| Literature DB >> 29535711 |
Zhaoqun Liu1,2,3, Lingling Wang1,2, Zhao Lv3,4, Zhi Zhou5, Weilin Wang1, Meijia Li3,4, Qilin Yi1, Limei Qiu3, Linsheng Song1,2.
Abstract
It is becoming increasingly clear that neurotransmitters impose direct influence on regulation of the immune process. Recently, a simple but sophisticated neuroendocrine-immune (NEI) system was identified in oyster, which modulated neural immune response via a "nervous-hemocyte"-mediated neuroendocrine immunomodulatory axis (NIA)-like pathway. In the present study, the de novo synthesis of neurotransmitters and their immunomodulation in the hemocytes of oyster Crassostrea gigas were investigated to understand the autocrine/paracrine pathway independent of the nervous system. After hemocytes were exposed to lipopolysaccharide (LPS) stimulation, acetylcholine (ACh), and norepinephrine (NE) in the cell supernatants, both increased to a significantly higher level (2.71- and 2.40-fold, p < 0.05) comparing with that in the control group. The mRNA expression levels and protein activities of choline O-acetyltransferase and dopamine β-hydroxylase in hemocytes which were involved in the synthesis of ACh and NE were significantly elevated at 1 h after LPS stimulation, while the activities of acetylcholinesterase and monoamine oxidase, two enzymes essential in the metabolic inactivation of ACh and NE, were inhibited. These results demonstrated the existence of the sophisticated intracellular machinery for the generation, release and inactivation of ACh and NE in oyster hemocytes. Moreover, the hemocyte-derived neurotransmitters could in turn regulate the mRNA expressions of tumor necrosis factor (TNF) genes, the activities of superoxide dismutase, catalase and lysosome, and hemocyte phagocytosis. The phagocytic activities of hemocytes, the mRNA expressions of TNF and the activities of key immune-related enzymes were significantly changed after the block of ACh and NE receptors with different kinds of antagonists, suggesting that autocrine/paracrine self-regulation was mediated by transmembrane receptors on hemocyte. The present study proved that oyster hemocyte could de novo synthesize and release cholinergic and adrenergic neurotransmitters, and the hemocyte-derived ACh/NE could then execute a negative regulation on hemocyte phagocytosis and synthesis of immune effectors with similar autocrine/paracrine signaling pathway identified in vertebrate macrophages. Findings in the present study demonstrated that the immune and neuroendocrine system evolved from a common origin and enriched our knowledge on the evolution of NEI system.Entities:
Keywords: Crassostrea gigas; autocrine/paracrine; hemocyte; immune regulation; membrane receptor; neurotransmitter
Mesh:
Substances:
Year: 2018 PMID: 29535711 PMCID: PMC5834419 DOI: 10.3389/fimmu.2018.00284
Source DB: PubMed Journal: Front Immunol ISSN: 1664-3224 Impact factor: 7.561
Sequences of the primers used in the experiment.
| Primer | Sequence (5′-3′) | Sequence information |
|---|---|---|
| P1 (forward) | CGCAATGGTCGCTTGGTGGTC | Real-time CgTNF (CGI_10005109) primer |
| P2 (reverse) | CGTAGGGGCGGAAGGTCTCG | Real-time CgTNF (CGI_10005109) primer |
| P3 (forward) | CAACGGTCTAACTTACCATCCAAAC | Real-time CgTNF (CGI_10005110) primer |
| P4 (reverse) | TGGTGGTAGATAAAATGGGACAGTG | Real-time CgTNF (CGI_10005110) primer |
| P5 (forward) | ATTGGAGCACCTGGAGGATAAG | Real-time CgTNF (CGI_10006440) primer |
| P6 (reverse) | CAGTCTTCCGTGCTGGTATTTC | Real-time CgTNF (CGI_10006440) primer |
| P7 (forward) | TGAGTCCAGATTCCTTTATCCAGTTAG | Real-time CgChAT (CGI_10023267) primer |
| P8 (reverse) | TCCAAAGCATCTGGGGTGTTAG | Real-time CgChAT (CGI_10023267) primer |
| P9 (forward) | GGTAATAACGAAAGGAAACGAAG | Real-time CgDBH (CGI_10027734) primer |
| P10 (reverse) | CACCGATAACTTCCCGACAC | Real-time CgDBH (CGI_10027734) primer |
| P11 (forward) | ACCTATTCAATCATCGCTCCTCC | Real-time CgAChE (CGI_10019411) primer |
| P12 (reverse) | TCTCTTTATACGTGTGAAGGGGC | Real-time CgAChE (CGI_10019411) primer |
| P13 (forward) | AGACAACTGATGGAGTGACGGTG | Real-time CgMAO (CGI_10022845) primer |
| P14 (reverse) | TCCAAAAAGGGGTCTTGTAGTAGC | Real-time CgMAO (CGI_10022845) primer |
| P15 (forward) | ATCCTTCCTCCATCTCGTCCT | Real-time CgEF (CGI_10012474) primer |
| P16 (reverse) | GGCACAGTTCCAATACCTCCA | Real-time CgEF (CGI_10012474) primer |
| M13-47 | CGCCAGGGTTTTCCCAGTCACGAC | pMD18-T simple vector primer |
| RV-M | GAGCGGATAACAATTTCACACAGG | pMD18-T simple vector primer |
| P17 (forward) | GGCCACGCGTCGACTAGTACT17 | Oligo(dT)-adaptor |
Figure 1Release of acetylcholine (Ach) and norepinephrine (NE) from oyster hemocytes and the presence of ACh/NE-producing enzymes in hemocytes. (A,B) After isolation and primary cell culture, hemocytes were incubated with 100 ng mL−1 of lipopolysaccharide (LPS) in vitro, while the same volume of PBS was added in the negative control (Neg-Ctrl) group. Hemocytes incubated with Leibovitz-15 (L-15) medium for 1 h and subsequently with LPS stimulation were employed as Vehicle group. Cellular supernatant fluids were collected as a function of time thereafter and then analyzed by enzyme-linked immunosorbent assay for acetylcholine (A) and norepinephrine (B). (C–H) After stimulation with 100 ng mL−1 of LPS in vitro, mRNA from hemocytes were sampled and subjected to real-time PCR analysates for choline O-acetyltransferase (C), dopamine beta-hydroxylase (D), acetylcholinesterase (G), and monoamine oxidase (H). (E,F,I,J), After stimulation with 100 ng mL−1 of LPS in vitro, protein from hemocytes were extracted and subjected to enzyme activity measurement of choline O-acetyltransferase (E), dopamine beta-hydroxylase (F), acetylcholinesterase (I), and monoamine oxidase (J). Each bar represents N = 6 samples. All data are presented as means ± SD.
Figure 2Transmembrane receptors mediate the immune regulation of hemocyte-derived acetylcholine (Ach) and norepinephrine (NE). The immune response (represented by hemocyte phagocytic activity) was induced by lipopolysaccharide (LPS). Adrenoceptors (A), muscarinic (B), and nicotinic (C) Ach receptors were blocked pharmacologically to explore their functions in mediating immune regulation of hemocyte-derived ACh and NE. Each bar represents N = 6 samples. All data are presented as mean ± SD. Asterisks indicate statistical significance comparing with the vehicle control.
Figure 3Hemocyte-derived acetylcholine and norepinephrine regulate cellular and humoral immunity. (A–C) After stimulation with 100 ng mL−1 of lipopolysaccharide (LPS) in vitro, mRNA from hemocytes were sampled and subjected to real-time PCR analysates for three oyster tumor necrosis factor genes, CGI_10005109 (A), CGI_10005110 (B), and CGI_10006440 (C). (D–F) After stimulation with 100 ng mL−1 of LPS in vitro, protein from hemocytes were extracted and subjected to enzyme activity measurement of superoxide dismutase (D), catalase (E), and lysosome (F). Each bar represents N = 6 samples. All data are presented as mean ± SD. Asterisks indicate statistical significance comparing with the vehicle control.
Figure 4Immunomodulation mediated by hemocyte-derived cholinergic and adrenergic neurotransmitters. Oyster hemocytes should represent similar immune and neuroendocrine functions as their counterparts in vertebrates (e.g., macrophages) and play an indispensable role in autocrine/paracrine immunomodulation, demonstrating that they could serve as suitable model for the study of the origin and evolution of the immune cells.