| Literature DB >> 29541250 |
Yuan Yuan1, Lin Shi2, Shijun Wang3.
Abstract
Cerebroma, a nervous system tumor located in the cranial cavity, seriously affects health and may even become life-threatening. The aim of the study was to investigate and discuss the expression levels of cluster of differentiation 44 (CD44) and Golgi protein 73 (GP73) in different types of cerebroma tissues and to study the correlations of CD44 and GP73. Reverse transcription-polymerase chain reaction (RT-PCR) was used to detect the mRNA expression levels of CD44 and GP73 in four kinds of cerebroma. The immunohistochemical streptavidin-biotin complex (SABC) method was applied to measure the expression levels of CD44 and GP73 in different types of cerebroma. Subsequently, immunofluorescence and western blot analysis were performed to detect the expression levels of CD44 and GP73 in four kinds of cerebroma tissues. Statistical Product and Service Solutions (SPSS) 17.0 software was used to analyze the differences in CD44 and GP73 expression levels of the four kinds of cerebroma tissues and normal brain tissues. Transcription of CD44 and GP73 mRNAs was detected in the four kinds of cerebroma tissues, and CD44 and GP73 proteins were expressed. The immunohistochemical results revealed that the expression levels of CD44 and GP73 in the four kinds of cerebroma were significantly increased compared with those in normal tissues. The immunofluorescence results indicated that both CD44 and GP73 were expressed in four kinds of cerebroma, and the expression of CD44 was higher than that of GP73. The results of analysis of variance showed that the differences in CD44 and GP73 expression levels in the four kinds of cerebroma tissues and normal brain tissues were statistically significant (P<0.01). The results show that the expression levels of CD44 and GP73 are obviously upregulated in four kinds of cerebroma tissues, suggesting that CD44 and GP73 have great value for cerebroma research and can provide a new direction for clinical study as well as the diagnosis and treatment of cerebroma.Entities:
Keywords: CD44; GP73; cerebroma; correlation research
Year: 2018 PMID: 29541250 PMCID: PMC5835860 DOI: 10.3892/ol.2018.7904
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
RT-PCR primer sequences for CD44 and GP73 mRNAs.
| Gene | Primer sequences |
|---|---|
| U: CAGACCTGCCCAATGCCTTTGATGGACC | |
| D: TCCACCTTCTTGACTCCCATGTGAGT | |
| U: CGGGATCCATGATGGGCTTGGGAAACGGGCGTC | |
| D: CGGAATTCTCAGAGTGTATGATTCCGCTTTTCAC | |
| β- | U: GAGCCGGGAAATCGTGCGT |
| D: GGAAGGAAGGCTGGAAGATG |
U, upstream; D, downstream.
Figure 1.Expression levels of CD44 and GP73 genes in the four kinds of cerebroma.
Figure 2.Expression levels of CD44 and GP73 in the four kinds of cerebroma tissues.
Figure 3.Expression levels of CD44 and GP73 in tumor tissues and normal brain tissues [streptavidin-biotin complex (SABC); magnification, ×400].
Expression levels of CD44 and GP73 in tumor tissues and normal brain tissues.
| Positive expression rate | |||||
|---|---|---|---|---|---|
| Proteins | Normal brain tissues | Astrocytoma | Meningioma | Oligodendrocytes | Cholesteatoma |
| CD44 | 4.90±1.20 | 68.40±4.10[ | 62.12±2.13[ | 60.12±6.83[ | 40.12±2.21[ |
| GP73 | 0.02±0.04 | 2.10±0.60[ | 10.03±2.68[ | 7.44±2.10[ | 3.08±0.47[ |
P<0.01 vs. normal brain tissues.
Figure 4.Expression levels of CD44 and GP73 in tumor tissues and normal brain tissues (magnification, ×400).