garwes, 1988). The disease is caused by TGE virus (TGEV), which is an enveloped, single-stranded, positive-sense RNA virus belonging to the genus Alphacoronavirus of the family Coronaviridae (Saif and Wesley, 1999). TGE was first reported in 1933 in the United States, and TGEV was first isolated and identified in 1946 (Doyle and Hutchings, 1946). Since then, TGEV has spread throughout the world including America, Europe and Asia, and has caused significant economic loss in the pig industry (Kim et al., 2000a; Stevenson et al., 2013). Since the mid 1980s, a variant respiratory form of the TGEV known as porcine respiratory coronavirus (PRCV) has become common in pigs (Laude et al., 1993). Compared to TGEV, PRCV has a deletion of between 672 and 681 nucleotides near the 5′ end of the spike (S) gene (Laude et al., 1993). Although PRCV replicates predominantly in the respiratory tract, some pigs infected with PRCV could also shed the virus in their feces (Costantini et al., 2004; Saif and Wesley, 1999). Therefore, any diagnostic assay for TGEV should be able to differentiate it from PRCV. Rapid and specific detection of TGEV would be extremely important in the prevention and control of TGE. The conventional methods for detection of TGEV are time-consuming, laborious, and requiring well-trained technicians, such as virus isolation, immunofluorescence assay, electron microscopy and ELISA (Carman et al., 2002; Dulac et al., 1977; van Nieuwstadt et al., 1988). A series of developed RT-PCR assays for PEDV require the high-precision, sophisticated and expensive instruments, well-trained technicians and good laboratory circumstance, thus unsuitable for being applied in under-equipped laboratories and on-site applications, such as RT-PCR (Paton et al., 1997), nanoparticle-assisted RT-PCR (Zhu et al., 2017) and real-time RT-PCR (Vemulapalli et al., 2009). Recently, RT-LAMP assays have been developed for TGEV detection (Chen et al., 2010; Li and Ren, 2011). Six primers were needed in the RT-LAMP assays for TGEV, the reaction time was 30 or 60 min, and the results were visualized by agarose gel electrophoresis (Chen et al., 2010; Li and Ren, 2011). Recombinase polymerase amplification (RPA) is an isothermal gene amplification technique that has been demonstrated to be a rapid, specific, sensitive, and cost-effective molecular diagnostic method (Daher et al., 2016; Piepenburg et al., 2006). RPA employs three core enzymes: a recombinase, a single-stranded DNA-binding protein (SSB) and a strand-displacing polymerase. The recombinase forms a nucleoprotein filament with primers and probes. This filament scans the double-stranded DNA (dsDNA) target searching for homologous sequences and invades the dsDNA once homology is found. Then a D-loop structure is formed, which is a local separation of DNA strands in which the complementary strand is stabilized by SSB and the target strand is hybridized with primer. Recombinase disassembly from the nucleoprotein filament, the strand-displacing DNA polymerase adds bases to the 3′-end of the primer and extension occurs (Daher et al., 2016; Piepenburg et al., 2006). Real time detection of RPA amplicons could be performed through adding exonuclease III and exo probes to the reaction mixture. The exo probe typically consist of an oligonucleotide backbone that contains an abasic nucleotide analogue (tetrahydrofuran residue or THF) flanked by a dT-fluorophore and a corresponding dT-quencher group. In a double-stranded context the THF residue presents a substrate for Exonuclease III, which will cleave the probe at the THF position, thereby separating the fluorophore and the quencher and generating a fluorescent signal. Real-time RPA assays had been developed for the detection of a series of important viruses in swine (Wang et al., 2017a,b). In this study, we developed and evaluated the user-friendly on-site detection platform integrating the real-time RPA technology and a field-deployable device (Genie III tube scanner) for the rapid detection of TGEV. The genomic RNA or DNA of TGEV (strain HB-YX), procine epidemic diarrhea virus (PEDV, strain JSCZ1601), porcine rotavirus (PoRV, strain HB-BD/2016), PRCV, porcine deltacoronavirus (PDCoV), Lawsonia intracellularis (strain LX5), porcine circovirus 2 (PCV2, strain HB-MC1) and porcine parvovirus (PPV, strain BJ-2) were kept in our laboratory. Seventy-six small intestinal samples from the piglets with signs of severe watery diarrhea, dehydration were collected from eleven pig farms in Hebei Province between April 2016 and February 2017. The piglets were 7–14 days old. The samples were homogenized with phosphate-buffered saline (PBS, pH 7.4) as a 10% (w/v) suspension and centrifuged for 10 min at 3000 g at 4 °C. Two hundreds microliter of the supernatant was used for RNA extraction using the Trizol Reagent. All the sample RNA were quantified using ND-2000c spectrophotometer (NanoDrop, Wilmington, USA), and were stored at −80 °C until use. The 886bp RT-PCR product encompassing the TGEV-specific S gene was generated from viral genomic RNA extracted from strain HB-YX using F1122 and R1122 primers (Paton et al., 1997). The resulting fragment was ligated into a pGEM-T Easy vector and transformed into E.coli DH5α chemically competent cells according to standard procedures. The in vitro transcribed TGEV standard RNA was produced with RiboMAX Large Scale RNA Production System-T7 (Promega, Madison, USA). The length from the T7 promoter region to the NdeI cut site of the pGEM-T Easy vector is 97 nucleotides, generating a total transcript of 983 nucleotides in length. The in vitro transcripts were quantified using ND-2000c and the copy number of RNA molecules was calculated by the following formula: Amount (copies/μL) = [RNA concentration (g/μL) /(transcript length in nucleotides × 340)] × 6.02 × 1023. The in vitro transcribed RNA was diluted in ten-fold serial dilutions to achieve RNA concentrations ranging from 1.0 × 105 to 1.0 × 10° copies/μL, which were used as the standard RNA for TGEV RT-RPA assay. According to the S gene nucleotides of different TGEVs (accession numbers: AF104420; AF179882; AF302263; AY335548; AF481360; AF494337; HQ462571; M21950; M94099; S51223; Z35758) and PRCVs (accession numbers: KR270796; M94103; M94102; M94098; M94097) available in Genbank, the RT-RPA primers and exo probe were designed to be specific to a portion of the S gene sequences conserved in TGEV but absent in PRCV. The forward primer was: 5´- TTCAGAGGCAAATTGTGGTAATATGCTGTATGGC-3´; the exo probe was: 5´- GCAGATGAGGTTGTTGCTTATTTACATGG(ROX-dT)G(THF)(BHQ2-dT)AGTTACCGTATTAG-C3spacer-3´; the reverse primer was 5´- ACGCATATCACCAAATGTGACAGTGCCAGACCA-3´. The primers and probe were synthesized by a commercial company (Sangon, Shanghai, China), and the length of the amplicon was 139 bp. RT-RPA reactions were performed in a total volume of 50 μL containing 29.5 μL rehydration buffer and 2.5 μL magnesium acetate (280 mM) from the TwistAmpTM RT exo kit (TwistDX, Cambridge, UK). Other components included 420 nM each RPA primer, 120 nM exo probe, and 1 μL of viral RNA or 5 μL sample RNA. The RT-RPA reactions were performed at 40 °C for 20 min in the Genie III scanner device. Ten nanograms of the different pathogen genomic RNA or DNA were used as template in the RT-RPA, and only the TGEV RNA were detected by RT-RPA while the other pathogens were not detected (Fig.1 ). No cross detections were observed in five independent reactions, demonstrating the high specificity of RT-RPA assay for the detection of TGEV. In the analytical sensitivity analysis, the limit of detection (LOD) of the RT-RPA was 1.0 × 102 copies per reaction, which was the same as the real-time RT-PCR (Fig. 2 ). The two-fold serial dilutions of the in vitro transcribed TGEV RNA were made from 1.0 × 103 to 6.25 × 101 copies, and from 1.0 × 102 to 1.25 × 101 copies, respectively. The above two-fold serial dilutions of the TGEV RNA, and 1.0 × 101 copies in vitro transcribed TGEV RNA were further used in the RT-RPA, and the LOD of the assay still was 100 copies per reaction. The threshold time (TT) values were 10.20 min and 10.42 min for 125 copies and 100 copies, while there were no fluorescence amplification curves for 62.5 copies and 50 copies. The RT-RPA assay was performed five times on the quantitative RNA with similar results.
Fig. 1

Analytical specificity of the TGEV RT-RPA assay. RT-RPA was carried out at 40 ℃ for 20 min. The results showed RT-RPA only amplified the TGEV RNA, but not other pathogens tested (n = 5). lane 1,TGEV; lane 2, PEDV; lane 3, PDCoV; lane 4, PoRV; lane 5, PRCV; lane 6, PPV; lane 7, PCV2; lane 8,L. intracellularis.

Fig. 2

Comparative sensitivity of TGEV RT-RPA and real-time RT-PCR assays. The assays were performed using the 10-fold dilution of in vitro transcribed TGEV standard RNA from 1.0 × 105 copies to 1.0 × 10° copies per reaction. The LOD of the RT-RPA was 1.0 × 102 copies. (A) Fluorescence development over time of the RT-RPA. (B) Analytical sensitivity of the real-time RT-PCR. The LOD the real-time RT-PCR was 1.0 × 102 copies, which was the same as that of RT-RPA.

Analytical specificity of the TGEV RT-RPA assay. RT-RPA was carried out at 40 ℃ for 20 min. The results showed RT-RPA only amplified the TGEV RNA, but not other pathogens tested (n = 5). lane 1,TGEV; lane 2, PEDV; lane 3, PDCoV; lane 4, PoRV; lane 5, PRCV; lane 6, PPV; lane 7, PCV2; lane 8,L. intracellularis. Comparative sensitivity of TGEV RT-RPA and real-time RT-PCR assays. The assays were performed using the 10-fold dilution of in vitro transcribed TGEV standard RNA from 1.0 × 105 copies to 1.0 × 10° copies per reaction. The LOD of the RT-RPA was 1.0 × 102 copies. (A) Fluorescence development over time of the RT-RPA. (B) Analytical sensitivity of the real-time RT-PCR. The LOD the real-time RT-PCR was 1.0 × 102 copies, which was the same as that of RT-RPA. For evaluating the potential applicability of the developed RT-RPA assay, 76 clinical samples had RNA extracted and were tested by the RT-RPA and real-time RT-PCR (Vemulapalli et al., 2009). Fourteen samples (18.4%, 14/76) were TGEV RNA positive in the RT-RPA, which were also positive in the real-time RT-PCR. The overall agreement between the RT-RPA and the real-time RT-PCR was 100% (76/76). The basic RPA assay were also performed for the 14 TGEV RNA positive samples using the TwistAmpTM RT Basic kit (TwistDX, Cambridge, UK), and the reaction system was the same as RT-RPA except the exo porbe was not used. The RPA amplification products were sequenced by a commercial company (Sangon, Shanghai, China), then were blasted in the GenBank. The blast results demonstrated that all the sequences showed more than 97.4% homology to TGEV strains in GenBank, which confirmed the good specificity of the RT-RPA assay for TGEV. For the positive samples, it took 4 −12 min in the RT-RPA to see amplification, while it took 37–56 min in the real-time RT-PCR with the Ct values ranging from 25.01 to 37.10. The performance of the RT-RPA was comparable to real-time RT-PCR, and the former is much faster. The threshold time (TT) and cycle threshold (Ct) values of the two assays were respectively well at an R2 value of 0.959 (Fig. 3 ).
Fig. 3

Comparison between performances of TGEV RT-RPA and real-time RT-PCR on clinical samples. Seventy-six RNA extracts of the clinical samples were screened. Linear regression analysis of RT-RPA threshold time (TT) values (y axis) and real-time RT-PCR cycle threshold (Ct) values (x axis) were determined by Prism software. The R2 value was 0.959.

Comparison between performances of TGEV RT-RPA and real-time RT-PCR on clinical samples. Seventy-six RNA extracts of the clinical samples were screened. Linear regression analysis of RT-RPA threshold time (TT) values (y axis) and real-time RT-PCR cycle threshold (Ct) values (x axis) were determined by Prism software. The R2 value was 0.959. The molecular diagnostic assays, which could be suitable for deployment closer to suspect cases of TGE, would be of significant importance in the TGE controlling. Recent advances of the RPA technology on the portable tube scanner device provide a simple, convenient and inexpensive method for the point-of-care (POC) detection of pathogens in clinical samples (Abd El Wahed et al., 2015a,b). In this study, we developed a RT-RPA platform integrating the real-time RPA technology and a tube scanner Genie III for the rapid and sensitive detection of TGEV. Considering the close relationship between TGEV and PRCV, multiple alignment of the TGEV and PRCV S gene sequences were made, and a 561 nucleotide-long region corresponding to sequence between nucleotides 105 and 666 of the TGEV S gene ORF, which is absent from all PRCV strains, was set as the target of RT-RPA. Other TGEV strains were not included in the assay except for the isolated field strain HB-YX, which is the deficiency of this study. The RPA is tolerant to 5–9 mismatches in primer and probe showing no influence on the performance of the assay (Abd El Wahed et al., 2013; Daher et al., 2015), and there were only 1–2 mismatches in this study with other circulating TGEV strains available in GenBank. It is assumed the assay would detect all the circulating strains of TGEV, based on the facts that the RT-RPA assay targeted the conserved S gene of TGEV. The tube scanner Genie III weighs only 1.75 kg and incorporates a rechargeable battery that could support operation for a whole day. It is especially important for TGEV detection in under-equipped laboratories and in the field. The user-friendly on-site detection platform offers an excellent tool for initial screening of clinical specimens for TGEV, which should make valuable contributions to the rapid diagnosis of TGE. The real-time RT-PCR required the expensive thermal cycler (Vemulapalli et al., 2009), and the RT-LAMP were inconvenient to perform due to the agarose gel electrophoresis (Chen et al., 2010; Li and Ren, 2011). The developed RT-RPA assay needed no complicated apparatus, was performed easily and completed within 20 min, showing distinct advantages in terms of equipment requirements, convenience and detection time. In conclusion, a user-friendly on-site detection platform for TGEV was developed. The good analytical specificity and sensitivity, simple and easy operation protocol make the platform ideal for the rapid detection of TGEV in under-equipped laboratories and the promising tool for POC detection of TGEV, especially in the resource-limited settings.

Conflicts of interest

All authors declare that they have no conflicts of interest.
  22 in total

1.  Development of a reverse transcription-nested polymerase chain reaction assay for differential diagnosis of transmissible gastroenteritis virus and porcine respiratory coronavirus from feces and nasal swabs of infected pigs.

Authors:  L Kim; K O Chang; K Sestak; A Parwani; L J Saif
Journal:  J Vet Diagn Invest       Date:  2000-07       Impact factor: 1.279

2.  Field validation of a commercial blocking ELISA to differentiate antibody to transmissible gastroenteritis virus (TGEV) and porcine respiratory coronavirus and to identify TGEV-infected swine herds.

Authors:  Susy Carman; Gaylan Josephson; Beverly McEwen; Grant Maxie; Mioara Antochi; Ken Eernisse; Gopi Nayar; Pat Halbur; Gene Erickson; Ernst Nilsson
Journal:  J Vet Diagn Invest       Date:  2002-03       Impact factor: 1.279

Review 3.  Porcine respiratory coronavirus: molecular features and virus-host interactions.

Authors:  H Laude; K Van Reeth; M Pensaert
Journal:  Vet Res       Date:  1993       Impact factor: 3.683

4.  Emergence of Porcine epidemic diarrhea virus in the United States: clinical signs, lesions, and viral genomic sequences.

Authors:  Gregory W Stevenson; Hai Hoang; Kent J Schwartz; Eric R Burrough; Dong Sun; Darin Madson; Vickie L Cooper; Angela Pillatzki; Philip Gauger; Beverly J Schmitt; Leo G Koster; Mary L Killian; Kyoungjin J Yoon
Journal:  J Vet Diagn Invest       Date:  2013-08-20       Impact factor: 1.279

5.  DNA detection using recombination proteins.

Authors:  Olaf Piepenburg; Colin H Williams; Derek L Stemple; Niall A Armes
Journal:  PLoS Biol       Date:  2006-07       Impact factor: 8.029

6.  Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection.

Authors:  Ahmed Abd El Wahed; Pranav Patel; Oumar Faye; Sasikanya Thaloengsok; Doris Heidenreich; Ponpan Matangkasombut; Khajohnpong Manopwisedjaroen; Anavaj Sakuntabhai; Amadou A Sall; Frank T Hufert; Manfred Weidmann
Journal:  PLoS One       Date:  2015-06-15       Impact factor: 3.240

7.  Solid phase immune electron microscopy for diagnosis of transmissible gastroenteritis in pigs.

Authors:  A P van Nieuwstadt; J B Cornelissen; J Vreeswijk
Journal:  Res Vet Sci       Date:  1988-05       Impact factor: 2.534

8.  Diagnostics-in-a-Suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virus.

Authors:  Ahmed Abd El Wahed; Manfred Weidmann; Frank T Hufert
Journal:  J Clin Virol       Date:  2015-05-19       Impact factor: 3.168

9.  Reverse transcription loop-mediated isothermal amplification for rapid detection of transmissible gastroenteritis virus.

Authors:  Pengchong Li; Xiaofeng Ren
Journal:  Curr Microbiol       Date:  2010-12-02       Impact factor: 2.188

10.  A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

Authors:  Ahmed Abd El Wahed; Ayman El-Deeb; Mohamed El-Tholoth; Hanaa Abd El Kader; Abeer Ahmed; Sayed Hassan; Bernd Hoffmann; Bernd Haas; Mohamed A Shalaby; Frank T Hufert; Manfred Weidmann
Journal:  PLoS One       Date:  2013-08-20       Impact factor: 3.240

View more
  4 in total

1.  Rapid and simple detection of Glaesserella parasuis in synovial fluid by recombinase polymerase amplification and lateral flow strip.

Authors:  Ting-Ting Zhang; Meng-Zhi Liu; Rong-Huan Yin; Long-Quan Yao; Bao-Shan Liu; Ze-Liang Chen
Journal:  BMC Vet Res       Date:  2019-08-14       Impact factor: 2.741

2.  Point-of-care diagnostic assay for rapid detection of porcine deltacoronavirus using the recombinase polymerase amplification method.

Authors:  Lei Ma; Fanwen Zeng; Bihong Huang; Yujun Zhu; Miaoli Wu; Fengjiao Xu; Li Xiao; Ren Huang; Jingyun Ma; Feng Cong; Pengju Guo
Journal:  Transbound Emerg Dis       Date:  2019-04-01       Impact factor: 5.005

3.  Development of a new TaqMan-based real-time RT-PCR assay for the specific detection of bovine kobuvirus.

Authors:  Yuelin Liu; Libing Liu; Jinfeng Wang; Ting Wang; Yaxin Gao; Xiaoxia Sun; Wanzhe Yuan; Ruiwen Li; Jianchang Wang
Journal:  Front Vet Sci       Date:  2022-08-04

Review 4.  Rapid and efficient detection methods of pathogenic swine enteric coronaviruses.

Authors:  Yuguang Fu; Baoyu Li; Guangliang Liu
Journal:  Appl Microbiol Biotechnol       Date:  2020-05-19       Impact factor: 4.813

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.