Literature DB >> 29540836

Genetic variations in the fusion protein of respiratory syncytial virus isolated from children hospitalized with community-acquired pneumonia in China.

Xiangpeng Chen1,2, Baoping Xu2, Jiayun Guo1,2, Changchong Li3, Shuhua An4, Yunlian Zhou5, Aihuan Chen6, Li Deng7, Zhou Fu8, Yun Zhu1,2, Chunyan Liu1,2, Lili Xu1,2, Wei Wang1,2, Kunling Shen9, Zhengde Xie10,11.   

Abstract

To identify the variations in fusion (F) protein gene of RSV in China, a molecular epidemiological study was conducted. A total of 553 RSV positive specimens were collected from 2338 pediatric patients hospitalized with community-acquired pneumonia during a multi-center study conducted during 2014-2016. A total of 252 samples (183 RSV A, 69 RSV B) were selected for F gene sequencing, and analyzed together with 142 F gene sequences downloaded from GenBank. The result showed that all the Chinese RSV A and RSV B strains could be divided respectively into three branches. Compared with RSV A/B prototype sequences respectively, there were significant amino acid (AA) mutations at multiple antigenic sites. For RSV A, changes were found at AA residues 122, 124, 125, 276 and 384, and for RSV B at AA residues 45, 116, 125, 172, 173 and 202. Variations in human histocompatibility leukocyte antigen-restricted CTL epitopes were also observed. In total, 56 amino acid differences for the complete F protein were found between the RSV A and B groups in China, while several mutations were only found in the RSV B strains during 2015-2016. The RSV F gene is relatively conserved in China, however, limited mutations are still occurring with time.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29540836      PMCID: PMC5852162          DOI: 10.1038/s41598-018-22826-4

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Human respiratory syncytial virus (RSV) is a leading pathogen of acute lower respiratory tract infection (ALRTI) among young children[1,2]. RSV caused about 33.8 million new episodes of ALRTI worldwide in children younger than 5 years of age in 2005, which contained at least 3.4 (2.8–4.3) million severe cases necessitating hospital admission. Among these patients, there were roughly 66,000–199,000 deaths, with 99% of them occurring in developing countries[2]. RSV associated illness is also the major cause of hospital admissions and mortality in infants born prematurely or with particular congenital diseases[3]. In China, RSV was also the most frequently detected virus (9.9%) in children younger than 2 years of age with ALRTI, accounting for 17.0%[4]. Except for the therapeutic monoclonal antibody-palivizumab (MedImmune, Gaithersburg, MD, USA)[5], there is no safe and effective vaccine or drugs against RSV available. A suitable vaccine available in the future could have a large impact in public health. The RSV fusion (F) protein is an important transmembrane glycoprotein which mediates the fusion between virus and the target cell membrane[6]. It contains the main antigenic determinants associated with neutralizing antibodies and cytotoxic T-lymphocyte (CTL)-mediated immunity[7-9]. Antigenic sites I, II, IV, ∅, MPE-8 (AM14), α2α3β3β4 and p27 are all present in the F protein[8]. Antigenic site II is the targeted site of palivizumab with the defined binding epitope (residues 262–276)[9]. Many human histocompatibility leukocyte antigen (HLA)-restricted CTL epitopes on the F protein have been identified, such as HLA-A*01, HLA-B*57, HLA-Cw*12[10-12]. The F protein of RSV is the major candidate of vaccine research and the focus of antiviral drug or antibodies development. It is important to elucidate variations in these epitopes of F protein. However, there has been no multi-center study of RSV F protein in China to date. There were few data of RSV F molecular variations available, especially the binding site of palivizumab. The present multi-center prospective study was conducted to clarify the genetic characteristics and variations in antigenic determinants of the F protein of the prevalent genotypes present in the mainland of China.

Results

The samples

In this study, a total of 553 (23.65%) RSV positive samples were identified from 2338 enrolled patients between November 2014 and June 2016 from 10 hospitals located in Beijing, Chongqing, Jilin, Hebei, Ningxia, Zhejiang, and Guangdong provinces in China. The ages of these patients ranged from 1 month to 8.5 years with a median age of 1 year. The male-to-female ratio was 2:1 (369 boys and 184 girls). For these 553 RSV positive samples, 366 (66.18%) were identified as RSV genotype A (RSV A), 176 (31.83%) were identified as RSV B, and 11 (1.99%) were identified as both RSV A and B). A total of 252 complete F gene sequences were obtained from 553 RSV positive samples, while the complete F gene sequences of 301 samples were not available because of poor sequence data quality.

Phylogenetic analysis

A total of 394 RSV F gene complete sequences were analyzed in this study, including 252 complete F gene sequences obtained (183 RSV A and 69 RSV B) in this study, and 142 reference sequences (including Long, CH18537, and 140 Chinese RSV F sequences) available from GenBank. Except the prototype sequences of Long and CH18537 strain, pairwise nucleotide (amino acid) sequences identities were 94.3%–100% (96.1%–100%) among 300 RSV A; 96.5%–100% (97.9%–100%) among 92 RSV B; and 81.2%–82.7% (88.3%–90.9%) between groups A and B. Compared with the prototype strains Long (for RSV A) and CH18537 (RSV B), the mean distances were 0.049 for RSV A, and 0.034 for RSV B, respectively. The P-distance between RSV B and the prototype Long strain was 0.204. All the Chinese RSV A strains could be stratified into A1, A2 and A3 branches. The mean genetic distances were 0.048, 0.049 and 0.035 between A1 and A2, A1 and A3, A2 and A3 respectively. RSV B strains could also be divided into three branches, with low genetic distance (0.027 between B1 and B2, 0.029 between B1 and B3, 0.012 between B2 and B3). Apart from the strains collected during 2010–2013, most of the strains isolated between 2014 and 2016 belonged to the A3 and B3 branches (Fig. 1).
Figure 1

The phylogenetic dendrogram based on the alignments of the 120 representative RSV F gene complete sequences was constructed with MEGA5.03 software. Panels (A and B) are detailed phylogenetic trees of the RSV A and RSV B taxa analyzed, respectively. The neighbour-joining method was used to infer the topology. The percentage of bootstrap (percentage of 1000 pseudoreplicate datasets) replicates supporting the trees are indicated at the nodes (for clarity, only values over 70% are shown). Squares indicate the prototypes RSV A Long and RSV B CH18537 strains. Filled circles indicate the strains from this study during 2014–2016. The scale bars represent substitutions per base pair per the indicated horizontal distance.

The phylogenetic dendrogram based on the alignments of the 120 representative RSV F gene complete sequences was constructed with MEGA5.03 software. Panels (A and B) are detailed phylogenetic trees of the RSV A and RSV B taxa analyzed, respectively. The neighbour-joining method was used to infer the topology. The percentage of bootstrap (percentage of 1000 pseudoreplicate datasets) replicates supporting the trees are indicated at the nodes (for clarity, only values over 70% are shown). Squares indicate the prototypes RSV A Long and RSV B CH18537 strains. Filled circles indicate the strains from this study during 2014–2016. The scale bars represent substitutions per base pair per the indicated horizontal distance.

Variation analysis

There were 83 nucleotide changes in RSV A and 59 nucleotide changes in RSV B fusion protein genes, and 298 nucleotide differences were observed between RSV A and B. All nucleotide mutations were base substitutions, the majority of which resulted in synonymous amino acid changes. The amino acid of the F proteins were relatively conserved. In contrast, there were 15 and 18 significant amino acid changes in RSV A and B, compared with their respective reference strains, while 56 amino acid differences were found between the two groups. Variations at the antigenic site areas were analyzed (Table 1). For RSV A, amino acid changes were found at: antigenic site I in AA residue 384 (V → I, 99.3%); antigenic site p27 in amino residues 122 (T → A, 4.3%), 124 (K → N, 100%) and 125 (T → N, 0.6%). For RSV B, amino acid changes were found at: antigenic site p27 in AA residues 116 (N → D, 3.3%) and 125 (L → P, 3.3%); antigenic site α2α3β3β4 in AA residues 172 (L → Q, 91.3%) and 173 (S → L, 73.9%); antigenic site MPE8 in AA residues 45 (F → L, 94.6%). The change of 276 (N → S) on palivizumab binding site of antigenic site II was observed in 98.0% RSV A and all the RSV B strains. The change at antigenic site α2α3β3β4 in AA residue 173 (S → L, 73.9%) was only found in the RSV B strains during 2015–2016. For the AA residue 202 of antigenic site ∅, all sequences except CH18537 were glutamine.
Table 1

Amino acid changes in antigenic sites and Cytotoxic T lymphocyte (CTL) epitopes of the fusion gene of RSV A (n = 300) and RSV B (n = 92) comparing with the prototype Long and CH18537 strains.

Antigenic SiteAARSV A & LongRSV B & LongRSV B & CH18537Between RSV A & B
VaF (%)VF (%)VF (%)VF (%)
I 380–400N380S100N380S100
V384I99.3V384T100V, I384T100
P389S100P389S100
II254–277N276S98.0N276S100N276S2.0
III422–438
62–69, 196–210N67T100N67T100
D200N100D200N100
K201N, S97.8, 2.2K201N, S100
R202Q100
K209Q91.3K209Q91.3
p27109–136L111A100L111A100
R113Q100R113Q100
F114Y100F114Y100
N116D3.3bN116D3.3bN116D3.3
L119I100L119I100
N121T100N121T100
T122A4.3A122T4.3
K124N100K124N100
T125N0.6T125L, P96.7, 3.3L125P3.3T, N125L, P100
T128S100T128S100
L129I100L129I100
α2α3β3β4(AM14)148–194S169N100S169N100
L172Q91.3L172Q91.3L172Q91.3
S173L73.9bS173L73.9bS173L73.9b
MPE844–50, 305–310L45F5.4F45L94.6L45F5.4
L305I100L305I100
HLA-A*01109–118L111A100L111A100
R113Q100R113Q100
F114Y100F114Y100
N116D3.3bN116D3.3bN116D3.3b
HLA-B*57106–114L111A100L111A100
R113Q100R113Q100
F114Y100F114Y100
HLA-Cw*12542–550V544I100V544I100
L547F1.3L547M2.2L547M2.2F547M1.5
HLA-A*020110–18,191–199,250–258,533–544A10T2.3T10A2.3
T12F100T12F100
T13L100T13L100
I14T100I14T100
L15F3.3bL15F3.3b
A17I100V17I100A17I100
V18I98.3V18N100V, I 18N100
I537V100I537V100
S540A98.0A540S98.0
V544I98.9V544I98.9

Notes. aA position B, the amino acid of this site have a change from A to B; bAll from 2015–16.

Abbreviations: AA, amino acids; F, frequency; V, variation.

Amino acid changes in antigenic sites and Cytotoxic T lymphocyte (CTL) epitopes of the fusion gene of RSV A (n = 300) and RSV B (n = 92) comparing with the prototype Long and CH18537 strains. Notes. aA position B, the amino acid of this site have a change from A to B; bAll from 2015–16. Abbreviations: AA, amino acids; F, frequency; V, variation. Mutations were also observed in the human histocompatibility leukocyte antigen (HLA) -restricted CTL epitopes. For RSV A, two amino acid residue substitutions were observed in over 98% of the strains in the HLA-A*0201 epitope, while the amino residue mutations 10 (A → T) in the HLA-A*0201 epitope, and 547 (L → F) in the HLA-Cw*12 epitope, were only found in 7 and 4 of the RSV A strains, respectively. For RSV B, comparing with the CH18537 strain, one mutation 17 (V → I) in HLA-A*0201 was observed among all the Chinese RSV B strains. The AA residue 15 (L → F) substitution in HLA-A*0201 and the 116 (N → D) in HLA-A*01 restricted epitopes were only observed in three strains between 2015 and 2016. The AA residue 547 (L → M) substitution in HLA-Cw*12 restricted epitopes was only observed in two strains.

Discussion

The F protein of RSV is the significant candidate for RSV vaccine and antibody development. Although it is relatively conserved, many variations were found in F gene among different clinical strains, especially between RSV subtypes. Few data about the molecular epidemiology of RSV F gene is available in China. In this multi-center prospective study, 2338 patients were enrolled from 7 provinces of China during December 2014–June 2016. A total of 553 patients with RSV infection were identified. RSV A was the predominant subtype which was detected from 366 (66.18%) samples, while the RSV B strains (176, 31.83%) detection was slightly lower. The RSV F complete gene was amplified and sequenced from 252 clinical samples. All Chinese RSV F sequences after 2010 available from GenBank were also analyzed in this study. The sequence identities within Chinese RSV A and B were more than 94.3% and 96.5% at the nucleotide level, more than 96.1% and 97.9% at the AA level, respectively. The sequence identities, including nucleotide and amino acid level, were lower than that reported by Xia et al.[7]. It might be due to the longer time and wider geographical distributions. The phylogenetic analyses showed that the RSV A strains from different regions of China between 2014 and 2016 were slightly clustered into the same branches, while the same temporal pattern of clusters of isolates was observed in RSV B. There were a few AA changes in the antigenic sites of RSVA and RSVB by comparing with their historical Long and CH18537 strains, respectively. These changes contain the substitutions of basic/acidic AA (K124N, R202Q, N116D), hydrophilic/hydrophobic AA (L172Q, S173L), and replacement of heterocyclic AA (L125P). These changes might alter the secondary structure of the protein, which are much more likely to change the antigenic appearance. However, further study is required for identifying the contributions of these non-synonymous AA changes. RSV F protein has metastable and stable states, which corresponds to the prefusion and postfusion respectively. The prefusion F protein on the surface of the virus plays the function of driving membrane fusion between the viral envelope and the host cell. The prefusion F protein undergoes a dramatic conformational change at the initiation of fusion, which results a very stable postfusion form[13]. RSV neutralization activity in human sera is primarily directed against the antigenic sites on the prefusion F protein[14]. Comparing with the historical CH18537 strain, the antigenic sites of RSV B prefusion F protein (∅, MPE-8, α2α3β3β4 (AM14), and p27) were relatively much more variable than the postfusion F protein. The amino acid of the antigenic sites between RSV A and B were high variable. There were 23 amino acid changes between RSV A and B. These results may suggest that a monovalent vaccine based on the F protein of RSV A may not provide enough protection against infections caused by RSV B. This will be an important consideration for the development of the therapeutic monoclonal antibody or small molecular drugs. The p27 is cleaved during the infection of cells and internalization of the virus. The cleavage of p27 is an important event to enable full infection of the virus[15], and is also a proven significant antigenic site[16]. Indeed, the p27 was the most variable antigenic site between RSV A and –B in this study. However, within each group, RSV A and RSV B are relatively conserved compared with their respective reference strains. These results suggest that the p27 antigenic site is responsible for group specificity, which is consistent with previous study[8]. It is interesting that the change at antigenic site α2α3β3β4 in AA residue 173 (S → L) was only found in 97.1% (67/69) of RSV B strains in China during 2015–2016. This was a new antigenic site change in clinical strains from China, however it was not found in RSV B before 2014 or in RSV A strains. This is not a resistance mutation under pressure, since no drugs or antibodies targeting this antigenic site was used. It might suggest that the change is due to the antigenic drift of the viruses and has become the predominant strain. Few data on antigenic site α2α3β3β4 was available. The potential effect of this change needs further study. Palivizumab is the only licensed monoclonal antibody for the prevention of severe RSV infection. The binding site of palivizumab is located on the antigenic sites II, which existed in both the prefusion and postfusion forms of F protein. There were many reports about the change of 276 (N → S), which was proved to be a non-resistance mutation to palivizumab[7,17]. The change of 276 (N → S) was also observed in 98.0% RSV A and all the RSV B strains in this study. Consistent with the report of Xia et al.[7], the percentage of strains with 276 (N → S) substitution in the F protein is increasing, accounted for 99% of RSV after 2014. The residues 262, 272, 275 are very important sites at which mutations could confer resistance to palivizumab[17]. No other change was observed in this study except the 276 (N → S) substitution. No resistance-associated mutations of natural polymorphisms or selection pressure to palivizumab were found in the RSV strains of China. The amino acid variations at the CTL epitopes were also significant for RSV vaccine design and to understand the mechanism the virus uses to escape immunosurveillance[11]. The CTL epitopes were conserved within the groups in this study. Almost all the variations constituted inter-group differences, except for residues 18 (V → I) and 540 (S → A) in RSV A, and 17 (V → I) in RSV B. The AA residue 15 (L → F) substitution in HLA-A*0201 and the 116 (N → D) in HLA-A*01 restricted epitopes were first observed in three strains between 2015 and 2016. Continuous monitoring is needed to investigate the development of these mutations; and further studies are needed to illustrate the effect of these variations on recognition of CTL cells. In conclusion, this is the first multi-center molecular epidemiologic study of the RSV F gene in China. The result revealed that the RSV F genes share relatively high identity in China. However, genetic variations temporally were also observed. The alterations of 276 (N → S) were observed in the majority of RSV A strains. The genetic variations of 173 (S → L) at antigenic site α2α3β3β4 and 15(L → F), 116 (N → D) at CTL epitopes were first identified in the RSV B strains during 2015–16. The F protein of RSV in the mainland of China is relatively conserved and remains the potential candidate target for vaccine and drug development.

Methods

Ethics statement

This study was approved by the Medical Ethics Committee of the Beijing Children’s Hospital affiliated to Capital Medical University, and informed consent was obtained. All procedures were conducted according to the guidelines.

Sample collection

Between November 2014 and June 2016, RSV positive respiratory samples were collected from patients hospitalized with community-acquired pneumonia (CAP) in a multi-centers study that involved 10 hospitals of 7 provinces or municipalities (Beijing, Chongqing, Jilin, Hebei, Ningxia, Zhejiang, and Guangdong) in China. Eligible participants were younger than 18 years. Nasopharyngeal aspirates or throat swabs were collected on admission. The specimens were frozen at −80 °C until tested by a multiplex PCR/DNA hybridization assay that detect RSV A, RSV B, and 16 other respiratory viruses (xTAG RVP Kit; Luminex, Toronto, Ontario, Canada).

RNA extraction and sequence determination for RSV F gene

Total RNA from RSV positive clinical samples were extracted by using QIAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The complete F gene sequences were obtained by segmented amplification and sequencing. Two fragments were amplified by SuperScript™ III One-Step RT-PCR System (Invitrogen, Carlsbad CA, USA, cat: 12574018), respectively. The primer pairs A-F1/R1 (A-F1: CTCAAGTCTCCACAACATCCGA; A-R1: GGGAAGAAAGATACTGATCCTGCAT) and F2/R2 (F2: ATGCCTATAACAAATGATCAGAAAAAGTT; R2: GCAATGACCTCGAATTTCAAATT) were used to amplify and sequence the nucleotides of the F gene of RSV A samples, while the primer pairs B-F1/R1 (B-F1: CACAAACACCCACAGCATCCGA; B-R1: GGAAAGAAGGATACTGATCCTGCAT) and F2/R2 were used to amplify and sequence the nucleotides of the F gene of RSV B samples. The sequences were edited and assembled by using Sequencher software version 5.0 (Gene Codes, Ann Arbor, MI, USA). The sequences generated in this study were submitted to GenBank with the accession numbers from MF978510 to MF978761.

Other RSV F gene sequences used in this study

All (140) Chinese RSV F gene reference sequences (117 RSV A and 23 RSV B) from Jan 2010 to June 2017, as well as the prototype sequences of RSV A and B genotypes were downloaded from GenBank. Information of the sequences downloaded from GenBank is shown in the Supplementary Table 1.

Phylogenetic and genetic diversity analysis

Multiple sequence alignments, phylogenetic analyses and pairwise distance were conducted and calculated by using MEGA 5.03 software (Sudhir Kumar, Arizona State University, Tempe, AZ, USA). The phylogenetic tree was generated with the neighbor-joining method and the Kimura 2-parameter model was chosen with pairwise deletion treatment for the missing and gaps data. The reliability of phylogenetic inference was estimated by using the bootstrap method with 1000 replicates, while only the values over 70% are shown. The sequences identities and genetic diversity of the complete F gene were determined with BioEdit software. Table S1
  17 in total

1.  HLA class I-restricted cytotoxic T-cell epitopes of the respiratory syncytial virus fusion protein.

Authors:  A H Brandenburg; L de Waal; H H Timmerman; P Hoogerhout; R L de Swart; A D Osterhaus
Journal:  J Virol       Date:  2000-11       Impact factor: 5.103

2.  Efficacy and optimization of palivizumab injection regimens against respiratory syncytial virus infection.

Authors:  Alexander Gutfraind; Alison P Galvani; Lauren Ancel Meyers
Journal:  JAMA Pediatr       Date:  2015-04       Impact factor: 16.193

3.  Identification of a novel human leucocyte antigen-A*01-restricted cytotoxic T-lymphocyte epitope in the respiratory syncytial virus fusion protein.

Authors:  Michael T Rock; James E Crowe
Journal:  Immunology       Date:  2003-04       Impact factor: 7.397

4.  Respiratory syncytial virus-neutralizing monoclonal antibodies motavizumab and palivizumab inhibit fusion.

Authors:  Kelly Huang; Len Incognito; Xing Cheng; Nancy D Ulbrandt; Herren Wu
Journal:  J Virol       Date:  2010-06-02       Impact factor: 5.103

5.  Detection of respiratory syncytial virus fusion protein variants between 2009 and 2012 in China.

Authors:  Qiuling Xia; Lili Zhou; Caijing Peng; Rui Hao; Ke Ni; Na Zang; Luo Ren; Yu Deng; Xiaohong Xie; Linli He; Daiyin Tian; Lijia Wang; Ailong Huang; Yao Zhao; Xiaodong Zhao; Zhou Fu; Wenwei Tu; Enmei Liu
Journal:  Arch Virol       Date:  2013-12-03       Impact factor: 2.574

Review 6.  Review of epidemiology and clinical risk factors for severe respiratory syncytial virus (RSV) infection.

Authors:  Robert C Welliver
Journal:  J Pediatr       Date:  2003-11       Impact factor: 4.406

Review 7.  Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study.

Authors:  Ting Shi; David A McAllister; Katherine L O'Brien; Eric A F Simoes; Shabir A Madhi; Bradford D Gessner; Fernando P Polack; Evelyn Balsells; Sozinho Acacio; Claudia Aguayo; Issifou Alassani; Asad Ali; Martin Antonio; Shally Awasthi; Juliet O Awori; Eduardo Azziz-Baumgartner; Henry C Baggett; Vicky L Baillie; Angel Balmaseda; Alfredo Barahona; Sudha Basnet; Quique Bassat; Wilma Basualdo; Godfrey Bigogo; Louis Bont; Robert F Breiman; W Abdullah Brooks; Shobha Broor; Nigel Bruce; Dana Bruden; Philippe Buchy; Stuart Campbell; Phyllis Carosone-Link; Mandeep Chadha; James Chipeta; Monidarin Chou; Wilfrido Clara; Cheryl Cohen; Elizabeth de Cuellar; Duc-Anh Dang; Budragchaagiin Dash-Yandag; Maria Deloria-Knoll; Mukesh Dherani; Tekchheng Eap; Bernard E Ebruke; Marcela Echavarria; Carla Cecília de Freitas Lázaro Emediato; Rodrigo A Fasce; Daniel R Feikin; Luzhao Feng; Angela Gentile; Aubree Gordon; Doli Goswami; Sophie Goyet; Michelle Groome; Natasha Halasa; Siddhivinayak Hirve; Nusrat Homaira; Stephen R C Howie; Jorge Jara; Imane Jroundi; Cissy B Kartasasmita; Najwa Khuri-Bulos; Karen L Kotloff; Anand Krishnan; Romina Libster; Olga Lopez; Marilla G Lucero; Florencia Lucion; Socorro P Lupisan; Debora N Marcone; John P McCracken; Mario Mejia; Jennifer C Moisi; Joel M Montgomery; David P Moore; Cinta Moraleda; Jocelyn Moyes; Patrick Munywoki; Kuswandewi Mutyara; Mark P Nicol; D James Nokes; Pagbajabyn Nymadawa; Maria Tereza da Costa Oliveira; Histoshi Oshitani; Nitin Pandey; Gláucia Paranhos-Baccalà; Lia N Phillips; Valentina Sanchez Picot; Mustafizur Rahman; Mala Rakoto-Andrianarivelo; Zeba A Rasmussen; Barbara A Rath; Annick Robinson; Candice Romero; Graciela Russomando; Vahid Salimi; Pongpun Sawatwong; Nienke Scheltema; Brunhilde Schweiger; J Anthony G Scott; Phil Seidenberg; Kunling Shen; Rosalyn Singleton; Viviana Sotomayor; Tor A Strand; Agustinus Sutanto; Mariam Sylla; Milagritos D Tapia; Somsak Thamthitiwat; Elizabeth D Thomas; Rafal Tokarz; Claudia Turner; Marietjie Venter; Sunthareeya Waicharoen; Jianwei Wang; Wanitda Watthanaworawit; Lay-Myint Yoshida; Hongjie Yu; Heather J Zar; Harry Campbell; Harish Nair
Journal:  Lancet       Date:  2017-07-07       Impact factor: 79.321

8.  Sequence variability of the respiratory syncytial virus (RSV) fusion gene among contemporary and historical genotypes of RSV/A and RSV/B.

Authors:  Anne M Hause; David M Henke; Vasanthi Avadhanula; Chad A Shaw; Lorena I Tapia; Pedro A Piedra
Journal:  PLoS One       Date:  2017-04-17       Impact factor: 3.240

9.  Host cell entry of respiratory syncytial virus involves macropinocytosis followed by proteolytic activation of the F protein.

Authors:  Magdalena Anna Krzyzaniak; Michael Thomas Zumstein; Juan Atilio Gerez; Paola Picotti; Ari Helenius
Journal:  PLoS Pathog       Date:  2013-04-11       Impact factor: 6.823

10.  Viral etiologies of hospitalized acute lower respiratory infection patients in China, 2009-2013.

Authors:  Luzhao Feng; Zhongjie Li; Shiwen Zhao; Harish Nair; Shengjie Lai; Wenbo Xu; Mengfeng Li; Jianguo Wu; Lili Ren; Wei Liu; Zhenghong Yuan; Yu Chen; Xinhua Wang; Zhuo Zhao; Honglong Zhang; Fu Li; Xianfei Ye; Sa Li; Daniel Feikin; Hongjie Yu; Weizhong Yang
Journal:  PLoS One       Date:  2014-06-19       Impact factor: 3.240

View more
  9 in total

1.  Sequence Analysis of the Fusion Protein Gene of Human Respiratory Syncytial Virus Circulating in China from 2003 to 2014.

Authors:  Jinhua Song; Huiling Wang; Teresa I Ng; Aili Cui; Shuangli Zhu; Yanzhi Huang; Liwei Sun; Zifeng Yang; Deshan Yu; Pengbo Yu; Hong Zhang; Yan Zhang; Wenbo Xu
Journal:  Sci Rep       Date:  2018-12-04       Impact factor: 4.379

2.  Emergence of new antigenic epitopes in the glycoproteins of human respiratory syncytial virus collected from a US surveillance study, 2015-17.

Authors:  Hui Liu; David E Tabor; Andrey Tovchigrechko; Yanping Qi; Alexey Ruzin; Mark T Esser; Hong Jin
Journal:  Sci Rep       Date:  2019-03-07       Impact factor: 4.379

3.  Characterization of human respiratory syncytial virus (RSV) isolated from HIV-exposed-uninfected and HIV-unexposed infants in South Africa during 2015-2017.

Authors:  Hui Liu; Bin Lu; David E Tabor; Andrey Tovchigrechko; Deidre Wilkins; Hong Jin; Shabir A Madhi; Nasiha Soofie; Mark T Esser; Marta C Nunes
Journal:  Influenza Other Respir Viruses       Date:  2020-03-03       Impact factor: 4.380

4.  Detailed Evolutionary Analyses of the F Gene in the Respiratory Syncytial Virus Subgroup A.

Authors:  Mariko Saito; Hiroyuki Tsukagoshi; Mitsuru Sada; Soyoka Sunagawa; Tatsuya Shirai; Kaori Okayama; Toshiyuki Sugai; Takeshi Tsugawa; Yuriko Hayashi; Akihide Ryo; Makoto Takeda; Hisashi Kawashima; Nobuhiro Saruki; Hirokazu Kimura
Journal:  Viruses       Date:  2021-12-15       Impact factor: 5.048

5.  Intranasal vaccination with a recombinant protein CTA1-DD-RBF protects mice against hRSV infection.

Authors:  Hai Li; Hu Ren; Yan Zhang; Lei Cao; Wenbo Xu
Journal:  Sci Rep       Date:  2021-09-20       Impact factor: 4.379

6.  Suptavumab for the Prevention of Medically Attended Respiratory Syncytial Virus Infection in Preterm Infants.

Authors:  Eric A F Simões; Eduardo Forleo-Neto; Gregory P Geba; Mohamed Kamal; Feng Yang; Helen Cicirello; Matthew R Houghton; Ronald Rideman; Qiong Zhao; Sarah L Benvin; Alicia Hawes; Erin D Fuller; Elzbieta Wloga; Jose M Novoa Pizarro; Flor M Munoz; Scott A Rush; Jason S McLellan; Leah Lipsich; Neil Stahl; George D Yancopoulos; David M Weinreich; Christos A Kyratsous; Sumathi Sivapalasingam
Journal:  Clin Infect Dis       Date:  2021-12-06       Impact factor: 9.079

Review 7.  Chinese expert consensus on immunoprophylaxis of common respiratory pathogens in children (2021 edition).

Authors:  Zifeng Yang; Tiejian Feng; Wenda Guan; Jianfeng He; Rongmeng Jiang; Gang Liu; Gen Lu; Quan Lu; Adong Shen; Lihong Sun; Xiaodong Sun; Yonghong Yang; Mei Zeng; Jiushun Zhou; Kunling Shen; Nanshan Zhong
Journal:  J Thorac Dis       Date:  2022-03       Impact factor: 2.895

8.  Influenza A Virus Inhibits RSV Infection via a Two-Wave Expression of IFIT Proteins.

Authors:  Yaron Drori; Jasmine Jacob-Hirsch; Rakefet Pando; Aharona Glatman-Freedman; Nehemya Friedman; Ella Mendelson; Michal Mandelboim
Journal:  Viruses       Date:  2020-10-16       Impact factor: 5.048

9.  HRSV prefusion-F protein with Adju-Phos adjuvant induces long-lasting Th2-biased immunity in mice.

Authors:  Hai Li; Hu Ren; Yangzi Zhou; Yan Zhang; Lei Cao; Wenbo Xu
Journal:  PLoS One       Date:  2022-01-31       Impact factor: 3.240

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.